Download TSG101 Protein Steady-State Level Is Regulated

[CANCER RESEARCH 60, 1736 –1741, March 15, 2000]
TSG101 Protein Steady-State Level Is Regulated Posttranslationally by an
Evolutionarily Conserved COOH-Terminal Sequence1
Guo Hong Feng,2 Chih-Jian Lih, and Stanley N. Cohen3
Department of Genetics, Stanford University School of Medicine, Stanford, California 94305
ABSTRACT
Antisense inactivation of the tsg101 tumor susceptibility gene in murine
NIH3T3 fibroblasts leads to neoplastic transformation and tumorigenesis,
which are reversed by restoration of tsg101 activity. tsg101 deficiency is
associated with a series of mitosis-related abnormalities, whereas overexpression of TSG101 can also result in neoplastic transformation and the
perturbation of cell cycling. Together, these observations imply that
TSG101 production outside of a narrow range can lead to abnormal cell
growth. We report here that the TSG101 protein is maintained at an
almost constant steady-state level in cultured murine and human cells and
that this occurs through a posttranslational process involving TSG101
protein degradation. Sustained overproduction of TSG101 from chromosomally inserted adventitious constructs resulted in compensatory downregulation of endogenous TSG101 and replacement of the native protein
by the adventitious one. Using deletion mutants of TSG101, we mapped
the region responsible for autoregulation of the TSG101 steady-state level
to an evolutionarily conserved sequence, here termed the “steadiness
box,” located near TSG101’s COOH-terminal end. Our results suggest a
model in which the biological effects of TSG101 are modulated either by
self-promoted proteolysis or participation with other cellular protein(s) in
a proteolytic feedback-control loop.
INTRODUCTION
Functional inactivation of the tsg101 tumor susceptibility gene by
antisense RNA in murine NIH3T3 fibroblasts leads to colony formation in 0.5% agar, focus formation in monolayer cultures, and the
ability to form metastatic tumors in athymic nude mice (1). Restoration of tsg101 activity reverses these features of neoplastic transformation as well as the nuclear, microtubule, and mitotic spindle abnormalities observed in TSG101-deficient cells (1, 2). Initial PCRbased findings of frequent intragenic DNA deletions within TSG101
in human breast cancers (3) have not been reproducible (4), and
Southern blotting has shown either no evidence of TSG101 genomic
mutations in breast tumors (5–7) or have shown genomic alterations
occurring at low frequency (8). Truncated TSG101 transcripts produced by alternative splicing (9) occur commonly in a variety of
human cancers (e.g., Refs. 3, 6, 7, and 10 –13), but also have been
observed in nonneoplastic tissues. The mechanism of action of
TSG101 is not known, although the gene has been proposed to have
a role in the regulation of ubiquitin-mediated proteolysis (14, 15) and
the modulation of nuclear receptor-mediated transcription activation
(16 –18).
Murine TSG101 is expressed from the one- or two-cell stage of
embryonic development (9) and is expressed ubiquitously in the
organs of adult mice and humans (3, 9). Either overexpression or
deficiency of TSG101 can result in tumorigenesis (1) or defective cell
cycling (2, 19), implying that either elevation or diminution of the
Received 9/28/99; accepted 2/11/00.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported in part by the 1993 Helmut Horten Research Award (to S. N. C.), by a
grant from the National Foundation for Cancer Research, and by a gift from the Chiron
Corporation.
2
Present address: Cereon Genomics, 45 Sidney Street, Cambridge, MA 02139.
3
To whom requests for reprints should be addressed. Phone: (650) 723-5315; Fax:
(650) 725-1536; E-mail: [email protected].
TSG101 steady-state level can lead directly or indirectly to abnormal
cell growth. A corollary of this statement is that TSG101 expression
normally may be stringently controlled. We report here investigations
that address the mechanism of regulation of TSG101 protein level. We
show that intracellular TSG101 protein is in fact maintained within a
narrow range in cultured cell populations by a posttranslational mechanism that modulates TSG101 protein degradation and prevents its
accumulation in cells overexpressing TSG101 mRNA. We further
show that regulation of the steady-state level of intracellular TSG101
protein is mediated by an evolutionarily conserved sequence (termed
the SB4) located near its COOH terminus.
MATERIALS AND METHODS
Cell Culture and Transfection. Human Ecr293 and mouse Ecr3T3 cell
lines (Invitrogen, San Diego, CA), which were used to study inducible expression of TSG101, can express adventitious genes under control of a modified
promoter containing Drosophila ecdysone-responsive DNA elements. These
cell lines and their derivatives were grown in DMEM supplemented with 10%
fetal bovine serum (Life Technologies, Inc., Gaithersburg, MD) and appropriate antibiotics. LipofectAMINE (Life Technologies, Inc.) was used to transfect
linearized DNA constructs into the cells according to procedures recommended by the manufacturer. Stable transfectants were selected and expanded
in media containing G418 at 600 – 800 ␮g/ml. To induce expression of the
adventitious proteins, cells at 40 –50% confluence were treated with analogues
of the steroid hormones ecdysone, MA at 1 ␮M, or PA at 5 ␮M dissolved,
which gave equivalent induction, for 24 hr, unless otherwise specified. Control
cells were treated with the same amount of solvent (␮l of 95% ethanol/10 ml
culture media) lacking inducer.
DNA Subcloning and Manipulation. The full-length protein coding sequence of mouse tsg101 cDNA is 10 AA residues longer at the NH2 terminus
than reported initially (1), as recently verified and corrected by us (GenBank
accession numbers U52945 and U82130) and others (9), and the corrected
sequence was used in the experiments reported here. Murine tsg101 cDNA was
excised by partial digestion with HindIII and digestion with NotI from
pLLEXP1 (1) and inserted into pIND (Invitrogen) that had been digested with
HindIII and NotI. The tsg101 coding sequence plus the 5⬘- and 3⬘-UTRs of the
previously cloned cDNA are present in the resulting pIND construct. Fulllength human TSG101 cDNA (3) was cleaved from pAMP1 by EagI and SalI
and inserted into pIND digested with NotI and XhoI. Flag-tagged TSG101
constructs were made by fusing the 8-AA Flag coding sequence (GACTACAAGGACGACGATGACAAG for AAs DYKDDDDK) in frame with the
last codon of the TSG101 protein coding sequence through a spacer of three
glycine codons (GGAGGTGGA). In-frame short deletions in mouse TSG101
were generated by linearization of the plasmid at an internal restriction enzyme
cleavage site, followed by treatment with S1 nuclease to delete several bases
at each end. Blunt ends were created using the Klenow fragment of Escherichia coli DNA polymerase I, and E. coli DNA ligase was used to recircularize the construct before transformation. LacZ fusion constructs were generated by joining the last codon of the E. coli LacZ gene in plasmids pINDLacZ and pIND(SP1)-LacZ to a TSG101 cDNA fragment coding for the
COOH-terminal polypeptide through a DNA linker (GGGATC for AAs G and
I). DNA sequencing was always performed to identify the appropriate in-frame
fusion and to verify the correctness of junctions, manipulated DNA segments,
and PCR-derived sequences.
4
The abbreviations used are: SB, steadiness box; AA, amino acid; MA, muristerone A;
PA, ponasterone A; UTR, untranslated region.
1736
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
REGULATION OF TSG101 PROTEIN LEVEL
Antibodies. Antisera against the full-length murine TSG101 protein or the
COOH-terminal 20 AAs were raised in rabbits, and the antibodies were
purified by affinity chromatography as described previously (2). Other antibodies used in this research included the M2 mouse monoclonal antibody
(Kodak, New Haven, CT) for detection of the Flag peptide and the antibody
against ␣-tubulin (Sigma, St. Louis, MO) for normalization of loading.
Gel Electrophoresis and Immunoblotting. Proteins in cell lysates were
separated by SDS-PAGE, electrotransferred to nitrocellulose filters, and analyzed by enhanced chemiluminescence (Amersham, Buckinghamshire, United
Kingdom).
Protein Labeling and Immunoprecipitation. Cells grown to about 50%
confluence were washed and incubated for 1 h in methionine-free DMEM
(Life Technologies, Inc.), followed by labeling of proteins in 150 ␮Ci/ml
[35S]methionine for the designated time. In pulse-chase experiments, the
labeling time was 1 h. For immunoprecipitations, labeled cells were washed in
PBS twice before being lysed in 2 ml of cold radioimmunoprecipitation assay
buffer [50 mM Tris-Cl (pH 7.5), 0.15 M NaCl, 1% Triton X-100, 0.5%
deoxycholate, 0.1% SDS, and proteinase inhibitors]. The lysates were centrifuged at 4000 rpm for 5 min, and supernatants were either stored at ⫺80°C or
used directly. Individual samples containing equal volumes of labeled extracts
were incubated for 1 h with 2 ␮g of nonspecific rabbit IgG and 30 ␮l of protein
A-agarose beads (Pharmacia, Uppsala, Sweden) on a rocking rotary shaker in
Fig. 2. Inverse correlation between the endogenous and adventitious TSG101 proteins.
A representative stable cell line, human Ecr293 transfected by the Flag-tagged mouse
cDNA construct, was induced to express the adventitious Flag-tagged mouse TSG101
protein (Flag-TSG101). Total protein from 8 ⫻ 104 cells was loaded in each lane.
Antibody against the full-length TSG101 protein was used for immunoblot analysis,
whereas antibody against ␣-tubulin was used as an internal control to normalize loading.
A, time course of induced expression of the adventitious protein. Cells at 40% confluence
were induced by adding 1 ␮M MA to the medium and harvested at the times shown. B,
expression of the adventitious protein under different inducer concentrations. Cultures
were induced for 24 h using different concentrations of MA. C, expression of the
adventitious protein after removal of the inducer. Cells were first cultured in medium
containing 1 ␮M MA for 24 h and then cultured in medium lacking inducer for up to 48 h.
They were harvested at the time points for immunoblot analysis. D, detection of the
adventitious protein in subculture passages continuously under induction. One-sixth of the
previous cell culture was inoculated for the next passage in each subculture. All subcultures were grown either in the absence of inducer (0 ␮M MA) or in the continuous
presence of inducer (1 ␮M MA) until harvested. P1–P5, passages 1–5.
Fig. 1. Induced adventitious TSG101 protein down-regulates the endogenous protein.
Mouse and human full-length cDNAs containing or lacking the Flag tag were inserted
downstream of an inducible promoter and transfected into human Ecr293 or mouse
Ecr3T3 cells. Stable transfectant cell lines were generated and tested for induced expression of the adventitious TSG101 proteins. For each cell line, equal amounts of total
cellular proteins from MA-induced (1 ␮M) and noninduced cells were analyzed by
immunoblotting using antibodies against the full-length TSG101 protein. A, Western blot
showing intracellular levels of combined nontagged mouse (adventitious) and human
(endogenous) TSG101 proteins in five representative cell lines. B and C, induced expression of Flag-tagged mouse and human TSG101 proteins in human Ecr293 cells, respectively. Induced and noninduced conditions were compared for two representative cell lines
for each construct. In addition to the endogenous human protein (hTSG101), a new band
was detected under induction; Flag-mTSG101 or Flag-hTSG101 indicates the adventitious
Flag-tagged mouse or human TSG101 protein. D, induced expression of Flag-tagged
mouse TSG101 protein (Flag-mTSG101) in mouse Ecr3T3 cells. The endogenous mouse
TSG101 protein is marked as mTSG101. E, Western blot detection of the adventitious
protein by antibody against TSG101 protein (left); protein immunoprecipitated by antibody against the Flag (right).
a cold room. The supernatant was then incubated with an excess amount of
specific antibody and 30 ␮l of protein A-agarose beads overnight. The beads
were washed four times with radioimmunoprecipitation assay buffer, and
bound proteins were dissolved by boiling in the loading buffer, separated on
SDS-PAGE gels, and analyzed by autoradiography. Protein concentrations
were estimated by serial dilution of the protein samples before loading onto
gels and by spectroscopic analysis of band intensities on X-ray films.
Northern Blot Analysis. Total RNAs were isolated from cells by RNA
STAT-60 (Tel-Test, Friendswood, TX), separated in agarose gels under denaturing conditions, and transferred using capillaries to Hybond-N nylon membranes (Amersham Life Sciences). Hybridization and washing were performed
under stringent conditions as described by Sambrook et al. (20).
RESULTS
Overexpression of Adventitious TSG101 Protein Leads to a
Decrease in Endogenous TSG101. In experiments initially aimed
at overproducing TSG101 protein, we placed mouse and human
TSG101 cDNAs containing the full-length coding sequence under the
control of a promoter inducible by MA or PA and introduced these
constructs by transfection into human Ecr293 cells to generate stable
cell lines. However, after induction, we observed little or no increase
1737
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
REGULATION OF TSG101 PROTEIN LEVEL
in total TSG101 protein from either construct by Western blot analysis
of whole cell extracts using antibody to full-length TSG101 as probe
(Fig. 1A). To determine whether TSG101 protein actually was being
expressed from adventitious constructs and to distinguish induced
TSG101 from the endogenous protein, we attached a nucleotide
segment encoding an 8-AA Flag sequence plus three additional spacer
AAs (see “Materials and Methods”) to the 3⬘ ends of human and
murine TSG101 protein coding sequences and generated Ecr293
(human) and Ecr3T3 (murine) stable transfectants containing these
constructs. After the addition of MA to these cultures, Western blot
analysis of cell extracts using antibodies made against either fulllength TSG101 or its COOH-terminal end detected human and murine
cDNA-encoded protein bands that migrated more slowly in gels
(calculated molecular weights of 49,000 and 50,000, respectively, in
both murine and human cells) than the respective endogenous
TSG101 proteins, which migrate near Mr 46,000 (Fig. 1, B–D).
Whereas the positions of these bands were higher than expected from
addition of the 11-AA Flag peptide and spacer to full-length TSG101
proteins, immunoprecipitations from Ecr293 cells by antibody against
the Flag peptide (Fig. 1E, right) confirmed that the slowly migrating
species made in these cells is Flag-tagged TSG101 protein derived
from the induced adventitious construct (Fig. 1E, left) rather than a
modified form of endogenous TSG101.
Additional Western blot analysis of Flag-tagged TSG101 in gels
showed that MA-induced expression of adventitious TSG101 protein
resulted in concomitant down-regulation of the resident protein, leading to replacement of endogenous TSG101 by the adventitious protein
in both human Ecr293 cells and mouse Ecr3T3 cells (Fig. 2). Because
similar results were observed in these cell lines during expression of
adventitious mouse and human TSG101 cDNAs, the cDNAs and cell
lines were used interchangeably in subsequent experiments. As seen
in Fig. 2, the extent of replacement of the endogenous protein varied
with the period of induced expression of the adventitious Flag-tagged
protein (Fig. 2A) and the concentration of inducer (Fig. 2B). In the
absence of inducer, little or no adventitious protein was expressed,
indicating effective control of the regulated promoter. Adventitious
TSG101 protein was first detected in elevated amounts 4 h after
induction, reached its maximum of twice the native level of endogenous protein at 8 h, and was maintained at this level throughout the
experiment as long as inducer was present (Fig. 2A). After 8 h of
induced expression of adventitious TSG101 by 1 ␮M MA, endogenous
Fig. 3. Northern blot analysis of induced TSG101 transcripts. Left, total TSG101
transcripts, including the adventitious and endogenous transcripts in Ecr293 cells, were
analyzed at different concentrations of MA. The probe used to detect the sum of mouse
and human TSG101 transcripts was a mixture of both mouse and human full-length
TSG101 cDNAs in equal amount. Middle, the endogenous transcript alone was analyzed
in the same RNA samples using the endogenous transcript-specific 3⬘-UTR of human
TSG101 cDNA as probe. Right, ethidium bromide-stained agarose gels served as loading
controls for RNA samples.
Fig. 4. Posttranslational regulation of TSG101 protein concentration. A, protein was
labeled in vivo with [35S]methionine for the indicated time periods under induced and
noninduced conditions. The cell line was derived by transfecting the Flag-tagged mouse
TSG101 cDNA construct into human Ecr293 cells. To label proteins synthesized under
induced conditions, cells at about 30% confluence were preinduced by 5 ␮M PA for 12 h
and then labeled in presence of the inducer for the times shown. Conditions were identical
for noninduced labeling, except that the inducer was replaced by the same volume of
solvent. Antibody against the COOH-terminal peptide was used for immunoprecipitation
as described in detail in “Materials and Methods.” The bars represent relative labeling
intensities detected from phosphor image. B, posttranslational turnover of the adventitious
and endogenous TSG101 proteins. Protein synthesized in vivo was labeled for 1 h with or
without induction as described for A. This pulse was then chased by transfer to nonradioactive media containing or lacking the inducer for the times indicated. Immunoprecipitation and detection were as described in A.
TSG101 began to decrease, and at 24 h, it was present in this
experiment at 20% of the initial level (Fig. 2A); the precise extent of
reduction of endogenous TSG101 varied slightly among different
experiments. At a MA concentration of 10 ␮M, adventitious TSG101
protein was present at more than 10 times the amount of endogenous
protein after 24 h of induction (Fig. 2B).
An inverse correlation between the intracellular levels of endogenous and adventitious TSG101 protein was also observed when expression of the adventitious protein was turned off by transfer of
MA-induced cells to medium lacking inducer (Fig. 2C). As Flagtagged adventitious TSG101 decayed, endogenous TSG101 gradually
retuned to its normal steady-state level. The ratio of Flag-tagged
adventitious TSG101 protein⬊endogenous native protein remained
unchanged during subculturing of continuously induced transfected
cell lines for more than 30 doublings (Fig. 2D), indicating that the
observed replacement of endogenous protein with adventitious protein
did not result from selective growth of induced cells. Interestingly, the
observed 1.5- to 2-fold increase in total (i.e., endogenous plus adventitious) TSG101 protein at the time of maximum induction was
associated with cell clumping and a more rounded cell morphology
compared with inducer-treated cells that did not overexpress TSG101
protein.
1738
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
REGULATION OF TSG101 PROTEIN LEVEL
Fig. 5. Mutations at the COOH-terminal domain of the adventitious protein affect down-regulation of the endogenous TSG101 protein. A, summary of results for the tested DNA
constructs, which are mutant derivatives of mouse TSG101 cDNA. These constructs were all introduced by transfection into Ecr293, and stable cell lines were established. UBC,
TSG101 domain resembling ubiquitin-conjugating enzyme; PPPP, proline-rich domain; CC2, coiled coil domain, SB, the steadiness box defined in these experiments (see text); ‚,
short in-frame deletions; F, Flag tag. The mutations are as follows: SD1-1 has a deletion of AAs 41– 43; SD2-9 has a replacement of AAs 50 –52 by Phe; SD3-17 has a deletion of
AAs 193–195; SD4-28 has a replacement of AAs 273–276 by Asp; and SD5–59 has a replacement of AAs 348 –351 by Gly. The deletion sites and fusion junctions involving the
COOH-terminal regions are indicated in Fig. 7: LD1-18 has a deletion of 42 AAs at the COOH-terminal; Z-cPEP1 and Z-cPEP2 were generated by fusing E. coli LacZ with cPEP1
and cPEP2, respectively (see “Materials and Methods” for details). B, immunoblot analysis showing the effects of mutated adventitious TSG101 protein on the endogenous protein.
Multiple stable transfectant cell lines were tested for each mutated construct, and all showed results similar to those seen here for one representative cell line. Cells were cultured with
or without 5 ␮M PA induction for 24 h as shown. Total cellular protein was adjusted to the same concentration before assay of the induced and noninduced cell lines. Antibody against
the full-length TSG101 protein was used in immunoblot analyses. C, induction time course for expression of LD1-18 in Ecr293. The protein amount was the same for each lane. The
arrow represents endogenous TSG101 protein. D, induction time course for expression of fused proteins containing TSG101 COOH-terminal peptides. Antibody was specifically
directed against the COOH-terminal peptide of TSG101 (2). Arrow, endogenous TSG101 protein; asterisk, internal control.
Down-Regulation of TSG101 Protein Is Posttranslational. In
contrast to the observations made for TSG101 protein, Northern
blot analysis showed that TSG101-specific mRNA increased 6to 10-fold 24 h after the addition of 1 or 10 ␮M MA to Ecr293
cells containing the Flag-tagged murine TSG101 construct (Fig. 3,
left). During this time, endogenous (human) TSG101 transcripts,
which were distinguishable from the adventitious (mouse) transcripts using a probe that detects their distinct 3⬘-UTR (GenBank
accession number U82130) remained at a constant level (Fig. 3,
middle). Given the observed dramatic decrease in endogenous
TSG101 protein under experimental conditions (Fig. 2), in which
endogenous mRNA production remained constant, the observed
down-regulation of TSG101 protein production must necessarily
be independent of any transcriptional control. To determine
whether this posttranscriptional control occurs at the level of
translation, we radioactively labeled total cellular protein with
[35S]methionine and analyzed the proteins immunoprecipitated by
excess anti-TSG101 antibody (Fig. 4A). In the absence of inducer,
a single radioactive band whose rate of synthesis was unaltered by
the induced synthesis of adventitious Flag-tagged TSG101 pro-
tein was observed, indicating that translation of the adventitious
protein does not interfere with the synthesis of endogenous
TSG101 and thus implying that the regulation of intracellular
TSG101 levels within a narrow range is accomplished posttranslationally.
The notion that almost-constant steady-state levels of TSG101
are maintained within cells by a posttranslational mechanism was
confirmed by pulse-chase experiments in which proteins synthesized in cells growing in the presence or absence of PA were
labeled with [35S]methionine for 1 h, transferred to media containing excess unlabeled methionine, and then cultured for the times
shown. As seen in Fig. 4B, after 8 h of nonradioactive chase of the
methionine pulse, the combined intracellular level of labeled adventitious and endogenous TSG101 proteins was less than the level
of endogenous TSG101 alone in noninduced cells, indicating that
overexpression of adventitious TSG101 accelerates the turnover
rate of the entire intracellular pool of TSG101 protein. These
findings implicate enhanced protein decay as the mechanism that
prevents intracellular accumulation of TSG101 during overexpression of the adventitious gene.
1739
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
REGULATION OF TSG101 PROTEIN LEVEL
Fig. 6. Characterization of the SB. The last 95 AAs at the COOHterminal end of human and mouse TSG101 proteins are aligned with
homologous sequences from C. elegans and yeast. The PILEUP and
PRETTY programs from the GCG package (25) were used for the
alignment. Gap penalty is 10. Length penalty is 1. Plurality is 3.
Uppercase letters represent the identical and conserved AA residues.
CC2 and SB regions are indicated. Arrows define the cPEP1 and
cPEP2 regions. cPEP1 was deleted in construct LD1-18. cPEP1 and
cPEP2 were fused to LacZ in the constructs Z-cPEP1 and Z-cPEP2,
respectively (Fig. 5). The dashed line shows the AAs deleted and
replaced with glycine in construct SD5-59 (Figs. 5 and 6). The circled
plus markers indicate the positively charged AA residues conserved in
all four aligned sequences.
A Conserved Region within the COOH-terminal Domain Is
Required for TSG101 Protein Autoregulation. To identify the
TSG101 sequences involved in posttranslational regulation of the
intracellular concentration, we constructed a set of in-frame short
deletion mutations within murine TSG101 cDNA and isolated stably
transfected Ecr293 cell clones containing these constructs (Fig. 5).
Cell lines showing induced expression were obtained at a high frequency for all constructs except SD4-28, which produced detectable
protein in only 5 of 40 clones. As seen in Fig. 5B, four of five TSG101
mutant proteins containing short in-frame deletions (i.e. constructs
DS1-1, DS2-9, SD3-17, and SD4-28, respectively) retained the ability
to down-regulate endogenous TSG101 protein after induction,
whereas the product of construct SD5-59, in which a glycine residue
replaced four AAs (AAs 348 –351; Fig. 5B), had little effect on the
intracellular level of endogenous protein. Confirmation that the
COOH-terminal end of adventitious TSG101 is necessary for downregulation of the endogenous protein was provided by our finding that
the LD1-18 construct, which lacks 42 AAs at the COOH-terminal end
of TSG101, totally lost this ability; additionally, unlike the full-length
adventitious TSG101 protein (Fig. 2), this overexpressed deletion
protein accumulated to 4 –5 times the normal level of endogenous
TSG101 (Fig. 5B, and C). Because the AA residues removed in this
construct are required for maintenance of the steady-state level of
TSG101 within a narrow range, this region of TSG101 was termed the
SB. The 3-AA internal deletion of SD5-59, which significantly reduced the ability of TSG101 protein to down-regulate its own intracellular level, is located in the SB (see Fig. 7).
To determine whether the COOH-terminal region alone is sufficient
for down-regulation, we constructed proteins containing TSG101
COOH-terminal peptides fused to LacZ gene and generated cell lines
expressing the fusion proteins (Fig. 5D). Production of these adventitious proteins at a level equivalent to or higher than the endogenous
protein failed to show a detectable decrease of endogenous TSG101.
Pulse-chase experiments comparing the turnover rate of endogenous TSG101 protein in cells that had been transfected by TSG101
cDNA constructs containing or lacking the SB (Fig. 5) directly implicated the SB in TSG101 turnover. As seen in Fig. 6, left, endogenous TSG101 was decreased by two-thirds during the first 8 h of
chase in cells overexpressing adventitious Flag-tagged full-length
TSG101 protein. However, cells showing comparable overexpression
of adventitious LD1-18 protein (Fig. 6, insert), which lacks the SB,
showed much less reduction of endogenous TSG101, suggesting that
the mutant is defective in its inability to accelerate decay of the
endogenous full-length protein.
DISCUSSION
Our results indicate that the steady-state level of TSG101 protein
normally is maintained within a narrow range during cell growth by a
mechanism that operates at the level of protein decay. Overexpression
of adventitious Flag-tagged TSG101 protein resulted in down-regu-
Fig. 7. COOH-terminal-deleted TSG101 protein fails to affect turnover of the endogenous TSG101. Left, a cell line containing Flag-tagged full-length mouse TSG101 cDNA
construct produced an adventitious protein, Flag-tagged mouse TSG101 on induction.
Right, a cell line containing LD1-18 (a COOH-terminal-deleted mouse cDNA construct)
adventitiously expressed a deleted TSG101 protein (⌬ TSG) on induction. The two cell
lines were preinduced for 12 h, pulse-labeled for 1 h, and then chased in fresh medium.
In all these steps, the media were supplemented with 5 ␮M PA as an inducer. Cells were
then collected after the indicated times and analyzed by immunoprecipitation. Induced
expression of the adventitious TSG101 proteins was monitored by immunoblotting in the
two cell lines immediately before labeling, as shown in the boxed insert. Antibody against
the COOH-terminal peptide, which detected both adventitious and endogenous full-length
TSG101 protein (left) and full-length endogenous TSG101 (right) was used for subsequent immunoprecepitations. The bars represent relative labeling intensities detected by
phosphor image after the bands were separated on DSD/PAGE gel.
1740
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
REGULATION OF TSG101 PROTEIN LEVEL
lation of the endogenous protein without affecting the intracellular
level of endogenous TSG101 mRNA, indicating that the observed
autoregulation of TSG101 expression occurs posttranscriptionally.
Pulse-chase experiments showed that overexpression of adventitious
TSG101 leads to increased turnover of both the endogenous and
adventitious TSG101 proteins, limiting the ability of TSG101 to
accumulate within cells. Continued overproduction of adventitious
TSG101, accompanied by continued accelerated turnover of the total
intracellular TSG101 protein pool, results in effective replacement of
the endogenous TSG101 protein by the adventitious protein.
These findings suggest a model in which the biological effects of
TSG101 are modulated either by self-promoted proteolysis or participation with other cellular protein(s) in a proteolytic feedback control
loop. The posttranslational autoregulation observed for TSG101 at the
level of protein decay is reminiscent of the mechanism that prevents
intracellular accumulation of the product of another tumor susceptibility gene, p53 (21). In that case, overproduction of p53 promotes the
synthesis of the MDM2 protein, which in turn accelerates p53 degradation (22, 23). If TSG101 participates in an analogous feedback
control loop with a second protein, its partner in the loop is also likely
to be affected by alterations in TSG101 production.
The ability of overexpressed TSG101 to accelerate its own degradation is consistent with the proposal that TSG101 may have a role in
proteolysis (14, 15). However, the COOH-terminal SB region that our
studies show is necessary for normal regulation of the intracellular
concentration of TSG101 is distinct from the ubiquitin-conjugase-like
domain previously identified in the NH2-terminal region of TSG101.
TSG101 derivatives lacking or mutated in the SB accumulate at
several times the normal level while also not reducing the concentration of endogenous TSG101 protein, demonstrating a crucial role for
this region in TSG101 autoregulation. However, truncated adventitious proteins containing only the SB fail to accomplish down-regulation of endogenous TSG101 (Fig. 6), indicating that the SB alone is
insufficient. Interestingly, the SB and its flanking sequences are the
most conserved regions of TSG101 homology among yeast, Caenorhabditis elegans, and mammals (Fig. 7), suggesting an evolutionarily
preserved function in these disparate organisms. Sequence similarity
in the SB is 69% between C. elegans and human or mouse and 56%
between yeast and these mammals. Among the 45 AAs in the SB,
there are 21 AAs (47%) conserved and 11 identical AAs (24%) in all
four species.
REFERENCES
1. Li, L., and Cohen, S. N. Tsg101: a novel tumor susceptibility gene isolated by
controlled homozygous functional knockout of allelic loci in mammalian cells. Cell,
85: 319 –329, 1996.
2. Xie, W., Li, L., and Cohen, S. N. Cell cycle-dependent subcellular localization of the
TSG101 protein and mitotic and nuclear abnormalities associated with TSG101
deficiency. Proc. Natl. Acad. Sci. USA, 95: 1595–1600, 1998.
3. Li, L., Li, X., Francke, U., and Cohen, S. N. The TSG101 tumor susceptibility gene
is located in chromosome 11 band p15 and is mutated in human breast cancer. Cell,
88: 143–154, 1997.
4. Li, L., Francke, U., and Cohen, S. N. Retraction. The TSG101 tumor susceptibility
gene is located in chromosome 11 band p15 and is mutated in human breast cancer.
Cell, 93: 660, 1998.
5. Steiner, P., Barnes, D. M., Harris, W. H., and Weinberg, R. A. Absence of rearrangements in the tumour susceptibility gene TSG101 in human breast cancer. Nat. Genet.,
16: 332–333, 1997.
6. Gayther, S. A., Barski, P., Batley, S. J., Li, L., de Foy, K. A., Cohen, S. N., Ponder,
B. A., and Caldas, C. Aberrant splicing of the TSG101 and FHIT genes occurs
frequently in multiple malignancies and in normal tissues and mimics alterations
previously described in tumours. Oncogene, 15: 2119 –2126, 1997.
7. Lee, M. P., and Feinberg, A. P. Aberrant splicing but not mutations of TSG101 in
human breast cancer. Cancer Res., 57: 3131–3134, 1997.
8. Wang, Q., Driouch, K., Courtois, S., Champeme, M. H., Bieche, I., Treilleux, I.,
Briffod, M., Rimokh, R., Magaud, J. P., Curmi, P., Lidereau, R., and Puisieux, A.
Low frequency of TSG101/CC2 gene alterations in invasive human breast cancers.
Oncogene, 16: 677– 679, 1998.
9. Wagner, K. U., Dierisseau, P., Rucker, E. B., III, Robinson, G. W., and
Hennighausen, L. Genomic architecture and transcriptional activation of the mouse
and human tumor susceptibility gene TSG101: common types of shorter transcripts
are true alternative splice variants. Oncogene, 17: 2761–2770, 1998.
10. Carney, M. E., Maxwell, G. L., Lancaster, J. M., Gumbs, C., Marks, J., Berchuck, A.,
and Futreal, P. A. Aberrant splicing of the TSG101 tumor suppressor gene in human
breast and ovarian cancers. J. Soc. Gynecol. Investig. 5: 281–285, 1998.
11. Lin, S. Y., Chen, Y. J., and Chang, J. G. Multiple truncated transcripts of TSG101 in
gastrointestinal cancers. J. Gastroenterol. Hepatol., 13: 1111–1114, 1998.
12. Oh, Y., Proctor, M. L., Fan, Y. H., Su, L. K., Hong, W. K., Fong, K. M., Sekido,
Y. S., Gazdar, A. F., Minna, J. D., and Mao, L. TSG101 is not mutated in lung cancer
but a shortened transcript is frequently expressed in small cell lung cancer. Oncogene,
17: 1141–1148, 1998.
13. Sun, Z., Pan, J., Bubley, G., and Balk, S. P. Frequent abnormalities of TSG101
transcripts in human prostate cancer. Oncogene, 15: 3121–3125, 1997.
14. Ponting, C. P., Cai, Y.D., and Bork, P. The breast cancer gene product TSG101: a
regulator of ubiquitination? J. Mol. Med., 75: 467– 469, 1997.
15. Koonin, E. V., and Abagyan, R. A. TSG101 may be the prototype of a class of
dominant negative ubiquitin regulators. Nat. Genet., 16: 330 –331, 1997.
16. Watanabe, M., Yanagi, Y., Masuhiro, Y., Yano, T., Yoshikawa, H., Yanagisawa, J.,
and Kato, S. A putative tumor suppressor, TSG101, acts as a transcriptional suppressor through its coiled-coil domain. Biochem. Biophys. Res. Commun., 245: 900 –905,
1998.
17. Sun, Z., Pan, J., Hope, W. X., Cohen, S. N., and Balk, S. P. Tumor susceptibility gene
101 protein represses androgen receptor transactivation and interacts with p300.
Cancer (Phila.), 86: 689 – 696, 1999.
18. Hittelman, A. B., Burakov, D., Iñiguez-Lluhı́, J. A., Freedman, L. P., and Garabedian,
M. J. Differential regulation of glucocorticoid receptor transcriptional activation.
EMBO J., in press, 2000.
19. Zhong, Q., Chen, Y., Jones, D., and Lee, W. H. Perturbation of TSG101 protein
affects cell cycle progression. Cancer Res., 58: 2699 –2702, 1998.
20. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory
Manual, Ed. 2. Plainview, NY: Cold Spring Harbor Laboratory, 1989.
21. Haupt, Y., Maya, R., Kazaz, A., and Oren, M. Mdm2 promotes the rapid degradation
of p53. Nature (Lond.), 387: 296 –299, 1997.
22. Kubbutat, M. H., Jones, S. N., and Vousden, K. H. Regulation of p53 stability by
Mdm2. Nature (Lond.), 387: 299 –303, 1997.
23. Kubbutat, M. H., Ludwig, R. L., Ashcroft, M., and Vousden, K. H. Regulation of
Mdm2-directed degradation by the C terminus of p53. Mol. Cell. Biol., 18: 5690 –
5698, 1998.
24. Zhong, Q., Chen, C. F., Chen, Y., Chen, P. L., and Lee, W. H. Identification of
cellular TSG101 protein in multiple human breast cancer cell lines. Cancer Res., 57:
4225– 4228, 1997.
25. Devereux, J., Haeberli, P., and Smithies, O. A comprehensive set of sequence analysis
programs for the VAX. Nucleic Acids Res., 12: 387–395, 1984.
1741
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.
TSG101 Protein Steady-State Level Is Regulated
Posttranslationally by an Evolutionarily Conserved
COOH-Terminal Sequence
Guo Hong Feng, Chih-Jian Lih and Stanley N. Cohen
Cancer Res 2000;60:1736-1741.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/60/6/1736
This article cites 21 articles, 5 of which you can access for free at:
http://cancerres.aacrjournals.org/content/60/6/1736.full.html#ref-list-1
This article has been cited by 27 HighWire-hosted articles. Access the articles at:
/content/60/6/1736.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2000 American Association for Cancer
Research.