Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplementary Information Supplementary Methods Sequences of
Document related concepts
no text concepts found
Transcript
Supplementary Information Supplementary Methods Sequences of nucleic acids used for assembly of elongation complexes (EC13s). Note that some complexes were walked to various positions before reactions in them were assessed. WT NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA +1A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGAACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCTTGTGCCGCTTATCGGT UAAUCGAGAGG AA +1C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGCACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCGTGTGCCGCTTATCGGT UAAUCGAGAGG AA +1T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGTACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCATGTGCCGCTTATCGGT UAAUCGAGAGG AA -1A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGAGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCTCTGTGCCGCTTATCGGT UAAUCGAGAGG AA -1T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGTGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCACTGTGCCGCTTATCGGT UAAUCGAGAGG AA -1C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGCGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCGCTGTGCCGCTTATCGGT UAAUCGAGAGG AA -2A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGAGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCTCCTGTGCCGCTTATCGGT UAAUCGAGAGA AA -2C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGCGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCGCCTGTGCCGCTTATCGGT UAAUCGAGAGC AA 1 -2T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGTGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCACCTGTGCCGCTTATCGGT UAAUCGAGAGU AA -3A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAAGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTTCCCTGTGCCGCTTATCGGT UAAUCGAGAAG AA -3C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGACGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTGCCCTGTGCCGCTTATCGGT UAAUCGAGACG AA -3T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGATGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTACCCTGTGCCGCTTATCGGT UAAUCGAGAUG AA -4G NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGGGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCCCCCCTGTGCCGCTTATCGGT UAAUCGAGGGG AA -4C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGCGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCGCCCCTGTGCCGCTTATCGGT UAAUCGAGCGG AA -4T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGTGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCACCCCTGTGCCGCTTATCGGT UAAUCGAGUGG AA -5A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAAAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTTTCCCCTGTGCCGCTTATCGGT UAAUCGAAAGG AA -5C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGACAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTGTCCCCTGTGCCGCTTATCGGT UAAUCGACAGG AA -5T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGATAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTATCCCCTGTGCCGCTTATCGGT UAAUCGAUAGG AA -6G NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGGGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCCCTCCCCTGTGCCGCTTATCGGT UAAUCGGGAGG AA -6C 2 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGCGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCGCTCCCCTGTGCCGCTTATCGGT UAAUCGCGAGG AA -6T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGTGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCACTCCCCTGTGCCGCTTATCGGT UAAUCGUGAGG AA -7A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCAAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGTTCTCCCCTGTGCCGCTTATCGGT UAAUCAAGAGG AA -7C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCCAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGGTCTCCCCTGTGCCGCTTATCGGT UAAUCCAGAGG AA -7T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCTAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGATCTCCCCTGTGCCGCTTATCGGT UAAUCUAGAGG AA -8A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATAGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTATCTCTCCCCTGTGCCGCTTATCGGT UAAUAGAGAGG AA -8T NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATTGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAACTCTCCCCTGTGCCGCTTATCGGT UAAUUGAGAGG AA -8G NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATGGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTACCTCTCCCCTGTGCCGCTTATCGGT UAAUGGAGAGG AA -9A NON-TEMPLATE TEMPLATE RNA ACTTACAGTAAACGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTTGCTCTCCCCTGTGCCGCTTATCGGT UAAACGAGAGG AA -9C NON-TEMPLATE TEMPLATE RNA ACTTACAGTAACCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTGGCTCTCCCCTGTGCCGCTTATCGGT UAACCGAGAGG AA -9G NON-TEMPLATE TEMPLATE RNA ACTTACAGTAAGCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTCGCTCTCCCCTGTGCCGCTTATCGGT UAAGCGAGAGG AA ST NON-TEMPLATE TEMPLATE ACTTACAGTAATCCGAAGTACAGACGGCGAATAGCCA TGAATGTCATTAGGCTTCATGTCTGCCGCTTATCGGT 3 RNA UAAUCCGAAGU AA ST(+2G) NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCCGAAGTACGGACGGCGAATAGCCA TGAATGTCATTAGGCTTCATGCCTGCCGCTTATCGGT UAAUCCGAAGU AA WT(-1A+1C) NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGACACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCTGTGTGCCGCTTATCGGT UAAUCGAGAGG AA WT(+1C -7C) NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCCAGAGGGCACACGGCGAATAGCCA TGAATGTCATTAGGTCTCCCGTGTGCCGCTTATCGGT UAAUCCAGAGG AA WT(-1A-2T) NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGTAGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCATCTGTGCCGCTTATCGGT UAAUCGAGAGU AA WT(-1A-7C) NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCCAGAGGAGACACGGCGAATAGCCA TGAATGTCATTAGGTCTCCTCTGTGCCGCTTATCGGT UAAUCCAGAGG AA NT-13 NON-TEMPLATE TEMPLATE RNA A ACTTACA TAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT-12 NON-TEMPLATE TEMPLATE RNA C ACTTACAG AATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT-11 NON-TEMPLATE TEMPLATE RNA C ACTTACAGT ATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT-10 NON-TEMPLATE TEMPLATE RNA C ACTTACAGTA TCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT-9 NON-TEMPLATE TEMPLATE RNA C ACTTACAGTAA CGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA 4 NT-8 NON-TEMPLATE TEMPLATE RNA A ACTTACAGTAAT GAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT-7 NON-TEMPLATE TEMPLATE RNA C ACTTACAGTAATC AGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT+1 NON-TEMPLATE TEMPLATE RNA C ACTTACAGTAATCGAGAGGG ACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT+2 NON-TEMPLATE TEMPLATE RNA T ACTTACAGTAATCGAGAGGGG CACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT+3 NON-TEMPLATE TEMPLATE RNA G ACTTACAGTAATCGAGAGGGGA ACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT+4 NON-TEMPLATE TEMPLATE RNA G ACTTACAGTAATCGAGAGGGGAC CGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA NT+5 NON-TEMPLATE TEMPLATE RNA T ACTTACAGTAATCGAGAGGGGACA GGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UAAUCGAGAGG AA RNA-12 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT AAUCGAGAGG AAG RNA-11 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT AUCGAGAGG AAGC RNA-10 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT UCGAGAGG AAGCG RNA-9 5 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT CGAGAGG AAGCGG RNA-8 NON-TEMPLATE TEMPLATE RNA ACTTACAGTAATCGAGAGGGGACACGGCGAATAGCCA TGAATGTCATTAGCTCTCCCCTGTGCCGCTTATCGGT GAGAGG AAGCGGG HIV-1 NON-TEMPLATE TEMPLATE RNA ACTTACAGCCATCGAGAGGGAACCCACTGCTTAAGCCTCAATAAAGC TGAATGTCGGTAGCTCTCCCTTGGGTGACGAATTCGGAGTTATTTCG AUCGAGAGG AAUA antiHIV-1 NON-TEMPLATE TEMPLATE RNA ACTTACAGCCATCGAGAGGGCTTAGTTTGCTTAAGCCTCAATAAAGC TGAATGTCGGTAGCTCTCCCGAATCAAACGAATTCGGAGTTATTTCG AUCGAGAGG AAUA OPS NON-TEMPLATE TEMPLATE RNA ACTTACAGCCATCGAGAGGCGGTAGCGTGCTTTTTTCGATAATAGCCA TGAATGTCGGTAGCTCTCCGCCATCGCACGAAAAAAGCTATTATCGGT AUCGAGAGG AAUA antiOPS NON-TEMPLATE TEMPLATE RNA ACTTACAGCCATCGAGAGGCGCTAAGGTGCTTTTTTCGATAATAGCCA TGAATGTCGGTAGCTCTCCGCGATTCCACGAAAAAAGCTATTATCGGT AUCGAGAGG AAUA Templates used for promoter borne transcription and for cloning into the plasmid for in vivo experiments (shown sequence of non-template strand of PCR fragment). Start of transcription is in italic. A2WT TCGACACCGGGGGAATTCGGATAAGTAGACAGCCTGATAAGTCGCACGAAAAACAGGTATTGACAACATGAAGTAACA TGCAGTAAGATACAAATCGCAAGGAAACACTAGCAGCGTCAACCGGGCGCGCAGTGCCTTCTAGGTGACTTAAGCG A2ST(for in vitro) TCGACACCGGGGGAATTCGGATAAGTAGACAGCCTGATAAGTCGCACGAAAAACAGGTATTGACAACATGAAGTAACA TGCAGTAAGATACAAATCGCAAGGAAACACTAGCAGCGTCAACCGAAGTACAGGTGCCTTCTAGGTGACTTAAGCG A2ST(for in vivo) 6 TCGACACCGGGGGAATTCGGATAAGTAGACAGCCTGATAAGTCGCACGAAAAACAGGTATTGACAACATGAAGTAACA TGCAGTAAGATACAAATCGCTAGGTAACACTAGCAGCGTCAACCGAAGTACAGGTGCCTTCTAGGTGACTTAAGCG Supplementary Figure Legends Supplementary Figure 1. The rate of second phosphodiester bond hydrolysis as a measure of changes in translocation equilibrium. The rate of phosphodiester bond hydrolysis was measured in assembled elongation complexes of E.coli RNAP, containing 16 nucleotide long RNA transcript, which was labeled at the 3’ proximal phosphodiester bond with [32P]. Shown are the template and non-template strands and the RNA of the complex without mismatches, EC16WT (for all sequences see Supplementary Methods). Nucleotide positions in the elongation complex are numbered relative to the position of the RNAP active center in the backstepped complex. Mismatches in the DNA duplex were introduced by changing sequence of the non-template DNA strand. Mismatches in the RNA-DNA hybrid were introduced by changing sequence of the transcript. Representative gels are shown in the bottom of the figure. The rates of second phosphodiester bond hydrolysis, kobs, in the resultant mismatched complexes were normalized to the rate of hydrolysis in the complex without mismatches (EC16WT) which was taken as 1, and are shown in logarithmic scale in histograms at the positions of corresponding mismatches. The results are consistent with the current understanding of the structure of the elongation complex, and are summarized in Fig. 1. Briefly: (i) Mismatches in positions +2 and +3 of the downstream DNA slowed down second phosphodiester bond cleavage while mismatches in the surrounding positions (+1, +4, +5) did not influence the rate of hydrolysis significantly. This is consistent with the formation of the downstream DNA duplex immediately next to the i+1 site of the RNAP active centre (Kashkina et al., 2007; Vassylyev et al., 2007b) and the fact that translocation shift to the 7 backstepped state should be influenced by formation of base pairs only in positions +2 and +3 (Fig. 1). (ii) Introduction of non-complementarity in the upstream edge of the RNA-DNA hybrid did not have effect on second phosphodiester bond cleavage until position -10, while shorter RNA-DNA hybrid strongly inhibited the reaction. This is consistent with the 10 base pairs long RNA-DNA hybrid observed in crystal structure (Vassylyev et al., 2007a), and the fact that translocation shift to the backstepped state should require rewinding of the hybrid up to position -9 (Fig. 1). (iii) Mismatches at positions -11 and -10 (and to lesser extent at -12) of the upstream DNA increased the rate of second phosphodiester bond hydrolysis, while mismatches at the surrounding positions of the upstream DNA (-13, -9, -8, -7) had minor or no effects on the rate of the reaction. This is consistent with the earlier biochemical evidence that 2-3 base pairs of the upstream DNA next to RNA-DNA hybrid remain melted (Korzheva and Mustaev, 2001), and the fact that melting of the positions -11, -10 of the upstream DNA should favor shifting of the translocation equilibrium to the backstepped state (Fig. 1). (iv) No significant cleavage of the third phosphodiester bond was observed, suggesting that the complex did not undergo significant backtracking for more than 1 base pair, though further backtracking was not restricted (see also main text). Fig. 1 shows the structure of the nucleic acids scaffold during translocational oscillation, consistent with the above results. Supplementary Figure 2. Recognition of the RNA-DNA hybrid sequence by RNAP. A. Graphic representation of the sequence of the RNA-DNA hybrid recognized by RNAP (sequence according to the non-template strand). The scheme shows stabilization and destabilization of the RNAP active center in the designated position (red circle). The height of the letters represents the relative rate of the second phosphodiester bond hydrolysis normalized to the rate of the reaction in EC16WT, where height of upright letters shows “folds faster” while height of upside down letters shows “fold slower” than cleavage in EC16WT. B. Some amino acids of the RNAP main channel that do and do not contribute to recognition of 8 the RNA-DNA hybrid sequence. Rates of second phosphodiester bond hydrolysis by wildtype (WT) and mutant RNAPs in elongation complexes bearing substitutions depicted in histograms (according to the non-template DNA). The rates of phosphodiester bond hydrolysis by wild-type and mutant enzymes were normalized to the respective rates of the reaction in EC16WT, which were taken as 1. Supplementary Figure 3. Transcription pausing caused by recognition of RNA-DNA hybrid sequence. A. Pause at position 15 on the ST sequence does not depend on the nature of the incoming NTP. Plots show (in percents of all complexes in reaction) formation and decay of paused EC15ST in the presence of 1 µM NTPs on ST and ST(+2G) templates, shown below the plots. B. At the top: kinetics of elongation on a derivative of the T7A2 template bearing the ST sequence (A2ST; part of the transcribed sequence shown on the left, with ST sequence in red). Transcription was initiated from the T7A2 promoter with the σ70 holoenzyme of E.coli RNAP (immobilized on the solid phase), stalled at position +13 to synchronize elongation complexes, and then chased by addition of all NTPs to the end of template. Two base pairs were changed (green) to allow formation of the stalled complex (EC13). The ST sequence caused pauses of transcription at positions +34 and +35. Below: To isolate EC34A2ST, chase reaction (from above) was stopped by washing of the beads after 10 s. EC34A2ST is stabilized in the pre-translocated state as judged by the rates of pyrophosphorolysis (lane 2’) and NTP addition (lanes 3’-5’). Note, that EC35A2ST formed from EC34A2ST is rapidly hydrolyzed, indicating that EC35A2ST is stabilized in the backstepped state. Black line separates parts of one gel that were brought together. C. Recognition of various sequences of the RNA-DNA hybrid may cause pausing of transcription. Plot show (in percents of all complexes in reaction) formation and decay of 9 EC15ST and EC16ST, summed together, in the presence of 1 µM NTPs on templates, shown below the plots. Supplementary Figure 4. Pausing on ops and HIV-1 sequences does not depend on the sequence of the non-template strand. A and B. Kinetics of transcription on the scaffolds containing ops RNA-DNA hybrid and either ops or antiops non-template strands (panel A), or HIV-1 RNA-DNA hybrid and either HIV-1 or antiHIV-1 non-template strands (panel B). Additional pauses and generally slower transcription on the scaffolds with mismatched nontemplates is explained by the slower transcription on partly single-stranded template due to formation of overextended RNA-DNA hybrids. 10 Supplementary Figure 1 11 Supplementary Figure 2 12 Supplementary Figure 3 13 Supplementary Figure 4 14 Supplementary Table 1. Translocation equilibrium is not affected in the absence of recognition of the RNA-DNA hybrid sequence. A. The rates of hydrolysis, pyrophosphorolysis and NTP addition in EC14WT, EC15WT and EC16WT, formed on the WT template. 15 Largest subunit T. thermophilus R534 R601 K610 Q611 R615 K621 R622 R628 R704 A705 P706 A1085 T1088 A1089 R1096 R259 K325 K334 Q335 R339 K345 R346 R352 R425 A426 P427 A787 T790 A791 R798 R249 K315 K324 Q325 R329 K335 R336 R342 R415 A416 P417 A791 T794 A795 R802 S. cerevisiae Pol I n.a. K462 K463 E464 R468 K474 R475 R481 R591 Q592 P593 A1010 T1013 S1014 R1021 S. cerevisiae Pol II R257 K323 K332 E333 R337 K343 R344 R350 R446 Q447 P448 A828 T831 A832 R839 S. cerevisiae Pol III n.a. R351 K360 Q361 R365 K371 R372 R378 R476 Q477 P478 A876 T879 A880 R887 E.coli S. pneumoniae Second largest subunit T. thermophilus E.coli S. pneumoniae R134 S387 R388 Q390 F394 R409 E421 R422 P444 N448 I452 N563 Q567 K846 V1001 E1002 L1021 Q1030 R1031 G1033 M1035 E1036 R143 S508 S509 Q510 F514 R529 E541 R542 P564 N568 I572 N684 Q688 K1073 V1239 D1240 L1259 Q1268 R1269 G1271 M1273 E1274 R132 S468 S469 Q470 F474 R489 D501 R502 P524 N528 I532 N646 Q750 K928 V1040 D1041 L1060 Q1069 R1070 G1072 M1074 E1075 S. cerevisiae Pol I K201 S482 n.a. Q480 V487 R501 n.a. R505 P534 N543 L542 N715 Q724 K924 V1040 D1042 V1060 I1069 R1070 G1072 M1074 E1075 S. cerevisiae Pol II K210 S475 R476 Q481 V482 R497 D505 R504 P528 N538 L539 N767 Q776 K987 V1099 D1100 V1119 L1128 R1129 G1131 M1133 E1134 S. cerevisiae Pol III K192 S438 R451 n.a. V457 R472 E508 R481 P503 N513 L514 N699 Q708 K919 V1031 D1033 T1051 L1060 R1061 G1063 M1065 E1066 Supplementary Table 2. Conservation of amino acids that potentially contact the RNA-DNA hybrid. Amino acids within 4 Å from atoms of the RNA-DNA hybrid of the elongation complex of T. thermophilus RNAP (PDB 2O5J) were aligned among RNAPs used in our study. Dark blue cells designate conserved amino acids, light blue – homologous substitutions, and white cells show non-conserved amino acids (n.a. – no alignement).
Related documents