Download Reassignment of the Human CSFl Gene to Chromosome lp13-p21

From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
Reassignment of the Human CSFl Gene to Chromosome lp13-p21
By Stephan W. Morris, Marcus 6. Valentine, David N. Shapiro, Jack E. Sublett, Larry L. Deaven, John T. Foust,
W. Mark Roberts, Douglas Pat Cerretti, and A. Thomas Look
Human macrophage colony-stimulating factor (CSF-1 or
M-CSF) is encoded by a single gene that was previously
assigned to the long arm of chromosome 5, band q33.1, in a
region adjacent to the gene encoding its receptor (Pettenati
MJ, et al, Proc Natl Acad Sei USA 84:2970, 1987). Using
fluorescence in situ hybridization with genomic probes to
examine normal metaphase chromosomes, we reassigned
the human CSFl gene to the short arm of chromosome 1,
bands ~ 1 3 . ~ 2 1We
. confirmed this result by hybridizing a
CSFl cDNA probe to filters containing flow-sorted chromosomes and by identifyingCSFl sequences in DNAs extracted
from human x rodent somatic cell hybrids that contained
M
ACROPHAGE colony-stimulating factor (CSF-1 or
M-CSF) stimulates the proliferation and differentiation of mononuclear phagocyte progenitors and promotes
the survival and effector functions of mature monocytes and
macrophages.' It has been implicated in the growth, maturation, and function of osteoclasts, and alterations of the
CSFl gene are responsible for congenital osteopetrosis in
up/up mutant mice.*x3 In addition, CSF-1 is produced at
high levels by uterine glandular epithelial cells during
pregnancy, and may play a role in the formation and
differentiation of the p l a ~ e n t a . ~ . ~
Human CSF-1 is encoded by a single gene that spans 20
kb and contains 10 exons'.'; differential splicing generates
multiple CSF-1 messenger RNA (mRNA) species with
different coding and 3' untranslated sequences.'-" Shortly
after human CSFl cDNA and genomic clones were isolated: the gene was mapped by isotopic in situ chromosomal hybridization, together with somatic cell hybrid
panels, to chromosome 5 at band q33.1,'* near the gene for
its receptor (CSFIR) at 5q33.2-q33.3.'3"5 The CSFl gene
appeared to be one of a cluster of growth factor and growth
factor receptor genes on the long arm of chromosome 5,
which are frequently deleted in bone marrow (BM) cells of
patients with myelodysplasia and refractory anemia (so
called 5q- syndrome) or therapy-related myeloid leukemias.'6-'8
We began to question the chromosomal location of the
CSFl gene while looking for the molecular breakpoints of
(3;5)(q25.1;q34) chromosomal translocations in the BM
cells of a subset of patients with myeloid leukemia or
trilineage marrow dysplasia.'' Hybridization experiments
with DNAs from human x hamster hybrid cell lines,
containing either the derivative 3 or derivative 5 human
chromosomes from leukemic blasts, were inconsistent,
leading us to reexamine normal metaphase chromosomes
for the location of the CSFl gene. Our results indicate that
the gene was incorrectly assigned to chromosome 5q33.1
and, in fact, resides on chromosome 1, at bands p13-p21.
This new assignment has important implications for the
study of human malignancies with rearrangements of the
short arm of chromosome 1 and for studies of the possible
involvement of the CSFl gene in human osteopetrosis.
Blood, Vol78, No 8 (October 151.1991: pp 2013-2020
human chromosome 1 but not human chromosome 5. Our
findings are consistent with studies that have shown tight
linkage between the murine CSF7 and amylase genes, as part
of a conserved linkage group between mouse chromosome 3
and the short arm of human chromosome 1, which also
includes the genes encoding the B subunits of thyrotropin
and nerve growth factor. Assignment of the CSF7 gene to
chromosome 1 at bands p13-p21 raises the possibility that it
may be altered by certain nonrandom chromosomal abnormalities arising in human hematopoietic malignancies and
solid tumors.
0 7991 by The American Society of Hematology.
MATERIALS AND METHODS
Cell lines. DC is a karyotypically normal, Epstein-Barr virus
(EBV)-immortalized human lymphocyte cell line; E36 is a hypoxanthine-guanine phosphoribosyl transferase (HPRT)-deficient subclone of V79 Chinese hamster lung fibroblasts; and M613 is a
murine HPRT-deficient fibroblast line. The human x mouse
somatic cell hybrids CF84-4/4 (repository no. NA09927) and
CF84-27/3 (repository no. NA09934) were obtained from the
National Institute of General Medical Sciences Human Genetic
Mutant Cell Repository (Coriell Institute for Medical Research,
Camden, NJ). In addition to small numbers of other human
chromosomes, these hybrid cell lines contain either normal human
chromosome 1 but not chromosome 5 (CF84-4/4 line) or normal
human chromosome 5 but not chromosome 1 (CF84-27/3 line).
We derived human x hamster somatic cell lines Al, A4, A5, A6,
C1, and C2 by polyethylene glycol (PEG) fusion of cryopreserved
leukemic marrow blasts with E36 hamster cells, according to the
method of Lemons et al?' A t(3;5)(q25.l;q34) was the only
cytogenetic abnormality identified in the leukemic cells of this
patient, as reported in a previous study (see results for patient 1 in
Raimondi et all'). Hybrid clones contained either the derivative
chromosome 3 (Al, A6, and C2) or the derivative chromosome 5
(A4 and A5), together with other human chromosomes.
Molecular probes. The 727 bp BamHI CSFl cDNA fragment
used for hybridization to Southern blots and filters containing
From the Departments of Hematology-Oncology and Tumor Cell
Biology, St Jude Children's Research Hospital; the Department of
Pediatrics, University of Tennessee, Memphis, College of Medicine,
Memphis, TN; the Experimental Pathology Group, Los Alamos
National Laboratory, Los Alamos, NM; and the Department of
Molecular Biology, Immuner Corporation, Seattle, WA.
Submitted April 3,1991; accepted June 20, 1991.
Supported in part by Grants No. CA-20180, CA-23099, and
CA-21765, from the National Cancer Institute, National Institutes of
Health, and by the American Lebanese Syrian Associated Chanties
(ALSAC).
Address reprint requests to A . Thomas Look, MD, Department of
Hematology-Oncology, St Jude Children 's Research Hospital, 332 N
Lauderdale, Memphis, TN 38105.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
0 1991 by The American Society of Hematology.
0006-4971I91 I7808-OO15$3.OO/O
2013
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
MORRIS ET AL
2014
sorted human chromosomes was obtained from the insert of clone
pcDBCSF-4.’ This BamHI fragment, which contains coding sequences from exon 6, was subcloned into pBluescript SK+ (Stratagene Corp, La Jolla, CA) and partially sequenced to confirm its
identity. The genomic CSF-1 clones used for fluorescence in situ
hybridization were derived from two independent sources. The
pMLSV/genomic-CSF-1 clone contains 17.3 kb of human DNA
that includes the entire coding sequence of the CSFI gene.” The
pHCSF-la genomic clone (no. 40185; American Type Culture
Collection [ATCC], Rockville, MD), plaque-purified by us, also
contains the complete coding sequence of this gene. Results of
restriction mapping of these clones, using the enzymes EamHI,
EcoRI, and Hind111 and hybridization of the 727-bp BamHI CSFl
cDNA probe to Southern blots prepared after electrophoresis of
the fragments in agarose gels, were consistent with published
findings.’*
The probes for other loci included in this study were a 2.1-kb
insert of plasmid pHJ, which contains coding sequences of human
juri*'; a 545-bp EcoRIIHindIII genomic fragment from clone pEB8
(ATCC no. 59736), which contains a portion of introns 1 and 2 and
all of exon A of the human amylase-1 gene (AMYI)’; the
anonymous human chromosome 5 polymorphic probe L1200
(D5S62;Collaborative Research, Inc, Bedford, MA); and a 1.4-kb
Sac I genomic fragment immediately 5’ of exon 1 of the human
platelet-derivedgrowth factor receptor+ gene (PDGF-Rf3).L‘
Fluorescence in situ hybridization. Bromodeoxyuridine-synchronized, phytohemagglutin-stimulatedperipheral blood lymphocytes
from a normal donor were used as a source of metaphase
chromosomes. Genomic DNA subcloned into plasmid or phage
vectors was nick-translated with digoxigenin-11-UTPand hybridized overnight at 37°C to fixed metaphase chromosomes according
to the method of Pinkel et al,24except for the inclusion of 500
pg/mL of highly reiterated human DNA self-annealed to Cot 1
(Bethesda Research Laboratories, Gaithersburg, MD). Signals
were detected by incubating the slides with fluorescein-conjugated
sheep antidigoxigenin antibodies(Boehringer Mannheim, Indianapolis, IN) followed by counterstaining in propidium iodide solution
containing antifade (1,4-diazabicyclo[2.2.2]octane;Sigma Chemical, St Louis, MO). Fluorescence microscopy was performed with a
Zeiss standard microscope equipped with fluorescein epifluorescence filters.
Sorted human chromosomes. Normal human metaphase chromosomes were isolated from diploid human lymphoblastoid cells
or from human x rodent hybrid cell lines and sorted into spots on
nitrocellulose filters.z The filters were then hybridized with a
’*P-labeled 727-bp EamHI CSFI cDNA fragment and washed as
previously described.%
Polymerase chain reaction (PCR). Amplimers specific for the
CSFl gene were a 5’ TAACTGGTACAGCCTTGCCC3’ sense
strand oligonucleotide and a 5’ TTCCACCTGTCTGTCATCCT3’
antisense strand oligonucleotide. These primers yield an amplified
genomic fragment of 1,469-bp, which includes sequences from
exons 6 to 8 and the two intervening introns. The CSFIR amplimers
(5’ TATACCAATCTGCCGAGCAGC 3’ sense strand and 5’
GGAAGTGGGATCCTCTGAAA3’ antisense strand oligonucleotides) were both derived from exon 22 of the gene and yield a
330-bp product.
Amplification was performed in a 50-pL reaction volume containing 200 pmol/L deoxynucleotide triphosphates, 1 pmol/L of each
primer, 1.25 U Taq DNA polymerase, and 250 ng of genomic DNA
in PCR buffer (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles
(denaturation, 94°C for 1 minute; annealing, 62°C for 2 minutes;
extension, 72°C for 3 minutes) in an automated thermocycler
(Perkin Elmer-Cetus). The PCR products were separated by
electrophoresis on 2% agarose gels, transferred to nylon mem-
branes, and hybridized to 32Pend-labeled oligonucleotide probes
that contained sequences from either exon 7 of the CSFI gene (5’
CAGAGAGCGGATTCTCCCTTG3‘) or exon 22 of the CSFlR
gene (5’ GTTGACGACAGGGAGTACCAC3’).
RESULTS
Somatic cell hybrids containing derivative t(3;5) chromosomes. Figure 1 shows the results of hybridization experiments to localize the molecular breakpoints of the t(3;
5)(q25.l;q34), using the indicated probes and DNAs from
human x hamster hybrid cell lines that contain either the
derivative 3 or derivative 5 human chromosome from
leukemic blasts. The PDGF-RP gene (located at 5q33-q35)
is contained in hybrids with the derivative chromosome 5
(A4 and A5) and in a hybrid with normal chromosome 5
A
8.0 kb
PDGF-RP
B
2.0 kb
D5S62
C
9.4 kb
’ W
CSF-1
Fig 1. Southern blot analysis of (A) Hindlll- or (B through D)
EcoRI-digested DNAs from human x hamster somatic cell hybrids.
Hybridization was performed with probes specific for the PDGF-Rp
gene (A), the anonymous chromosome 5 sequence D5S62 (8). the
CSFI gene (C), and thejun gene (D). Names of the hybridcell lines, the
EBV-transformed human cell line (DC), and the hamster cell line (E36)
are indicated above the lanes. The presence of normal (nl) human
chromosomes 1,3, and 5, as well as derivative (der) chromosomes 3
or 5, is indicated for each hybrid cell line. The lengths of the human
genomic restriction fragments recognized by each probe are also
indicatedin kilobases.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2015
HUMAN CSFl GENE ON CHROMOSOME 1
(Al), but not in hybrids with the derivative chromosome 3
that lack normal chromosome 5 (A6 and C2; Fig lA),
indicating that the PDGF-RP gene maps proximal to the
breakpoint. By contrast, the anonymous probe L1200
(DSS62; located at 5q34-qter) hybridized to hybrid DNAs
that contained the derivative 3 chromosome, but not to
DNAs from hybrids that contained the derivative 5 chromosome (Fig lB), indicating that this sequence lies distal to
the breakpoint. Results with the CSFl cDNA probe were
inconsistent: there was hybridization to DNAs from two of
the hybrid cell lines with the derivative 3 chromosome (A1
and A6), but not to the third (C2; Fig 1C). A similar
hybridization pattern was obtained with a jun probe (located at lp32) (Fig 1D) and an AMY1 probe (located at
lp21; data not shown), indicating that the short arm of
human chromosome 1 is present in hybrids A1 and A6, but
not in the other hybrids included in the panel.
Fluorescence in situ hybriduation. The lack of a satisfac-
A
m
k
t
4
I .
jh
Fig 2. Fluorescence in situ hybridizationto normal
human metaphase chromosomes performed with a
genomic fragment that contains the entire coding
sequence of the CSFl gene (original magnification
x 1,764). Fluorescein fluorescence resulting from hybridization of the probe is evident at identical positions adjacent t o the sister chromatids of chromosome 1 (different metaphase spreads are shown in
[A] and [E]). The localization to chromosome 1 at
band ~ 1 3 . ~ 2was
1
based on the distance from the
centromere of the hybridization signal relative to the
entire length of the short arm of chromosome 1. The
region of centromeric heterochromatin characteristic
of the long arm of chromosome 1, which did not
reproduce well in this figure, was readily apparent by
microscopic examination, allowing localizationof the
fluorescence signal to lp.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2016
MORRIS ET AL
Fig 3. Localization of the
CSFl gene by chromosome sorting. Human chromosomes of
each type were sorted by flow
cytometry, with greater than 90%
purity, directly onto nitrocellulose filter discs (black circles).
Chromosomes9 to 12 are shown
together and as separate populations obtained by sorting of
monochromosome human x rodent somatic cell hybrids. The
autoradiograph shows one of
two sets of filters hybridized with
a 727-bpRs”I CSFl cDNAfragment.
tory explanation for the hybridization pattern of the CSFI
cDNA probe with DNAs from the somatic cell hybrid cell
lines led us to reexamine the chromosomal location of the
CSFl gene. We used chromosomal fluorescence in situ
hybridization techniques, because they allow unambiguous,
high-resolution chromosomal localization of single-copy
DNA sequences?427-”When this approach was used with
normal human metaphase chromosomes hybridized to a
genomic CSF-1 clone (pMLSV/genomic-CSF-l), which
includes 17.3 kb of DNA encompassing the entire coding
region of the CSFl gene, the only fluorescence signal
emanated from the proximal short arm of the chromosome
1 (Fig 2). The hybridizing chromosomal arms were identified as human chromosome l p by the metacentric morphology and characteristicpattern of centromeric heterochromatin on the long arm of this chromosome. Based on the
distance from the centromere of the hybridization signal
relative to the entire length of the short arm of chromosome
1, we assigned the CSFl gene to bands p13-p21. Specific
labeling of 21 of 32 chromosome 1 chromatids at this
position was seen in eight representative metaphases selected for photography. Hybridization with an independently derived genomic clone, pHCSF-la, also containing
the complete CSFl coding sequence, yielded an identical
pattern of fluorescence. A fluorescence signal was not
observed on chromosome 5q with either clone. By contrast,
cosmid clones containing portions of the CSFIR and
PDGF-Rp genesU showed highly specific labeling of the
long arm of chromosome 5, as expected, when analyzed by
the same techniques (data not shown).
Chromosomes isolated by flow sorting. The CSFl gene
was independently assigned to chromosome 1 by hybridizing the ’*P-labeled 727-bp CSFI cDNA fragment to filters
containing flow cytometrically sorted human metaphase
chromosomes. Hybridization was specific for the region of
the filters containing chromosome 1 in two independent
chromosome-sorting experiments (Fig 3). Specific signals
were not observed in regions of the filters containing
Fig4. Southem blot analysis of DNAsfrom human x mouse hybrid
cell linescontaining human chromosomes 1or 5. Sequential hybridization was performed with probes specific for the PDGf-RB (A),jun (B),
or CSf 1 (C) genes t o a Southern blot of Hindlll-digested DNAs from
hybrid (CF84-27/3, CF844/4), human (DC), and mouse (M613) cell
lines. The presence of human chromosomes 1or 5 is indicated for the
somatic cell hybrids. The sizes of human genomic Hindlll fragments
recognized by each probe are indicated.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2017
HUMAN CSFf GENE ON CHROMOSOME 1
chromosome 5, or in regions containing other human
chromosomes.
Further studies with DNAs from somatic cell hybrids. We
also performed Southern blot analyses of DNAs from
hybrids containing human chromosomes 1 or 5. Hybridization with the PDGF-RP probe (Fig 4A), the L1200 probe
(D5S62; not shown), jun (Fig 4B), and AMY1 (not shown)
confirmed the presence of chromosome 1 (but not chromosome 5 ) in the CF84-4/4 hybrid and chromosome 5 (but not
chromosome 1) in the CF84-27/3 hybrid. The CSFI locus
cosegregated with chromosome 1, but not with chromosome 5 in these hybrid cell lines (Fig 4C).
To exclude the presence of a CSFI pseudogene or
related gene on chromosome 1, we performed PCR amplification of DNAs from these hybrids using amplimersspecific
for both the CSFI and CSFIR genes. Amplification of total
human genomic DNA with a mixture of the two sets of
primers resulted in the generation of products of the
expected size for both the CSFI (1,469 bp) and CSFIR (330
bp) genes (Fig 5). When the two hybrid DNAs were used as
templates with this primer mixture, only the CSFI-specific
product was produced with DNA from the chromosome
1-containinghybrid, while only the CSFIR-specific product
was observed with DNA from the chromosome 5-contain-
A
CSF-1 (1469 bp)
-
CSF-IR (330 bp)
-
B
1469 bp330 bpCSF-IR
Fig 5. PCR analysis of human DNA (DC) and DNAs
from human x mouse hybrid cell lines containing
human chromosomes 1(CF84-4/4) or 5 (CF84-27/3).
An ethidium bromide-stained agarose gel (A) illustrates the products resuking from PCR amplification
with a mixture of amplimers specific for the human
CSFI and CSFIR genes. End-labeled oligonucleotide
probes were used to detect the amplified CSFlR (E)
or CSFI (C) genomic fragments in Southern blot
analysis of the PCR products. The sizes of the CSFIspecific (1,469 bp) and CSFIR-specific (330bp) PCR
products are indicatedto the left of each panel.
C
1469 bp330 bp-
CSF-1
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
MORRIS ET AL
2018
ing hybrid. Control reactions performed using genomic
mouse DNA or in the absence of any template did not yield
any amplified products (data not shown). Because the
coding sequence flanked by the CSFl exon 6- and exon
8-specific primers is only 569 bp long, amplification of a
1,469-bp product can only result from extension across the
two intervening introns, which together are 900 bp in
length.
DISCUSSION
We provide independent lines of evidence that the
human CSFl gene is located on chromosome 1, bands
p13-p21, rather than on the long arm of chromosome 5, as
previously reported.'* This revised assignment of the human
CSFl gene is consistent with studies of Gisselbrecht et al,31
who localized the murine CSFl gene to mouse chromosome
3 at band 3F3, both by in situ hybridization and linkage
analysis. These investigators observed tight linkage between the murine CSFl and amylase (Amy) genes, indicating that these two loci are separated by approximately 5
centimorgans. The human AMY1 and AMY2 genes are
located on chromosome 1 at band ~ 2 1 : ~as part of a
conserved linkage group between mouse chromosome 3
and human chromosome 1, which includes the genes
encoding the CD2 T-cell surface antigen (CD2), the
ATPase a subunit (ATPlAl),and the p subunits of thyroidstimulating hormone (TSHB) and nerve growth factor
(NGFB).33*34
Although linkage studies have not been reported with probes from the human CSFl gene, our data
combined with linkage studies in the mouse3' suggest that
the CSFI locus is part of this evolutionarily conserved
linkage group.
Recent refinements in chromosomal fluorescence in situ
hybridization techniques and chromosome flow sorting
have significantly enhanced the accuracy of gene mapping.
Previously available methods for in situ hybridization used
radioisotopically labeled probes and detection systems
based on autoradiographic analysis of silver grains in
photographic emulsions applied over metaphase chromosome spreads. These techniques often yielded a low percentage of chromatids with specific hybridization and had a high
level of background silver grains, necessitating analysis of
large numbers of metaphases to infer statistically the
location of sequences hybridizing to the probe. The wide
scatter of radioactive disintegrations in the region of
hybridization also severely limited the precision of the
method. By contrast, fluorescence in situ hybridization
techniques generate probe-specific signal in greater than
50% of metaphase chromatids with very low background
and the highest resolution attainable by light microscoPY.24.27-30
Paired signals are often evident at symmetrical
positions on both chromatids of each metaphase chromosome, as shown in Fig 2, unequivocally localizing the
sequences hybridizing with the probe after analysis of
relatively few metaphases. Advantages of the fluorescence
in situ hybridization method include the ability to order
chromosomal loci and determine the approximate genomic
distances between probes in both metaphase and interphase c e l l ~ . ~Fluorescence-activated
~.~"
flow sorting of chromosomes has also been improved by dual-laser sorting
techniques and by the use of chromosome preparations
from monochromosome human x rodent hybrids, resulting
in the isolation of each human chromosome with greater
than 90% purity?' These techniques, combined with PCRbased methods to detect human sequences in wellcharacterized human x rodent somatic cell hybrids, provide sensitive and definitive means to confirm the location
of hybridizing sequences at the chromosomal level.
Mice with osteopetrosis homozygous for a recessive
mutation, op, have a complete systemic deficiency of CSF-1,
resulting from a single base-pair insertion in exon sequences that renders the gene incapable of encoding a
functional p r ~ t e i n .Human
~ . ~ congenital osteopetrosis resembles the condition in oplop mutant mice; hence, CSFl could
be altered in the human autosomal recessive form of this
disease. Our results suggest that linkage studies attempting
to implicate genetic abnormalities of CSFl in kindreds
affected by this disorder should examine polymorphic loci
from the linkage group on the short arm of chromosome 1.
Abnormalities of chromosome 1 at bands p13-p21 have
been observed in both leukemias and solid tumors. A
(1;22)(p13;q13) chromosomal translocation is specific for
marrow blast cells of infants with acute megakaryoblastic
leukemia (FAB M7).35.36Translocations, inversions, and
deletions involving this region of the short arm of chromosome 1 have also been identified in lymphoma, breast
carcinoma, melanoma, leiomyosarcoma, and mesothelioma?' Thus, the CSFl gene should be considered among
the genetic loci that could be affected by these chromosomal alterations in human malignancies.
ACKNOWLEDGMENT
We are grateful to Drs Martine Roussel and Charles Sherr for
encouragement and helpful discussions, for providing the CSFl
cDNA probe and CSFlR amplimers, and for comments about the
manuscript;to Dr Dirk Bohmann, University of California, Berkeley, for providing the jun cDNA probe; and to Dr Barbara
Weiffenbach, Collaborative Research, Bedford, MA, for access to
human chromosome 5 linkage data before publication. We thank
Sharon Nooner, Bart Jones, Kevin Coleman, and Mary Campbell
for technical assistance and John Gilbert for editorial review.
REFERENCES
1. Sherr CJ, Stanley ER: Colony-stimulating factor 1 (macrophage colony-stimulating factor), in Sporn MB, Roberts AB (eds):
Handbook of Experimental Pharmacology, Peptide Growth Factors and Their Receptors I (vol 95/I). New York, NY, SpringerVerlag, 1990, p 667
2. Yoshida H, Hayashi S, Kunisada T, Ogawa M, Nishikawa S,
Okamura H, Sudo T, Shultz LD, Nishikawa SI: The murine
mutation osteopetrosis is in the coding region of the macrophage
colony stimulating factor gene. Nature 345:442,1990
3. Wiktor-JedrzejczakW, Bartocci A, Ferrante AW Jr, Ahmed-
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
HUMAN CSFI GENE ON CHROMOSOME 1
Ansari A, Sell KW, Pollard JW, Stanley ER: Total absence of
colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (oplop) mouse. Proc Natl Acad Sci USA 87:4828,1990
4. Pollard JW, Bartocci A, Arceci R, Orlofsky A, Ladner MB,
Stanley ER: Apparent role of the macrophage growth factor,
CSF-1, in placental development. Nature 330484,1987
5. Regenstreif LJ, Rossant J: Expression of the c-fms protooncogene and of the cytokine, CSF-1, during mouse embryogenesis. Dev Biol 133:284, 1989
6. Arceci RJ, Shanahan F, Stanley ER, Pollard Jw: Temporal
expression and location of colony-stimulating factor 1(CSF-1) and
its receptor in the female reproductive tract are consistent with
CSF-1-regulated placental development. Proc Natl Acad Sci USA
86:8818, 1989
7. Ladner MB, Martin GA, Noble JA, Nikoloff DM, Tal R,
Kawasaki ES, White TJ: Human CSF-1: Gene structure and
alternative splicing of mRNA precursors. EMBO J 6:2693, 1987
8. Cerretti DP, Wignall J, Anderson D, Tushinski RJ, Gallis
BM, Stya M, Gillis S, Urdal DL, Cosman D: Human macrophagecolony stimulating factor: Alternative RNA and protein processing
from a single gene. Mol Immunol25:761,1988
9. Kawasaki ES, Ladner MB, Wang AM, Van Arsdell J, Warren
MK, Coyne MY, Schweickart VL, Lee MT, Wilson KJ, Boosman
A, Stanley ER, Ralph P, Mark DF: Molecular cloning of a
complementary DNA encoding human macrophage-specific colonystimulating factor (CSF-1). Science 230:291, 1985
10. Wong GG, Temple PA, Leary AC, Witek-Giannotti JS,
Yang YC, Ciarletta AB, Chung M, Murtha P, Kriz R, Kaufman RJ,
Ferenz CR, Sibley BS, Turner KJ, Hewick RM, Clark SC, Yanai N,
Yokota H, Yamada M, Saito M, Motoyoshi K, Takaku F Human
CSF-1: Molecular cloning and expression of 4-kb cDNA encoding
the human urinary protein. Science 235:1504, 1987
11. Rettenmier CW, Roussel MF: Differential processing of
colony-stimulating factor 1 precursors encoded by two human
cDNAs. Mol Cell Biol8:5026,1988
12. Pettenati MJ, Le Beau MM, Lemons RS, Shima EA,
Kawasaki ES, Larson RA, Sherr CJ, Diaz MO, Rowley JD:
Assignment of CSF-1 to 5q33.1: Evidence for clustering of genes
regulating hematopoiesis and for their involvement in the deletion
of the long arm of chromosome 5 in myeloid disorders. Proc Natl
Acad Sci USA 84:2970,1987
13. Roussel MF, Sherr CJ, Barker PE, Ruddle FH: Molecular
cloning of the c-fms locus and its assignment to human chromosome 5. J Virol48:770,1983
14. Groffen J, Heisterkamp N, Spurr N, Dana S, Wasmuth JJ,
Stephenson JR: Chromosomal localization of the human c-fms
oncogene. Nucleic Acids Res 11:6331,1983
15. Le Beau MM, Westbrook CA, Diaz MO, Larson RA,
Rowley JD, Gasson JC, Golde DW, Sherr CJ: Evidence for the
involvement of GM-CSF and fms in the deletion (5q) in myeloid
disorders. Science 231:984,1986
16. Le Beau MM, Pettenati MJ, Lemons RS, Diaz MO, Westbrook CA, Larson RA, Sherr CJ, Rowley JD: Assignment of the
GM-CSF, CSF-1, and FMS genes to human chromosome 5
provides evidence for linkage of a family of genes regulating
hematopoiesis and for their involvement in the deletion (5q) in
myeloid disorders. Cold Spring Harb Symp Quant Biol 515399,
1986
17. Nagarajan L, Lange B, Cannizzaro L, Finan J, Nowell PC,
Huebner K: Molecular anatomy of a 5q interstitial deletion. Blood
75:82, 1990
18. Huebner K, Nagarajan L, Besa E, Angert E, Lange BJ,
2019
Cannizzaro LA, Van den Berghe H, Santoli D, Finan J, Croce CM,
Nowell PC: Order of genes on human chromosome 5q with respect
to 5q interstitial deletions. Am J Hum Genet 4626, 1990
19. Raimondi SC, Dube ID, Valentine MB, Mirro J Jr, Watt HJ,
Larson RA, Bitter MA, Le Beau MM, Rowley JD: Clinicopathologic manifestations and breakpoints of the t(3;5) in patients with
acute nonlymphocytic leukemia. Leukemia 3:42,1989
20. Lemons RS, Eilender D, Waldmann RA, Rebentisch M,
Frej AK, Ledbetter DH, Willman C, McConnell T, O’Connell P:
Cloning and characterization of the t(15;17) translocation breakpoint region in acute promyelocytic leukemia. Genes Chromosomes Cancer 2:79,1990
21. Bohmann D, Bos TJ, Admon A, Nishimura T, Vogt PK,
Tjian R: Human proto-oncogene c-jun encodes a DNA binding
protein with structural and functional properties of transcription
factor AP-1. Science 238:1386,1987
22. Gumucio DL, Wiebauer K, Caldwell RM, Samuelson LC,
Meisler MH: Concerted evolution of human amylase genes. Mol
Cell Biol8:1197,1988
23. Roberts WM, Look AT, Roussel MF, Sherr CJ: Tandem
linkage of human CSF-1 receptor (c-fms) and PDGF receptor
genes. Cell 55:655,1988
24. Pinkel D, Landegent J, Collins C, Fuscoe J, Segraves R,
Lucas J, Gray J: Fluorescence in situ hybridization with human
chromosome-specific libraries: Detection of trisomy 21 and translocations of chromosome 4. Proc Natl Acad Sci USA 85:9138,1988
25. Deaven LL, Van Dilla MA, Bartholdi MF, Carrano AV,
Cram LS, Fuscoe JC, Gray JW, Hildebrand CE, Moyzis RK,
Perlman J: Construction of human chromosome-specific DNA
libraries from flow-sorted chromosomes. Cold Spring Harb Symp
Quant Biol51:159,1986
26. Varghese S, Deaven LL, Huang YC, Gill RK, Iacopino AM,
Christakos S: Transcriptional regulation and chromosomal assignment of the mammalian calbindin-D28k gene. Mol Endocrinol
3:495,1989
27. Lawrence JB, Villnave CA, Singer RH: Sensitive, highresolution chromatin and chromosome mapping in situ: Presence
and orientation of two closely integrated copies of EBV in a
lymphoma line. Cell 52:51,1988
28. Ferguson-Smith MA: Putting the genetics back into cytogenetics. Am J Hum Genet 48:179,1991 (editorial)
29. Lichter P, Tang CC-J, Call K, Hermanson G, Evans GA,
Housman D, Ward DC: High-resolution mapping of human
chromosome 11by in situ hybridization with cosmid clones. Science
247:64, 1990
30. Trask BJ, Massa H, Kenwrick S, Gitschier J: Mapping of
human chromosome Xq28 by two-color fluorescence in situ hybridization of DNA sequences to interphase cell nuclei. Am J Hum
Genet 48:1,1991
31. Gisselbrecht S, Sola B, Fichelson S, Bordereaux D, Tambourin P, Mattei MG, Simon D, Guenet J L The murine M-CSF
gene is localized on chromosome 3. Blood 73:1742,1989
32. Zabel BU, Naylor SL, Sakaguchi AY, Bell GI, Shows TB:
High-resolution chromosomal localization of human genes for
amylase, proopiomelanocortin, somatostatin, and a DNA fragment
(D2S1) by in situ hybridization. Proc Natl Acad Sci USA 80:6932,
1983
33. Moseley WS, Seldin M F Definition of mouse chromosome 1
and 3 gene linkage groups that are conserved on human chromosome 1: Evidence that a conserved linkage group spans the
centromere of human chromosome 1. Genomics 52399,1989
34. Dracopoli NC, Stanger BZ, Ito CY, Call KM, Lincoln SE,
Lander ES, Housman DE: A genetic linkage map of 27 loci from
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
MORRIS ET AL
2020
PND to FY on the short arm of human chromosome I. Am J Hum
Genet 43:462,1988
35. Sait SN, Brecher ML, Green DM, Sandberg AA: Translocation t(1;22) in congenital acute megakaryocytic leukemia. Cancer
Genet Cytogenet 34277,1988
P, Emami A, Gross S, Alvarado C, Phillips C, Krischer J, Crist W,
Head D, Gresik M, Ravindranath Y, Weinstein H: The t(1;22)(p13;
q13) is nonrandom and restricted to infants with acute megakaryoblastic leukemia. Blood 1991 (in press)
37. Trent JM, Kaneko Y, Mitelman F: Report of the committee
on structural chromosome changes in neodasia. Cvtogenet Cell
Genet 51533,1989
v
36. Carroll A, Civin C, Schneider N, Dah1 G, Pappo A, Bowman
,
Y
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1991 78: 2013-2020
Reassignment of the human CSF1 gene to chromosome 1p13-p21
SW Morris, MB Valentine, DN Shapiro, JE Sublett, LL Deaven, JT Foust, WM Roberts, DP Cerretti
and AT Look
Updated information and services can be found at:
http://www.bloodjournal.org/content/78/8/2013.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.