Download Citrus testing manual - Post-entry quarantine

Citrus (Citrus),
Fortunella (Kumquat) &
Poncirus (Trifoliate orange)
Post-Entry Quarantine
Testing Manual
July 2010
Plant Health and Environment Laboratory
Investigation and Diagnostic Centres and Response
PO Box 2095, 231 Morrin Road, Saint Johns,
Auckland 1140, New Zealand
Telephone: +64-9-909 3015, Facsimile: +64-9-909 5739
www.mpi.govt.nz
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual
Contents
1.
SCOPE ................................................................................................................................................. 4
2.
INTRODUCTION ............................................................................................................................... 4
3.
IMPORT REQUIREMENTS .............................................................................................................. 6
4.
PESTS .................................................................................................................................................. 7
5.
4.1
Regulated pests for which generic measures are required ...................................................... 7
4.2
Regulated pests for which specific tests are required .............................................................. 7
4.3
Regulated pests for which specific tests are optional ............................................................... 9
PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE .................... 9
5.1
Nursery stock............................................................................................................................ 9
5.1.1
Dormant cuttings ............................................................................................................... 10
5.1.2
Plants in tissue culture ....................................................................................................... 10
5.2
Seed for sowing ....................................................................................................................... 11
5.3
Pollen ...................................................................................................................................... 11
6.
INSPECTION .................................................................................................................................... 12
7.
TESTING ........................................................................................................................................... 12
7.1
Specific tests for nursery stock ............................................................................................... 14
7.1.1
Graft indexing .................................................................................................................... 14
7.1.2
Serological and molecular assays....................................................................................... 18
7.1.2.1
Enzyme-linked immunosorbent assay (ELISA) ....................................................... 19
7.1.2.2
Polymerase chain reaction (PCR) ............................................................................. 20
7.1.2.2.1 Virus and viroid reverse transcription-PCR (RT-PCR)...................................... 22
7.1.2.2.1.1 Citrus leaf rugose virus .................................................................................. 23
7.1.2.2.1.2 Citrus leprosis virus ........................................................................................ 23
7.1.2.2.1.3 Citrus psorosis virus ....................................................................................... 24
7.1.2.2.1.4 Citrus tatter leaf virus..................................................................................... 24
7.1.2.2.1.5 Citrus tristeza virus......................................................................................... 24
7.1.2.2.1.6 Citrus variegation virus .................................................................................. 24
7.1.2.2.1.7 Indian citrus ringspot virus ............................................................................ 24
7.1.2.2.1.8 Olive latent virus 1.......................................................................................... 24
7.1.2.2.1.9 Satsuma dwarf virus ....................................................................................... 24
7.1.2.2.1.10 Citrus viroid I ................................................................................................. 24
7.1.2.2.1.11 Citrus viroid III .............................................................................................. 24
7.1.2.2.1.12 Citrus viroid IV .............................................................................................. 24
7.1.2.2.1.13 Citrus viroid V ................................................................................................ 24
7.1.2.2.1.14 Citrus viroid original sample .......................................................................... 25
7.1.2.2.1.15 Hop stunt viroid.............................................................................................. 25
7.1.2.2.2 Phytoplasma and bacterial PCR .......................................................................... 25
7.1.2.2.2.1 Australian citrus dieback .............................................................................. 28
7.1.2.2.2.2 ‘Candidatus Phytoplasma aurantifolia’......................................................... 28
7.1.2.2.2.3 ‘Candidatus Liberibacter africanus’ ............................................................. 28
7.1.2.2.2.4 ‘Candidatus Liberibacter americanus’ .......................................................... 28
7.1.2.2.2.5 ‘Candidatus Liberibacter asiaticus’ .............................................................. 29
7.1.2.2.2.6 Spiroplasma citri ............................................................................................ 29
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
2
7.1.3
7.1.4
7.1.5
7.1.2.2.2.7 Xanthomonas axonopodis pv. aurantifolii...................................................... 29
7.1.2.2.2.8 Xanthomonas citri subsp. citri........................................................................ 29
7.1.2.2.2.9 Xanthomonas alfalfae subsp. citrumelonis..................................................... 29
7.1.2.2.2.10 Xylella fastidiosa ............................................................................................ 29
Shoot-tip grafting ............................................................................................................... 29
Detached leaf bioassay ....................................................................................................... 31
Return-polyacrylamide gel electrophoresis (R-PAGE) ..................................................... 32
8.
CONTACT POINT ............................................................................................................................ 33
9.
ACKNOWLEDGEMENTS ............................................................................................................... 33
10. REFERENCES .................................................................................................................................. 34
Appendix 1. Types of grafting buds used for citrus ................................................................................. 38
Appendix 2. Symptoms of significant regulated pests of Citrus, Fortunella and Poncirus ...................... 39
2.1
‘Candidatus Phytoplasma aurantifolia’ .................................................................................. 39
2.2
‘Candidatus Liberibacter spp’ ................................................................................................ 39
2.3
Spiroplasma citri ..................................................................................................................... 40
2.4
Xanthomonas citri subsp. citri ................................................................................................. 40
2.5
Xylella fastidiosa ..................................................................................................................... 40
2.6
Citrus leprosis virus ................................................................................................................. 41
2.7
Citrus psorosis virus ................................................................................................................ 41
2.9
Citrus tristeza virus .................................................................................................................. 44
2.10
Citrus variegation virus ........................................................................................................... 45
2.12
Satsuma dwarf virus ................................................................................................................ 46
2.13
Citrus viroid III ....................................................................................................................... 47
2.16
Cristacortis ............................................................................................................................. 50
Appendix 3. Symptoms of nutrient deficiencies in Citrus, Fortunella and Poncirus................................ 51
3.1
Manganese deficiency ............................................................................................................. 51
3.2
Zinc deficiency ........................................................................................................................ 51
3.3
Magnesium deficiency ............................................................................................................ 51
3.4
Nitrogen deficiency ................................................................................................................. 51
Appendix 4. Protocols referenced in manual ........................................................................................... 52
3.1
Silica-milk RNA extraction protocol ...................................................................................... 52
3.2
Phytoplasma DNA enrichment CTAB extraction protocol ................................................... 52
3.3
Trizol® Reagent RNA extraction protocol ............................................................................. 53
3.4
CTAB RNA extraction protocol ............................................................................................. 53
3.5
R-PAGE .................................................................................................................................. 54
3.6
Preparation of media and rootstock seedlings for shoot-tip grafting .................................... 56
© Ministry for Primary Industries, July 2010
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
3
1.
SCOPE
The scope of this manual is limited to nursery stock (dormant cuttings and plants in tissue
culture only), seed for sowing and pollen of Citrus, Fortunella and Poncirus species
permitted entry into New Zealand as listed in the Ministry for Primary Industries‟s (MPI)
Plants Biosecurity Index (see: http://www1.mpi.govt.nz/cgi-bin/bioindex/bioindex.pl).
At the date of publication of this manual, these species were as follows:
Citrus aurantifolia
Citrus aurantium
Citrus bergamia
Citrus deliciosa
Citrus excelsa
Citrus grandis
Citrus hystrix
Citrus jambhiri
Citrus junos
Citrus latifolia
Citrus limon
Citrus limonia
Citrus macrophylla
Citrus madurensis
Citrus medica
Citrus meyerii
Citrus myrtifolia
Citrus nobilis
Citrus reshni
Citrus reticulata
Citrus sinensis
Citrus unshiu
Citrus volkameriana
Citrus paradisi (syn. Citrus paradisi)
Citrus reticulata
Citrus sinensis
Citrus tangelo
Fortunella crassifolia
Fortunella japonica
Fortunella margarita
Poncirus trifoliata (syn. Citrus trifoliata)
This manual describes the testing protocols specified in the import health standards for
these commodities. The manual also provides an introduction to the crop and guidance
on the establishment and maintenance of healthy plants in quarantine.
2.
INTRODUCTION
The genus Citrus, and the closely related genera of Poncirus and Fortunella, belong to
the sub-family Aurantioideae, family Rutaceae, of the order Sapindales. The genera
Citrus, Fortunella and Poncirus originated over 2 million years ago in the sub-tropical to
tropical regions of Southeast Asia, occurring from northern India, to China and Malaysia.
The distribution of the genera to the rest of the world was very slow, being recorded in
the eastern Mediterranean area a few centuries BC, and not spreading to the Americas
until the late 1400s. However, with a few exceptions, the crops are now grown
commercially between 35o N and 35o S of the equator.
Citrus plants are large shrubs, growing into small trees and in their natural habitat
reaching 5 to 15 m tall, with Poncirus and Fortunella being slightly smaller. Commercial
cultivars grafted onto rootstocks are maintained between 2 to 5 m tall. The plants may or
may not have thorns of varying length; the leaves are glossy with an entire margin with a
petiole that may be winged.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
4
The taxonomy of Citrus, and the relationships among species and genera are
controversial and are complicated by many factors, such as the biology of the crop, its
long history and area of cultivation, somatic mutations, and ease of hybridisation within
the genera and related genera (Poncirus and Fortunella). There are two commonly
accepted taxonomic systems in use today, with widely differing views on the number of
species. Swingle and Reece (1967) accepts only 16 species, whereas Tanaka (1977)
recognises 162 species. It appears that species rank has been afforded to many naturally
occurring, stable hybrids. Scora (1988), Barrett & Rhodes (1976) and Mabberley (1997)
contend there are only 3 natural species. Recent molecular studies by Barkley et al.
(2006) reinforce this contention and that Fortunella clusters within the Citrus genus, and
that Poncirus is a sister genus to Citrus.
The major Citrus species that are commercially important include Citrus sinensis (sweet
orange – both navel and Valencia), Citrus limon (lemon), Citrus latifolia and Citrus
aurantifolia (limes), Citrus paradisi (grapefruit), Citrus reticulata (Clementine
mandarin), Citrus unshiu (Satsuma mandarin). Other Citrus species and Fortunella
species (F. crassifolia, F. japonica, F. margarita) are grown in specific regions of the
world and generally are only of local commercial significance. Sour orange (Citrus
aurantium) is the preferred citrus rootstock for most citrus worldwide as it imparts
excellent internal qualities to the fruit of the trees growing on this rootstock, however,
with Citrus tristeza virus and its efficient vector Toxoptera citricida spreading throughout
the world, Poncirus and its hybrids have become the dominant rootstock for all citrus,
especially in New Zealand, except for some lemon cultivars which require alternative
roostocks.
Since the 1980s, total production and consumption of citrus has grown strongly with the
current annual worldwide production of citrus at over 105 million tonnes. In 2007, Brazil
was the largest producer, with 20,682,309 tonnes. China was the second largest with
19,617,100 tonnes. The United States of America produced 10,017,000 tonnes and
Mexico, 6,851,000. The production of citrus in home gardens throughout the world is
unknown (http://faostat.fao.org).
In New Zealand, the Citrus Budwood scheme has distributed approximately 1.4 million
buds of 93 citrus cultivars, mandarins comprising over 50%, with lemons and oranges
each with almost 20% of the buds sold. Most of these buds have been propagated onto
seedling Poncirus rootstock.
New Zealand citrus production is small by world standards, with a recorded production of
43,540 tonnes, commercially comprised of oranges, mandarins and lemons with a crop
volume of 21,640, 16,900, 5,000 tonnes respectively. Volumes for other crops are
unrecorded. Part of the crop is exported, with a value of NZ$4.4 million, and the
estimated value of the New Zealand domestic market is $16 million. (Fresh Facts 2006:
http://www.hortresearch.co.nz).
Importation of new citrus planting material is required to increase the production of New
Zealand citrus. Production can be increased by extending the maturity period of the
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
5
crops either by earlier or later maturing cultivars, by cultivars with increased yield, better
flavour or colour, or new to New Zealand cultivars that could show potential on the world
market. The imported citrus cultivars are derived from overseas breeding programmes,
and need to be evaluated for New Zealand growing conditions.
3.
IMPORT REQUIREMENTS
The import requirements for nursery stock (dormant cuttings and plants in tissue culture
only) of Citrus, Fortunella and Poncirus are set out in MPI‟s import health standard
“Importation of Nursery Stock”( http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf).
). Imported cuttings and tissue culture plants must meet the general requirements
(sections 1-3) and the additional specific requirements detailed in the “Citrus”,
“Fortunella” or “Poncirus” schedule as appropriate. In summary, an import permit is
required and a phytosanitary certificate must accompany all consignments certifying that
the nursery stock has been inspected and found to be free of any visually detectable
regulated pests, and has been treated for regulated insects and mites (cuttings only). All
material from non-accredited facilities must be grown for a minimum period of 16
months in a Level 3 post-entry quarantine facility where it will be inspected, treated
and/or tested for regulated pests. Material from accredited facilities must be grown for a
minimum period of either 6 (plants in tissue culture or dormant cuttings sourced from
mother plants grown in insect proof houses) or 16 months (dormant cuttings sourced
from mother plants grown open ground) in a Level 2 post-entry quarantine facility where
it will be inspected, treated and/or tested for regulated pests.
Country freedom is accepted as an alternative method for any of the specific tests for
nursery stock listed in this manual. Country freedom must be certified by the NPPO of
the exporting country using an additional declaration on the phytosanitary certificate.
The import requirements for Citrus, Fortunella and Poncirus seed for sowing are set out
in MPI‟s import health standard “Importation of Seed for Sowing”
(http://www.biosecurity.govt.nz/files/ihs/155-02-05.pdf). Imported seed can be imported
from specified countries and must meet the general requirements (sections 1-2) and the
specific requirements detailed in the “Citrus” schedule in section 3. In summary, an
import permit is not required but a phytosanitary certificate must accompany all
consignments certifying that the seeds are derived from an area in which Xanthomonas
axonopodis pv. citri is not known to occur. Seed meeting the import requirements is
given biosecurity clearance at the border without the need for post-entry quarantine.
The import requirements for pollen are stated in section 2.2.3 in MPI‟s import health
standard “Importation of Nursery Stock” (http://www.biosecurity.govt.nz/files/ihs/15502-06.pdf). An import permit is required, however there are no regulated pests affecting
pollen of Citrus, and pollen meeting the import requirements is given biosecurity
clearance at the border without the need for post-entry quarantine.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
6
4.
PESTS
A list of the regulated pests of Citrus Poncirus and Fortunella can be found in the
nursery stock import health standard (see section 3).
4.1
Regulated pests for which generic measures are required
Insects, mites, spiders, molluscs & fungi:
Refer to import health standard
Bacteria:
Burkholderia cepacia
[Nursery stock only]
Diseases of unknown aetiology:
Bud union disease
Citrus blight disease
Citrus yellow mottle
Lemon sieve tube necrosis
Shell bark of lemons
Zonate chlorosis
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
4.2
Regulated pests for which specific tests are required
Bacteria or bacteria-like organisms:
„Candidatus Liberibacter africanus‟
[Huanglongbing, Citrus greening]
„Candidatus Liberibacter asiaticus‟
[Huanglongbing, Citrus greening]
Spiroplasma citri
[Stubborn disease]
Xanthomonas axonopodis pv. aurantifolii1
[Citrus canker B & C]
Xanthomonas citri subsp. citri2
[Citrus canker A]
Xanthomonas alfalfae subsp. citrumelonis3
[Citrus bacterial spot]
Xylella fastidiosa
[Citrus variegated chlorosis strain]
Phytoplasmas:
Australian citrus dieback
„Candidatus Phytoplasma aurantifolia‟
[Nursery stock only]
[Nursery stock only] [Fig. 2.2]
[Nursery stock only] [Fig. 2.3]
[Nursery stock only]
[Nursery stock only] [Fig. 2.4]
[Nursery stock only]
[Nursery stock only] [Fig. 2.5]
[Nursery stock only]
[Nursery stock only] [Fig. 2.1]
1
Previously known as Xanthomonas campestris pv. aurantifolii
Previously known as Xanthomonas campestris pv. citri and X. axonopodis pv. citri
3
Previously known as Xanthomonas campestis pv. citrumelo and X. axonopodis pv. citrumelo
2
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
7
Viruses:
Citrus leaf rugose virus
Citrus leprosis virus
Citrus mosaic (badna)virus
[synonyms: Citrus yellow mosaic virus
and Indian citrus mosaic virus]
Citrus psorosis virus
[synonyms: Citrus ringspot virus and
Psorosis A & B complex)
Citrus tatter leaf virus
[synonym: Apple stem grooving virus]
Citrus tristeza virus
[strains not in New Zealand]
Citrus variegation virus
[synonym: Citrus infectious variegation virus]
Satsuma dwarf virus
[synonyms: Citrus leathery leaf virus,
Citrus mosaic (sadwa)virus, Navel orange
infectious mottling virus, Satsuma dwarf virus
- Natsudaidai dwarf strain]
[Nursery stock only]
[Nursery stock only] [Fig. 2.6]
[Nursery stock only]
[Nursery stock only] [Fig. 2.7]
[Nursery stock only] [Fig. 2.8]
[Nursery stock only] [Fig. 2.9]
[Nursery stock only]
[Nursery stock only] [Fig. 2.10]
[Nursery stock only] [Fig. 2.12]
Viroids:
Citrus viroid I,
[Nursery stock only]
[synonyms: CVd-Ia, Citrus bent leaf viroid,
CVd-Ib, and Citrus variable viroid]
Citrus viroid III
[Nursery stock only] [Fig. 2.13]
[synonym : Citrus dwarfing factor viroid]
Citrus viroid IV
[Nursery stock only]
Hop stunt viroid
[Nursery stock only] [Fig. 2.14]
[synonyms: Citrus cachexia viroid,
Xyloporosis viroid, CVd-IIa, CVd-IIb, CCaVd,
CVd-IIc, CVd II Ca909, causal agent of gum
pocket, gummy pitting, gummy bark and Kassala disease]
Diseases of unknown aetiology:
Blind pocket/concave gum4
Citrus chlorotic dwarf
Citrus fatal yellows
Citrus impietratura disease
Citrus sunken vein disease
Cristacortis
Rubbery wood
Yellow vein clearing of lemon
4
[Nursery stock only] [Fig. 2.15]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only]
[Nursery stock only] [Fig. 2.16]
[Nursery stock only]
[Nursery stock only]
Blind pocket and concave gum are thought to be the same disease
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
8
4.3
Regulated pests for which specific tests are optional
Bacterium-like organism:
„Candidatus Liberibacter americanus‟
[Huanglongbing, Citrus greening]
[Nursery stock only]
Viruses:
Indian citrus ringspot virus
Olive latent virus 1
[Nursery stock only]
[Nursery stock only] [Fig. 2.11]
Viroids:
Citrus viroid V
Citrus viroid original sample
[Nursery stock only]
[Nursery stock only]
5.
PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY
QUARANTINE
Plants must be maintained in a healthy, vigorous state. Citrus, Fortunella and Poncirus
plants in quarantine may exhibit symptoms associated with abiotic stresses such as water
and nutrient deficiencies (e.g. copper, iron, nitrogen, magnesium, manganese and zinc).
Potting up the plants to allow large root volumes and foliar feeding can help avoid these
problems, as can regular re-potting into fresh media. Symptoms of the most common
nutrient deficiencies are illustrated in Appendix 3. Further illustrations of nutrient
deficiencies can be found on the American Phytopathological Society‟s CD-ROM
„Nutrient Deficiencies and Toxicities of Plants‟ (www.aps.org) and Whiteside et al.
(1989).
The growing media should be pasteurised before the addition of nutrients and before use.
A good commercially-available, well composted bark potting mix or a peat/pumice mix
with an air-filled porosity of between 15% and 25%, and a water-holding capacity of
between 150 ml and 250 ml per litre can be used. Alternatively, the „modified UC‟
system (Roistacher, 1991) for growing media could be used, using New Zealand peat and
pumice instead. The potting mix should have base nutrient added containing major
(nitrogen, phosphorus, potassium, magnesium, calcium and sulphur) and trace elements
(boron, copper, iron, manganese, molybdenum and zinc), together with a slow-release
fertiliser, e.g. Osmocote® or Serrablend®, with a fritted trace element mix.
5.1
Nursery stock
Citrus, Fortunella and Poncirus nursery stock may be imported as dormant cuttings or as
plants in tissue culture.
It is important that pruning and cutting tools used on the imported plants are disinfected
between each plant. A 1% sodium hypochlorite solution has been found to be an effective
sterilising agent against citrus viruses and viroids (Roistacher et al. 1969; Roistacher
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
9
1991), and a “dip/wipe/dip/wipe” technique should be used on cutting equipment.
Alternatively, disposable razor blades may be used.
Plants must be maintained in a healthy, vigorous and free-growing state for adequate
expression of any disease symptoms, without any nutrient or water stresses. Plants can be
grown in greenhouse conditions throughout the year, with day temperatures of 25 oC-30oC
and minimum night time temperatures of 15-20oC. Growth of plants in quarantine must
not be restricted by nutrition, temperature or lighting. When plants are being indexed for
disease, they should be maintained at the appropriate temperature and conditions for the
disease in question. Slow-release fertiliser and fritted trace element mixture should be
applied at the recommended intervals to maintain the plants in a good growing condition.
Alternatively, a weak fertigation solution containing both major and minor elements with
a Conductivity Factor of 4 – 5 (Electricity Conductivity of 40 – 50) could be used as a
daily irrigation. Deficiency symptoms of nitrogen, manganese, zinc, copper, iron and
magnesium can occur if adequate nutrition is not maintained.
5.1.1 Dormant cuttings
New elite genetic and promising cultivars are most efficiently imported by budwood,
although tissue-cultured material can also be imported. It is advisable to import budwood
which arrives as bud-sticks containing 8-12 buds. In the post-entry quarantine facility, it
is most convenient to propagate new plants by budding, which is quick and reliable.
Budding is performed by slicing off a bud from the imported bud stick, complete with
bark and a sliver of wood and inserting this into a “T” cut in the stem of the
rootstock/indicator plant. Before insertion, the bark is lifted on the “T” cut in the stem of
the rootstock to form two flaps, then the bud is positioned against the wood of the stem,
the flaps closed over the bud, then bud and stem wrapped completely with tape and left
for 21 days. By this time, the bud should have calloused sufficiently for the tapes to be
removed and the stem of the rootstock cut off above the bud. The new scion bud should
start to grow in 14 days given sufficient heat and light, allowing disease status monitoring
observations to be made. Whip grafting can be used, but with this method more
budwood per graft is used and there is a higher failure rate. Other grafting techniques can
also be used, but these are more specialised, and are usually reserved for indexing of
citrus cultivars (Roistacher, 1991). Illustrations of the grafting technique can be found in
Appendix 1 and section 7.1.1 about graft indexing.
5.1.2 Plants in tissue culture
Plantlets are established using conventional tissue culture techniques. On arrival, the
plantlets which are growing in media contained in flasks are carefully removed in the
quarantine facility. The plantlets are washed to remove all traces of the old growing
media from the developing roots and planted into 50 mm diameter pots containing a
sterile 1:1 (v:v) peat:pumice or similar mixture with a medium term slow-release fertiliser
(e.g. Osmocote®). The potted plants should be covered to prevent moisture loss and
maintained in a light and temperature controlled incubator for the first three weeks, or
alternatively, the plants can be grown in a temperature controlled glasshouse with partial
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
10
shade and frequent misting for the same period. Once established the plants can be
maintained in the quarantine facility with increasing light intensity, re-potted as growth
permits and maintained as described above.
5.2
Seed for sowing
Seeds for rootstocks or indicator plants should be obtained from certified sources if
possible to eliminate the risk of any seed-borne diseases. If collected locally, Citrus seed
should be heat-treated at 52oC for 10 minutes in a water bath, then bought back quickly to
ambient temperature, or alternatively, the seed should be dipped for 3 minutes in a 1% 8hydroxy quinoline sulphate solution. Following treatment, the seed should be allowed to
air-dry before dusting with a fungicide powder (e.g. Thiram), to help to preserve them
during storage and to help prevent albinism when the seedlings germinate. Seed can be
stored at 4oC.
Improved and more even germination of citrus seed can be obtained if the seed coat is
removed before germination. Two common procedures are used for raising seed. The
first is pre-germination of seed in humid containers at 26-28ºC. The seeds are spread out
on moist tissue paper in Petri dishes/sealed plastic containers. When the hypocotyls
emerge, the seed are planted, hypocotyls down, in pasteurised seed-raising mix in 150
mm deep “root trainers”. When the plants are of sufficient size, they can be planted into
permanent pots of 2.5 to 5 litre capacity depending on the number of plants grown per
pot, or length of time growing in the pot. Care should be taken to discard any abnormal or
small plants. Alternatively, seed can be sown in deep (150-200 mm) planting trays
containing pasteurised seed-raising mix. The seed should be spaced 30–40 mm apart to
allow for growth, and covered with 6–10 mm of pasteurised mix. The seeds are allowed
to germinate and grow at 26-28oC with adequate watering. Plantlets can be transplanted
when of adequate size (150 mm tall) into permanent pots, taking care to discard any nonconforming plants or plants with bench roots. Rigid plastic pots are preferable to soft
polythene bags, as they are more robust and can withstand frequent handling.
5.3
Pollen
Imported pollen should have been collected from „balloon stage‟, unopened flowers from
disease-free plants, and dried for 24 hours over a desiccant prior to despatch. Freshly
collected and dried pollen loses its viability quickly and should be transported in chilled
containers. On arrival in the facility, the pollen should be sub-sampled into small vials,
capped with cotton wool or similar and placed inside another sealed container with a
desiccant e.g. silica gel, and stored at -20oC or -80oC until required. For flower
pollination, only the required amount of pollen needed for pollination should be removed
from the freezer as thawing and refreezing reduces its viability. Flowers to be pollinated
should be at the „balloon stage‟ and should be emasculated to prevent any self-pollination
and bagged to prevent contamination by insects. Pollination is best done by dipping a fine
artist‟s paintbrush in the pollen then dabbing it onto the stigma of the chosen female
parent. After pollination, the flower should be re-bagged to prevent any further
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
11
inadvertent pollination and labelled with date and pollen source. Any resulting seed
should be germinated and grown in an approved facility.
Pollen viability can be determined by the fluorochromatic reaction as described by
Heslop-Harrison and Heslop-Harrison (1970) or by germination on Petri plates of agar
containing dextrose and boric acid. Pollen is germinated for 24 hours at approximately
20°C and then killed by dropping 2 ml of an ethanol-based stain onto each plate.
Germination counts are determined with a compound microscope.
6.
INSPECTION
The inspection requirements for the operator of the facility are set out in the “MPI
Biosecurity Authority Standard PBC-NZ-TRA-PQCON” (see:
http://www.biosecurity.govt.nz/border/transitional-facilities/plants/pbc-nz-trapqcon.htm).
Photographs of symptoms caused by some of the significant regulated pests can be found
in Appendix 2. It is important to be aware that pot-grown plants can be prone to nutrient
deficiencies if not adequately fertilised and nutrient deficiencies can resemble virus
infection, e.g., chlorosis and necrosis. Photographs of common nutrient deficiencies can
be found in Appendix 3.
7.
TESTING
Each of the specific tests required by the import health standard (as listed in section 4 and
summarised in Table 1) must be performed irrespective of whether plants exhibit
symptoms. This testing is required to detect latent infections.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
12
Table 1: Summary of the regulated pests for Citrus indicating the specific tests that are
required (■), alternative (□) or optional ()
Organism type
Graft
inoculation
Bacteria or bacteria-like organisms1
„Candidatus Liberibacter
■
africanus‟
„Candidatus Liberibacter

americanus‟2
„Candidatus Liberibacter
■
asiaticus‟
Spiroplasma citri
□
Xanthomona axonopodis pv.
aurantifolii
Xanthomonas citri subsp. citri
Xanthomonas alfalfae subsp.
citrumelonis
Xylella fastidiosa
Phytoplasmas
Australian citrus dieback
„Candidatus Phytoplasma
■
aurantifolia‟
1
Viruses
Citrus leaf rugose virus
■
Citrus leprosis virus
■
Citrus mosaic virus
■
Citrus psorosis virus
■
Citrus tatter leaf virus
■
Citrus tristeza virus
□
[strains not in NZ]
Citrus variegation virus
■
Indian citrus ringspot virus2
Olive latent virus 1
Satsuma dwarf virus
■
Viroids1
Citrus viroid I
■
Citrus viroid III
■
Citrus viroid IV
■
Citrus viroid V2

Citrus viroid original sample2

Hop stunt viroid
■
Diseases of unknown aetiology
Blind pocket/concave gum
■
Citrus chlorotic dwarf
■
Citrus fatal yellows
■
Citrus impietratura disease
■
Citrus sunken vein disease
■
Cristacortis
■
Rubbery wood
■
Yellow vein clearing of lemon
■
1
2
ELISA
PCR
Shoot-tip
grafting
Detached
leaf
bioassay
Return
PAGE



□

□
□
□
□
□
□
□
□
□
□
□
□
■





□





□
□
□


□
□
□
□


□
Refer to section 4.2 for synonyms and disease names caused by these agents.
Pests not currently listed in the Import Standard; optional diagnostic tests are recommended.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
13
7.1
Specific tests for nursery stock
Citrus budwood is the primary source of tissue used for testing however, bark and leaves can
also be used. The selection of the tissue may vary depending on the pathogen targeted. It is
recommended that budwood is not collected during excessively hot weather because some
graft-transmissible pathogens can be temporarily inactive or suppressed by heat in the
peripheral branches of field trees (Roistacher and Calavan, 1974). Seasons with cooler
temperatures are preferable because pathogens actively replicate and the titre increases,
however, citrus viroids best sampled for in late summer when the temperatures are warmer.
When moving from tree to tree to collect tissue, clippers must be disinfected by dipping or
spraying in a 1% sodium hypochlorite solution. Immediately after collecting, the tissue
should be transferred into a clearly labelled polythene bag or plastic container to prevent
drying. An ice chest should be used for budwood storage, transportation and during the
collection. Upon arrival at the plant laboratory, specimens should be transferred and stored in
a refrigerator at 4-6°C. All surface water should be removed to avoid decay. Avoid freezing
the inoculum. Budwood can be maintained under refrigeration for two weeks or longer, but it
is recommended to graft or to extract nucleic acids as soon as possible. Samples that become
partially decayed or mouldy should not be tested, and further samples must be collected.
Graft indexing must be done in the early spring using young, vigorous indicator plants.
Laboratory tests for viruses (ELISA and RT-PCR) must be carried out in the spring using the
new flush of spring growth. Laboratory tests for phytoplasmas, viroids and bacteria (RTPCR and PCR) must be carried out at the end of the summer.
Each plant must be tested separately with the following exceptions, samples from up to 5
plants may be bulked for testing provided that either:
(a) the plants are derived from a single imported cutting which was split into separate
cuttings upon arrival in New Zealand, in the presence of a MPI inspector; or
(b) in the case of tissue culture where plants are clonal, and this is confirmed by evidence
from the national plant protection organisation in the exporting country.
7.1.1
Graft indexing
Each Citrus, Fortunella or Poncirus plant must be tested by bud-grafting onto 3 to 5 replicate
indicator species as listed in Table 2.
It is best to grow the indicator plants from young cuttings or seeds. See the recommended
grafting methods section below for details of these propagation methods. The indicator
plants are ready for grafting when they have two or more fully expanded leaves. The
indicator plants must be maintained in a vigorous state of growth before and after grafting,
and must be grown under moderate to warm temperatures (refer to Table 2) with
supplemented lighting to ensure a 16 hour photoperiod.
To avoid cross-contamination of plants during the grafting process, use a sterile scalpel for
each Citrus, Fortunella or Poncirus plant to be tested.
Recommended method
1. Remove leaves from the bud sticks to be tested. Bud sticks can be 15 to 20 cm long.
Label the bud sticks clearly and place them into a polyethylene bag and hold in an iced
container and/or keep refrigerated until used.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
14
2.
3.
4.
5.
6.
7.
8.
9.
The most common types of buds are:
(a) The „eyed bud‟. This is a single bud used for propagation.
(b) The „blind bud‟, with no bud. This is the preferred type for inoculation.
(c) The chip bud. This is used when the plants are not slipping.
All three are acceptable for inoculation.
The most common grafting technique is the „T‟ shape graft. Using a scalpel blade,
remove the young actively growing leaves close to the grafting area of the receptor
indicator and make a 1-2 cm vertical cut. A second cut is made above and horizontally.
The two cuts must form the shape of the letter „T‟. An opening is then made with the tip
of the knife from the top to accept the bud. Insert the test bud into the „T‟ opening and
wrap using polyethylene tape. Other wrapping material can also be used successfully,
however, polyethylene tape makes a very secure wrap and minimises dehydration.
It is recommended to use between 3 to 5 replicate indicators for every test.
At least two indicator plants must be left un-grafted as the negative controls. These
plants must be subjected to the same horticultural practices as the inoculated plants.
Optional: Indicators plants may be budded with positive control vegetative material.
The positive control material must be infected with a disease that produces distinctive
symptoms in an indicator. Please note that approval from a Chief Technical Officer is
required for propagation of unwanted organisms.
Two to three weeks after grafting, the wrapping tape should be removed and the grafted
bud examined for survival. If tape is cut with a knife or razor-blade, cutting tools should
be disinfected between plants with 1% sodium hypochlorite.
The growing temperatures and conditions and the time from inoculation to the
appearance of the first symptoms are detailed in Table 2. Most symptoms will be
apparent within 2 to 3 months, however, symptoms on indicators grafted with material
infected with „Candidatus Liberibacter spp.‟ or „Candidatus Phytoplasma aurantifolia‟
may take between 5 months to 2 years, or longer, to show symptoms.
It is important that the grafted plants are kept properly watered and not exposed to cold
temperatures during the test period.
Interpretation of results
The graft indexing results will only be considered valid if no symptoms are produced on each
of the negative controls (non-grafted plants). If the optional positive control was used, then
the correct symptoms must be produced on the indicator species or cultivar.
The symptoms produced by each of the regulated pathogens on woody indicators are
described in Table 2.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
15
Table 2: Recommended indicator cultivars for graft indexing
Organism
Indicator plant
Bacteria or bacteria-like organisms
„Candidatus Liberibacter
Sweet orange „Pineapple‟
spp.‟
Incubation
Temp.
18-25ºC
Spiroplasma citri
Sweet orange „Madame
Vinous‟
32-38ºC
Phytoplasma
„Candidatus Phytoplasma
aurantifolia‟
Lime
18-25ºC
Viruses1
Citrus leaf rugose virus
Citrus leprosis virus
Mexican lime or Eureka
lemon
24-27ºC
max. day
18-21ºC
min. night
Sweet orange (with difficulty) 18-25ºC
Citrus mosaic virus
Mexican lime or Sweet orange 24-27ºC
max. day
18-21ºC
min. night
Citrus psorosis virus
Sweet orange „Madame
Vinous‟
24-27ºC
max. day
18-21ºC
min. night
Citrus tatter leaf virus
Citrus excelsa and/or X
„Rusk‟ citrange
Citrus tristeza virus
Mexican lime
24-27ºC
max. day
18-21ºC
min. night
24-27ºC
max. day
18-21ºC
min.night
Citrus variegation virus
Rough lemon or Citron
24-27ºC
max. day
18-21ºC
min. night
Satsuma dwarf virus
„Dweet‟ tangor, mandarin
seedlings or „Satsuma‟ on
trifoliate rootstock if Citrus
tristeza virus is not present in
the test sample
Citron or lemon if Citrus
tristeza virus is present in the
test sample
26ºC
max. day
12-18ºC
min. night
Citron „Etrog Arizona 861‟
32-40ºC
max. day
25-30ºC
min. night
Viroids1,2
Citrus viroids I, III, IV, V
&
Citrus viroid original
sample (CVd OS)
Symptoms on indicator
Chlorotic mottling on leaves.
Symptoms appear within 5 to 7
months.
Stunted shoots and stunted plant,
chlorotic spots near leaf tip.
Symptoms apparent within 3 months.
Witches‟-Broom, sprouting.
Symptoms apparent within 2 years or
longer.
Lime: Leaf puckering.
Lemon: Pinpoint chlorotic spotting.
Symptoms for both appear within 4 to
6 weeks.
Necrotic lesions. Symptoms appear
within 3 months.
Symptoms dependent on cultivar.
Young leaves express mosaic, rings
or chlorotic spots within 70 days.
Shock symptoms, e.g. defoliation of
young leaves, followed by leafflecking and mottle in the new
shoots. Symptoms appear within 4 to
6 weeks.
Chlorotic mottle, leaf spotting and
blotching in citrange.
Symptoms appear within 5 to 7
weeks.
Vein clearing, vein darkening, leaf
cupping, and stem pitting. Vein
corking for severe isolates.
Symptoms appear 3 to 5 weeks (end
of first or second growth flush).
Young leaf patterns and leaf
distortion, puckered segments,
epinasty and chlorotic mottle.
Symptoms appear within 4 to 6
weeks.
Spoon or boat shaped leaves and
stunting. Symptoms apparent within
3 months.
Mild reaction in group I &V2.
Moderate reaction in group III & IV2.
Symptoms apparent within 6 to 12
months or longer.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
16
Hop stunt viroid
„Parson‟s special‟ mandarin
on Rough lemon rootstock
Diseases of unknown aetiology1
Blind pocket/Concave gum Mandarin or sweet orange
32-40ºC
max. day
25-30ºC
min. night
Gum in bark and scions. Gum in
scion just above the bud union and
cut back joints. Symptoms apparent
within 6 to 12 months or longer.
Vein flecking and oak leaf pattern
appears on young leaves of first
flush. Symptoms appear within 5 to 8
weeks.
Bent tip of leaf and a V-notch are the
first symptoms to appear. Crinkling,
warping, inverted cupping and
variegation on mature leaves.
Symptoms appear on first or second
new flush of growth within 5 to 8
weeks.
Epinasty, clearing of mid-veins, mid
vein curvature, and failure of leaves
to maintain normal size and colour.
Symptoms may show in new flush of
growth generally within 5 to 8 weeks.
Oak leaf pattern develops on young
leaves within 5 to 8 weeks.
Citrus chlorotic dwarf
Rough lemon
24-28ºC
max. day
18-21ºC
min. night
18-25ºC
Citrus fatal yellows
Alemow seedlings
25-32ºC
Citrus impietratura disease
Sweet orange for Oak leaf
pattern, „Dweet‟ tangor, or
mandarin
Citrus sunken vein disease
Alemow seedlings
24-28ºC
max. day
18-21 ºC
min. night
24-28ºC
max. day
18-21 ºC
min. night
Cristacortis
Screenhouse:
Tangelo „Orlando‟, „Webber‟
or „Williams‟ as scions grafted
on Sour orange
Seedlings:
„Dweet‟ tangor, „King‟,
„Kara‟, or „Dancy‟ mandarin
or sweet orange seedling
Sweet orange or lemon
24-27ºC
max. day
18-21ºC
min. night
Mexican lime or sour orange
18-25ºC
Rubbery wood
Yellow vein clearing of
lemon
27-32ºC
Veins sunken abaxially and raised
adaxially; episodes of formation of
small yellow leaves and twisting of
stems.
Symptoms may show in new flush of
growth generally within 5 to 8 weeks.
Screenhouse:
Deep pits in stem after 8 to 24
months.
Seedlings:
Oak leaf pattern or leaf fleck after 5
to 8 weeks.
Flexible, downward bent shoot.
Symptoms should appear within 3
months.
Vein clearing. Symptoms appear
within 2 months
Citrus aurantifolia (Lime); Citrus aurantium (Sour orange); Citrus jambhiri (Rough lemon); Citrus
macrophylla (Alemow); Citrus medica (Citron); Citrus reticulata Blanco × Citrus paradise (Tangelo);
Citrus reticulates (Mandarin); Citrus reticulata (Satsuma); Citrus sinensis (Sweet orange); X Citroncirus
webberi („Rusk‟ citrange); Poncirus trifoliate (Trifoliate)
1
2
Refer to section 4.2 for synonyms and disease names caused by these agents.
As some field sources may contain several viroids, the described symptoms may vary to
those described. The synergistic and inhibitory interactions of multiple infections may
delay or enhance symptoms causing pronounced dwarfing and epinasty or variable leaf
symptoms (Semancik and Duran Vila, 1991).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
17
7.1.2
Serological and molecular assays
ELISA is an ALTERNATIVE method for the following pathogens:
Citrus tristeza virus [strains not in New Zealand]
Xylella fasitdiosa
PCR is an ALTERNATIVE method for the following pathogens:
Bacteria or bacteria-like organisms:
Xanthomona axonopodis pv. aurantifolii
Xanthomonas citri subsp. citri
Xanthomonas alfalfae subsp. citrumelonis
Xylella fastidiosa
Viroids:
Citrus viroid I
Citrus viroid III
Citrus viroid IV
Hop stunt viroid
PCR is REQUIRED for the following pathogen:
Phytoplasma:
Australian citrus dieback
PCR is OPTIONAL for the following pathogens:
Bacteria or bacteria-like organisms:
„Candidatus Liberibacter africanus‟
„Candidatus Liberibacter americanus‟
„Candidatus Liberibacter asiaticus‟
Spiroplasma citri
Phytoplasmas:
„Candidatus Phytoplasma aurantifolia‟
Viruses:
Citrus leaf rugose virus
Citrus leprosis virus
Citrus psorosis
Citrus tatter leaf virus
Citrus tristeza virus [strains not in New Zealand]
Citrus variegation virus
Indian citrus ringspot virus
Olive latent virus 1
Satsuma dwarf virus
Viroids:
Citrus viroid V
Citrus viroid original sample
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
18
7.1.2.1
Enzyme-linked immunosorbent assay (ELISA)
Recommended method
1. Perform the ELISA according to the manufacturer‟s instructions. The following controls
must be included on each ELISA plate:
(a) positive control: infected leaf tissue or equivalent (Table 3); and
(b) negative control: Citrus, Fortunella and/or Poncirus leaf tissue known to be healthy;
and
(c) buffer control: extraction buffer only.
2. Add each of the samples and controls to the ELISA plate as duplicate wells. It is not
recommended to perform ELISA with plant samples or sap that has been frozen, unless it
has been demonstrated that it does not affect the performance of the test.
3. Measure the optical density 60 minutes after addition of the substrate or as recommended
in the manufacturer‟s instructions.
Antisera have been prepared against a number of citrus pathogens, however, not many are
commercially available. These antisera may be obtained by contacting research laboratories.
Commercial ELISA kits are available for Citrus tristeza virus and Xylella fastidiosa (Table
3).
Table 3: Source of antisera and positive controls for ELISA
Virus
Citrus tristeza virus
Xylella fastidiosa
Antisera1
Positive/negative control2
Agdia Cat. No. SRA 78900/0096
(Reagent set)
Agdia Cat. No. SRP 34501/0096
(Reagent set)
Agdia Cat. No. LPC 78900
Agdia Cat. No. LNC 78900
Agdia Cat. No. LPC 34501
Agdia Cat. No. LNC 34501
1
The catalogue numbers for the complete reagent sets are given; the reagents can also be
purchased separately.
2
The positive control is included if the complete reagent set for antisera is purchased.
Further information on the supplier listed in Table 3 can be found on their website:
Agdia Incorporated, USA (http://www.agdia.com).
The antisera listed have been tested by the Investigation and Diagnostic Centre and Response
– Tamaki, MPI. Alternative antisera and positive controls may be available from other
manufacturers but would require validation before use.
Interpretation of results
A result is considered positive if the mean absorbance of the two replicate wells is greater
than 2 times the mean absorbance of the negative control. The test will only be considered
valid if:
(a) the absorbances for the positive and negative controls are within the acceptable range
specified by the manufacturer; and
(b) the coefficient of variation (standard deviation / mean × 100), between the duplicate
wells is less than 20%.
If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are
close to the cut-off must be retested or tested using an alternative method recommended in
the import health standard if available (see Table 1).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
19
7.1.2.2 Polymerase chain reaction (PCR)
PCR primers used to detect viruses, viroids, spiroplasmas, phytoplasmas and bacteria of
Citrus are listed in Table 4, along with plant internal control primers for RNA and DNA. The
inclusion of an internal control assay is recommended to eliminate the possibility of PCR
false negatives due to extraction failure, nucleic acid degradation or the presence of PCR
inhibitors. The Nad5 primers amplify mRNA from plant mitochondria and the Gd1/Berg54
primers amplify the 16S rRNA gene from most prokaryotes as well as from chloroplasts.
The COX primers amplify the constitutive cytochrome oxidase 1 gene found in plant
mitochondria.
The PCR reagents listed for the methods described in this section have been tested by the
Investigation and Diagnostic Centre and Response – Tamaki, MPI. Alternative reagents may
give similar results but will require validation. Bovine Serum Albumin (BSA) is included in
the PCR reactions to overcome inhibitors that are present in Citrus, Fortunella and/or
Poncirus tissue.
Table 4: PCR primers used for the detection of regulated pests of Citrus, Fortunella
and/or Poncirus and plant internal controls
Target
Primer
Primer sequence 5′-3′
organism
name
Bacteria or bacteria-like organisms
TATAAAGGTTGACCTTTCGAGTTT
„Candidatus
A2
ACAAAAGCAGAAATAGCACGAACAA
Liberibacter
J5
africanus‟
AAGTCGAGCGAGTACGCAAGTACT
„Candidatus
GB1
CCAACTTAATGATGGCAAATATAG
Liberibacter
GB3
americanus‟
TATAAAGGTTGACCTTTCGAGTTT
„Candidatus
A2
ACAAAAGCAGAAATAGCACGAACAA
Liberibacter
J5
asiaticus‟
GCGGACAAATTAAGTAATAAAAGAGC
Spiroplasma citri
P58-6f
GCACAGCATTTGCCAACTACA
P58-4r
CTTCAACTCAAACGCCGGAC
Xanthomonas
J-pth1
CATCGCGCTGTTCGGGAG
axonopodis pv.
J-pth2
aurantifolii
CTTCAACTCAAACGCCGGAC
Xanthomonas
J-pth1
CATCGCGCTGTTCGGGAG
citri subsp. citri
J-pth2
Xanthomonas
alfalfae subsp.
citrumelonis
Xylella fastidiosa
J-RTpth3
J-RTpth4
J-Taqpth21
J-RTR
ib16Sup
J-RTR
ib16Sdown
J-taq16S-11
RST31
RST33
XF-F
XF-R
XF-P2
Tm
(ºC)
Band Reference
(bp)
62
669
64
1,027 Teixeira et al., 2005
62
703
Hocquellet et al.,
1999
56
450
Yokomi et al., 2008
58
197
Cubero & Graham,
2002
58
197
Cubero & Graham,
2002
ACCGTCCCCTACTTCAACTCAA
CGCACCTCGAACGATTGC
FAM-ATGCGCCCAGCCCAACGC-NFQ2
60
_
Cubero & Graham,
2005
GTGACGTAGCGAGCGTTTGA
60
_
Cubero & Graham,
2005
56
733
62
70
Minsavage et al.,
1994
Harper & Ward,
2010 (Unpub)
CCAAGTTGCCTCAGGGTCATA
FAM-AGCCACCAACGCGAACATAGA
CTCA-NFQ2
TGGACGTTGTGGTATCGGTG
TTGAAGTTGACGTGTGGCTG
CACGGCTGGTAACGGAAGA
GGGTTGCGTGGTGAAATCAAG
FAM-CGCATCCCGTGGCTCAGCC-NFQ3
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
Hocquellet et al.,
1999
20
Phytoplasmas
Universal
phytoplasma
P1
P7
AAGAGTTTGATCCTGGCTCAGGATT
CGTCCTTCATCGGCTCTT
53
R16F2
R16F2
ACGACTGCTAAGACTGG
TGACGGGCGGTGTGTACAAACCCCG
50
1,800 Deng & Hiruki, 1991
Schneider et al.,
1995
1,248 Lee et al., 1995
60
_
Christensen et al.,
2004
Phyto-F
Phyto-R
Phyto-P1
CGTACGCAAGTATGAAACTTAAAGGA
TCTTCGAATTAAACAACATGATCCA
FAM-TGACGGGACTCCGCACAAGCG-NFQ2
Viruses
Citrus leaf rugose
CLRV1F
virus
CLRV2F
Citrus leprosis virus CiLV-C F1
CiLV-C R1
Citrus psorosis virus Cons-F
Cons-R
Citrus tatter leaf
TL1F
virus
TL1R
Citrus tristeza virus CTV-P25F
CTV-P25R
Citrus variegation
CVVF
virus
CVVR
TCTGAGCATAAATACCCTTTGAGAACG
GAGGTAAAGTCGGTGCTATGAAGG
ATGCGGGGACTTGTGTTT
TGCGCTTTATGACCTTACCT
ACAAAGAAATTCCCTGCAAGGG
AAGTTTCTATCATTCTGAAACCC
TGAAAACCTTTGCTGCCACTTCT
TACTCTCCGAACCTGCCTCGAAA
AAAGAAGGCGACGATGTTGT
AGCTCCGGTCAAGAAATCTG
GAAGTCTCCTTCTCCACTTTTACGT
TCATTCTTCAACAACCAAGAAATTRCTTGG
56
814
Roy et al., 2005
56
278
58
411
F. Ochoa Corona,
2008, unpublished
Roy et al., 2005
58
309
Roy et al., 2005
56
509
56
701
S. Harper,
unpublished
Roy et al., 2005
Indian citrus
ringspot virus
Olive latent virus 1
CGAACTCATGAGCTTTGACTACACA
CCTTTGGTGAAGGCAACGTG
CTCACCCATCGTTGTGTGG
TTTCACCCCACCAAATGGC
TCTTTACGTTCCGTCTATGC
TACCTGCAAATATATCGCAG
58
942
Roy et al., 2005
50
747
Martelli et al., 1996
56
1,134 Shimomura &
Noguchi, 2003
CTGTAACCGGACCGGTCTCCTTC
ACGACCGCTCAGTCTCCTCT
55
247
Ito et al., 2002
CTCCGCTAGTCGGAAAGACTCCGC
TCACCAACTTAGCTGCCTTCGTC
TCTGGGGAATTTCTCTGCGGGACC
TCTATCTCAGGTCGCGAAGGAAGAAGC
TCGACGAAGGCCGGTGAGCA
CGACGACAGGTGAGTACTCTCTA
CGTCGACGAAGGCATGTGAGCTT
GTCCGCTCGACTAGCGGCAGAGAGC
CCGGGGCAACTCTTCTCAGAATCCA
GGCTCCTTTCTCAGGTAAG
55
271
Ito et al., 2002
55
209
Ito et al., 2002
55
294
Serra et al.,2008
55
166
Ito et al., 2002
55
300
Hadidi et al., 1992
GATGCTTCTTGGGGCTTCTTGTT
CTCCAGTCACCAACATTGGCATAA
ACGGAGAGTTTGATCCTG
AAAGGAGGTGATCCAGCCGCACCTTC
50-60
181
Menzel et al., 2002
50-62
1,500 Andersen et al., 1998
CGTCGCATTCCAGATTATCCA
CAACTACGGATATATAAGAGCCAAAACTG
FAM-TGCTTACGCTGGATGGAATG
CCCTNFQ2
=
60
74
ICRSV1F
ICSRV1R
Primer A
Primer B
Satsuma dwarf virus CP-L1(+)
CPL-R(-)
Viroids
Citrus viroid I
CB2-AP
CB2-CM
Citrus viroid III
CV3-AP
CV3-AM
Citrus viroid IV
CV4-AP4
CV4-AM3
Citrus viroid V
PI
PII
Citrus viroid original CB3-AP
sample
CB3-AM6
Hop stunt viroid
HSVd-H79
HSVd-C60
Internal controls
Plant RNA control
Plant DNA control
& Bacteria
Plant DNA control
Nad5-F
Nad5-R
Gd1
Berg54
COX-F
COX-R
COX- P1
1
Weller et al., 2000
Real-time probe; 2NFQ= Non-fluorescent quencher.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
21
7.1.2.2.1 Virus and viroid reverse transcription-PCR (RT-PCR)
Recommended method for RNA viruses and viroids: Conventional RT-PCR
1. Extract total RNA according to a standard protocol. Successful RT-PCR amplification
can be achieved using RNA that has been extracted using the following methods:
(a) RNeasy® Plant Mini Kit (Qiagen Cat. No. 74904); or
(b) RNeasy® Plant Mini Kit (Qiagen Cat. No. 74904) with a modified lysis buffer as
described by MacKenzie et al. (1997); or
(c) silica-based method as described by Menzel et al. (2002).
See Appendix 4 for details of the latter two extraction methods. Alternative methods may
also be used after validation.
2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5 internal control primers
(Table 4) using the components and concentrations listed in Table 5 and cycle under the
conditions listed in Table 6.
3. Perform a one-step RT-PCR on the RNA with the pathogen-specific primers (Table 4)
using the components and concentrations listed in Table 5 and cycle under the conditions
listed in Table 6. The following controls must be included for each set of RT-PCR
reactions:
(a) positive control: RNA of the appropriate virus or viroid extracted from any host
tissue or a cDNA clone. If the internal control primers are not used, then the RNA
or cDNA clone must be mixed with healthy citrus RNA to rule out the presence of
PCR inhibitors.
(b) no template control: water is added instead of RNA template.
When setting up the test initially, it is advised that a negative control (RNA extracted
from healthy citrus leaf tissue) is included. Please note that the Nad5 internal control
primers do not reliably amplify a product from RNA extracted from freeze-dried material.
We therefore recommend mixing fresh healthy citrus leaf material with freeze-dried
positive control material (3:1 w/w) prior to carrying out the extraction.
4. Analyse the PCR products by agarose gel electrophoresis.
Table 5: Generic one-step RT-PCR for RNA viruses and viroids using Invitrogen OneStep RT-PCR System with Platinum® Taq DNA Polymerase
Reagent
Sterile deionised H2O
2 × Reaction mix (Invitrogen)
10 µM Forward primer
10 µM Reverse primer
SuperScriptTM III RT / Platinum® Taq Mix (Invitrogen 12574-026)
10 µg/µl Bovine Albumin Serum (BSA) (Sigma A7888)
RNA template
Total
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
Volume per reaction (µl)
2.1
4.2
5.0
0.5
0.5
0.4
0.5
1.0
10.0
10.0
1.0
1.0
0.8
1.0
2.0
20.0
22
Table 6: Generic PCR cycling conditions
Step
Temperature
Time
cDNA synthesis
Initial denaturation
Denaturation
Annealing
50oC
94oC
94oC
See Table 3
Elongation
72oC
Final elongation
72oC
30 min (Invitrogen)
2 min
30 sec
30 sec
30 to 45 sec (viruses, viroids)
1 min (bacteria, fungi, phytoplasmas)
7 min
No. of
cycles
1
1
40
1
Interpretation of results
The RT-PCR test will only be considered valid if:
(a) the positive control produces the correct size product as indicated in Table 4; and
(b) no bands are produced in the negative control (if used) and the no template control.
If the Nad5 internal control primers are used, then the negative control (if used), positive
control and each of the test samples must produce a 181 bp band. Failure of the samples to
amplify with the internal control primers suggests that the RNA extraction has failed,
compounds inhibitory to PCR are present in the RNA extract or the RNA has degraded.
Virus positive controls for PCR
1. The following viruses may be obtained from the American Type Culture Collection
(ATCC; http://www.atcc.org):
(a) Citrus variegation virus (as: Citrus leaf rugose virus); Cat. No. PV-195.
(b) Citrus tristeza virus; Cat. No. PVMC-3, PVMC-5.
(c) Satsuma dwarf virus (as: Natsudaidai dwarf virus); Cat. No. PVMC-58.
(d) Satsuma dwarf virus (as: Citrus mosaic virus); Cat. No. PVMC-59, PVMC-60.
2. The following viruses may be obtained from the German Resource Centre for Biological
Material (DSMZ; http://www.dsmz.de):
(a) Citrus tristeza virus; Cat. No. 0332.
3. Citrus tristeza virus may also be obtained from the commercial source listed in Table 3.
4. Nucleic acid positive controls for Citrus leprosis virus, Citrus psorosis virus, Citrus tatter
leaf virus, Citrus tristeza virus, Citrus variegation virus, Indian citrus ringspot virus,
Satsuma dwarf virus, Hop stunt viroid, Citrus viroids I, II, III and V may be obtained
from the Investigation and Diagnostic Centre – Tamaki, MPI Biosecurity New Zealand
(see the Contact Point, section 8). A charge may be imposed to recover costs.
5. Positive control material for Citrus viroid IV, Citrus viroid original sample, Citrus leaf
rugose virus and Olive latent virus 1 are currently unobtainable; it has therefore not been
possible to validate the relevant PCRs for these viruses and viroids.
7.1.2.2.1.1 Citrus leaf rugose virus
It is optional to test for Citrus leaf rugose virus by RT-PCR using the primer pair listed in
Table 4. See section 7.1.2.2.1 for details of test methods and interpretation of results. Please
note that as a suitable positive control is not commercially available, it has not been possible
to validate this PCR.
7.1.2.2.1.2 Citrus leprosis virus
It is optional to test for Citrus leprosis virus by RT-PCR using the primer pair listed in Table
4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
23
7.1.2.2.1.3 Citrus psorosis virus
It is optional to test for Citrus psorosis virus by RT-PCR using the primer pair listed in Table
4. See section 7.1.2.2.1 for details of test methods and interpretation of results
7.1.2.2.1.4 Citrus tatter leaf virus
It is optional to test for Citrus tatter leaf virus by RT-PCR using the primer pair listed in
Table 4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.5 Citrus tristeza virus
It is optional to test for Citrus tristeza virus by RT-PCR using the primer pair listed in Table
4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.6 Citrus variegation virus
It is optional to test for Citrus variegation virus by RT-PCR using the primer pair listed in
Table 4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.7 Indian citrus ringspot virus
It is optional to test for Indian citrus ringspot virus by RT-PCR using the primer pair listed in
Table 4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.8 Olive latent virus 1
It is optional to test for Olive latent virus 1 by RT-PCR using the primer pair listed in Table
4. See section 7.1.2.2.1 for details of test methods and interpretation of results. Please note
that as a suitable positive control is not commercially available, it has not been possible to
validate this PCR.
7.1.2.2.1.9 Satsuma dwarf virus
It is optional to test for Satsuma dwarf virus by RT-PCR using the primer pair listed in Table
4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.10 Citrus viroid I
Plants can be tested for Citrus viroid I by RT-PCR using the primer pair listed in Table 4. See
section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.11 Citrus viroid III
Plants can be tested for Citrus viroid III by RT-PCR using the primer pair listed in Table 4.
See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.1.12 Citrus viroid IV
Plants can be tested for Citrus viroid IV by RT-PCR using the primer pair listed in Table 4.
See section 7.1.2.2.1 for details of test methods and interpretation of results. Please note that
as a suitable positive control is not commercially available, it has not been possible to
validate this PCR.
7.1.2.2.1.13 Citrus viroid V
It is optional to test for Citrus viroid V by RT-PCR using the primer pair listed in Table 4.
See section 7.1.2.2.1 for details of test methods and interpretation of results.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
24
7.1.2.2.1.14 Citrus viroid original sample
It is optional to test for Citrus viroid original sample by RT-PCR using the primer pair listed
in Table 4. See section 7.1.2.2.1 for details of test methods and interpretation of results.
Please note that as a suitable positive control is not commercially available, it has not been
possible to validate this PCR.
7.1.2.2.1.15 Hop stunt viroid
Plants can be tested for Hop stunt viroid by RT-PCR using the primer pair listed in Table 4.
See section 7.1.2.2.1 for details of test methods and interpretation of results.
7.1.2.2.2 Phytoplasma and bacterial PCR
Recommended method for phytoplasma: Conventional PCR
1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol.
Successful PCR amplification can be achieved using the following DNA extraction
procedures:
(a) Qiagen DNeasy® Plant Mini Kit (Qiagen Cat. No. 69104); or
(b) phytoplasma enrichment procedure as described by Kirkpatrick et al. (1987) and
modified by Ahrens & Seemüller (1992) (see Appendix 4 for details of the extraction
method).
Alternative methods may also be used after validation.
2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 4) using
the components and concentrations listed in Table 7 and cycle under the conditions listed
in Table 6 (section 7.1.2.2.1). Perform a nested PCR on the purified DNA using the
universal phytoplasma primer pair P1/P7 (Table 4), for the first-stage PCR, followed by
the R16F2/R16R2 primer pair (Table 4) for the second-stage PCR.
3. Set-up the first-stage and second-stage PCR reactions using the components and
concentrations listed in Table 7 and cycle under the conditions listed in Table 6. (The
first-stage PCR products are diluted 1:25 (v/v) in water prior to re-amplification using the
second-stage PCR primers). The following controls must be included for each set of PCR
reactions:
(a) positive control: DNA from any phytoplasma extracted from any host tissue. A
cloned fragment of the phytoplasma may also be used. If the internal control primers
are not used, then the phytoplasma DNA must be mixed with healthy citrus DNA to
rule out the presence of PCR inhibitors.
(b) no template control: water is added instead of DNA template. An additional no
template control is included in the second-stage PCR.
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy citrus tissue is included.
4. Analyse the products from the first and second-stage PCRs by agarose gel
electrophoresis.
Recommended method for bacteria: Conventional PCR
1. Extract total DNA from leaf petioles and mid-veins. Successful PCR amplification can be
achieved using DNA extracted with the DNeasy® Plant Mini Kit (Qiagen Cat. No.
69104). An alternative method may also be used after validation.
2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 4) using
the components and concentrations listed in Table 7 and cycle under the conditions listed
in Table 6.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
25
3. Perform a PCR with the bacteria-specific primers on the purified DNA using the
components and concentrations listed in Table 7 and cycle under the conditions listed in
Table 6. The following controls must be included for each set of PCR reactions:
(a) positive control: total DNA or a cloned fragment from the appropriate bacteria. If the
internal control primers are not used, then the DNA must be mixed with healthy citrus
DNA to rule out the presence of PCR inhibitors.
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy citrus leaf tissue) is included.
4. Analyse the PCR products by agarose gel electrophoresis.
Interpretation of results
The pathogen-specific PCR test will only be considered valid if:
(a) the positive control produces the correct size product as indicated in Table 4; and
(b) no bands are produced in the negative control (if used) and the no template control.
If the Gd1/Berg54 internal control primers are also used, then the negative control (if used),
positive control and each of the test samples must produce a 1500 bp band. Failure of the
samples to amplify with the control primers suggests that either the DNA extraction has
failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An
effective method to further purify the DNA is by using MicroSpin™ S-300 HR columns (GE
Healthcare Cat. No. 27-5130-01).
Recommended method for phytoplasma and bacteria: Real-time PCR
1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol (as
described above).
2. Set-up the PCR using pathogen-specific primers (Table 4) and the components and
concentrations listed in Table 8 for bacteria or Table 9 for phytoplasma, and cycle under
the conditions listed in Table 10. Please note that reaction and cycling conditions can be
changed depending on the real-time machine used, but this would require validation.
3. Optional: Perform PCR on the nucleic acid using the COX internal control primers
(Table 4), and using the components and concentrations listed in Table 8 for bacteria or
Table 9 for phytoplasma and cycle under the conditions listed in Table 10.
4. The following controls must be included for each set of reactions:
(a) Positive control: For phytoplasma and bacteria, total DNA or a cloned fragment
from the appropriate organism may also be used. If the internal control primers are
not used, then the DNA must be mixed with healthy citrus DNA to rule out the
presence of PCR inhibitors; and
(b) no template control: water is added instead of DNA template
5. When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy citrus leaf tissue) is included.
6. Analyse real-time amplification data according to the real-time thermocycler
manufacturer‟s instructions.
Interpretation of results for real-time PCR
The real-time PCR test will only be considered valid if:
(a) the positive control produces an amplification curve with the pathogen-specific
primers; and
(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative
control (if used) and the no template control.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
26
If the COX internal control primers are also used, then the negative control (if used), positive
control and each of the test samples must produce an amplification curve. Failure of the
samples to produce an amplification plot with the internal control primers suggests that the
DNA extraction has failed or compounds inhibitory to PCR are present in the DNA extract or
the DNA has degraded.
Table 7: Generic PCR for DNA templates using Invitrogen Platinum Taq DNA
polymerase
Reagent
Sterile H2O
10 × PCR buffer
10 µg/µl Bovine Albumin Serum (BSA) (Sigma A7888)
50 mM MgCl2
10 mM dNTPs
5 µM Forward primer
5 µM Reverse primer
5 U/µl Platinum Taq DNA polymerase (Invitrogen 10966-026)
DNA template
Total
Volume per reaction (µl)
11.8
2.0
1.0
0.6
0.4
1.0
1.0
0.2
2.0
20.0
Table 8: Generic real-time PCR for bacteria using Invitrogen Platinum® qPCR
SuperMix-UDG
Reagent
Sterile H2O
2 × Reaction Mix (Invitrogen 11730-017)
10 µg/µl Bovine Albumin Serum (BSA) (Sigma A7888)
5 µM Forward primer
5 µM Reverse primer
5 µM Dual-labelled fluorogenic probe
DNA
Total
Volume per reaction (µl)
4.6
10.0
1.2
1.2
0.5
0.5
2.0
20.0
Table 9: Generic real-time PCR for phytoplasma using Roche LightCycler 480 Probes
Mastermix
Reagent
Sterile H20
2 x Reaction Mix (Roche 04707494001)
10 µg/µl Bovine Albumin Serum (BSA) (Sigma A7888)
5 µM Forward primer
5 µM Reverse primer
5 µM Dual-labelled fluorogenic probe
DNA
Total
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
Volume per reaction (µl)
4.6
10.0
0.8
1.2
1.2
0.5
2.0
20.0
27
Table 10: Generic cycling conditions for real-time PCR
Step
UDG incubation hold
(Invitrogen only)
Initial denaturation
Temperature
50ºC
Time
2 min
95oC
Denaturation
Annealing
95oC
See Table 3
2 min (Invitrogen)
5 min (Roche)
10-15 sec
40 sec
No. of cycles
1
1
40
Phytoplasma and bacterial positive controls for PCR
1. The following cultures may be obtained from the Landcare Research International
Collection of Micro-organisms from Plants (ICMP);
http://www.landcareresearch.co.nz/research/biodiversity/fungiprog/icmp.asp) for:
(a) Xanthomonas axonopodis pv. aurantifolii ICMP 14283, 14285,
(b) Xanthomonas citri subsp. citri; ICMP No. 20 to 30.
(c) Xanthomonas alfalfae subsp. citrumelonis; ICMP No. 10009, 10012.
(d) Xylella fastidiosa; ICMP No. 6575, 6576, 8729-8745, 8693, 8694.
2. Positive control material for Spiroplasma citri may be obtained from Agdia Incorporated,
USA (http://www.agdia.com). Cat. No. LPC14700.
3. Positive control DNA of‟ „Candidatus Liberibacter africanus‟, „Candidatus Liberibacter
americanus‟, „Candidatus Liberibacter asiaticus‟, Spiroplasma citri, Xanthomonas
axonopodis pv. aurantifolii, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis
pv. citrumelo, Xylella fastidiosa and „Candidatus Phytoplasma aurantifolia‟ may be
obtained from the Investigation and Diagnostic Centre – Tamaki, MPI Biosecurity New
Zealand (see the Contact Point, section 8). A charge may be imposed to recover costs.
7.1.2.2.2.1 Australian citrus dieback
Australian citrus dieback can be tested for by nested-PCR or real-time PCR using the primer
pair listed in Table 4. See section 7.1.2.2.2 for details of test methods and interpretation of
results.
7.1.2.2.2.2 ‘Candidatus Phytoplasma aurantifolia’
It is optional to test for ‘Candidatus Phytoplasma aurantifolia‟ by nested-PCR or real-time
PCR using the primer pair listed in Table 4. See section 7.1.2.2.2 for details of test methods
and interpretation of results.
7.1.2.2.2.3 ‘Candidatus Liberibacter africanus’
It is optional to test for ‘Candidatus Liberibacter africanus‟ by PCR using the primer pair
listed in Table 4. See section 7.1.2.2.2 for details of test methods and interpretation of results.
7.1.2.2.2.4 ‘Candidatus Liberibacter americanus’
It is optional to test for „Candidatus Liberibacter americanus‟ by PCR using the primer pair
listed in Table 4. See section 7.1.2.2.2 for details of test methods and interpretation of results.
This PCR should be cycled under the conditions in shown in Table 11 (below).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
28
Table 11. Cycling conditions for ‘Candidatus Liberibacter americanus’
Step
Temperature
Time
Initial denaturation
Denaturation
Annealing
Elongation
Final elongation
94oC
94oC
64ºC
72oC
72oC
2 min
45 sec
45 sec
1 min
10 min
No. of
cycles
1
40
1
7.1.2.2.2.5 ‘Candidatus Liberibacter asiaticus’
It is optional to test for ‘Candidatus Liberibacter asiaticus‟ by PCR using the primer pair
listed in Table 4. See section 7.1.2.2.2 for details of test methods and interpretation of results.
7.1.2.2.2.6 Spiroplasma citri
It is optional to test for Spiroplasma citri by PCR using the primer pair listed in Table 4. See
section 7.1.2.2.2 for details of test methods and interpretation of results.
7.1.2.2.2.7 Xanthomonas axonopodis pv. aurantifolii
Plants can be tested for by Xanthomonas axonopodis pv. aurantifolii by conventional PCR
using the primer pairs listed in Table 4. See section 7.1.2.2.2 for details of test methods and
interpretation of results.
7.1.2.2.2.8 Xanthomonas citri subsp. citri
Plants can be tested for by Xanthomonas citri subsp. citri by conventional or real-time PCR
using the primer pairs listed in Table 4. See section 7.1.2.2.2 for details of test methods and
interpretation of results.
7.1.2.2.2.9 Xanthomonas alfalfae subsp. citrumelonis
Plants can be tested for by Xanthomonas alfalfae subsp. citrumelonis by conventional or realtime PCR using the primer pairs listed in Table 4. See section 7.1.2.2.2 for details of test
methods and interpretation of results.
7.1.2.2.2.10 Xylella fastidiosa
Plants can be tested for by Xylella fastidiosa by PCR using the primer pair listed in Table 4.
See section 7.1.2.2.2 for details of test methods and interpretation of results.
7.1.3 Shoot-tip grafting
Shoot-tip grafting (STG) is a way of eliminating graft-transmissible plant pathogens, while
maintaining the integrity of the original plant material.
The following section describes the recommended method for STG. A range of equipment is
required for STG. Please refer to the following link for a detailed description of the STG
protocol and the equipment needed: http://ecoport.org/. Refer to Appendix 4 for details of
preparation of growing media and preparation of rootstock seedlings.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
29
Preparation of tips for grafting
1. Sterile blades and clean/sterile grafting equipment must be used during this process. Dip
blades into bleach then neat alcohol, and air-dry between each cut. Do not flame blades
after dipping in alcohol. Change blades as required.
2. Once scions on propagating rootstocks have reached a size that can tolerate being
stripped of their leaves, cut back young, soft growth and remove all leaves from the tree.
3. Maintain the denuded tree in the glasshouse. Trees can be moved to a warmer (32/24ºC)
or cooler (20/24ºC) room if the tips are growing too quickly or too slowly. The tips
usually take between 10-15 days to reach grafting size of 1-2 cm long. Growth depends
on time of year and variety.
4. When tips are ready for grafting, collect tips and place on moistened filter paper in a
sterile Petri dish and keep at 4ºC until ready to use. Tips must be grafted the same day as
they are collected.
5. A fine pointed needle or fine pointed forceps are used to cut the small young leaves from
the shoot. This is best done under a binocular microscope or using a headband binocular
magnifier.
6. Place the prepared tips in a square of cheesecloth and carefully fold the cloth over the
tips and place in clean 25 mm culture tubes. The tubes are filled with 1% sodium
hypochlorite, plus two drops of Tween 20 emulsifier. The tubes are capped and tips are
left for 5 minutes to disinfect. After 5 min, the disinfectant is removed and the tips are
rinsed 3 times in sterile distilled water. The disinfected and rinsed shoot-tips are now
ready for STG.
Shoot-tip grafting technique
1. The following procedure must be carried out in a laminar-air-flow hood using aseptic
techniques.
2. Transfer the disinfected shoot-tips to a sterile Petri dish. Remove a 12-16 day old
rootstock seedling from the culture tube (See Appendix 4 for details on preparing
rootstock seedlings), and place it in a Petri dish. Prepare seedling by cutting the main
root to 4-6 cm and the stem to 1-1.5 cm. Remove cotyledons and small adventitious
buds.
3. Under a microscope, make an inverted T-cut at the top of the stem using a scalpel and
spread the edges.
4. Under the microscope, hold the tip with inverse tweezers and with a scalpel, peel away
the primordial leaves, leaving the meristem and 2-3 leaf primordia. Slice off the tip.
With the tip still on the razor blade, slide the tip onto the shelf of the T-cut.
5. Grafted plants are grown in a liquid medium in a culture room at 26-27ºC and exposed to
a 16 h day of 45µE s-1 m-2 (about 1000 lux) illumination and dark for 8 hours.
6. Check on survival and growth of the grafts once a week by observing under the
microscope. Discard any contaminated or dead plants. For those grafts that have
survived, the adventitious shoots will require trimming (under aseptic conditions).
Growing-on
1. When successfully grafted scions have grown to about 1-2 cm in size (about 1 month
after grafting), the plants can be transplanted directly to pots containing a sterilised
artificial soil mix.
2. The containers with the young transplanted STG plants are enveloped inside a
polyethylene bag and grown under shade.
3. Alternatively, just two weeks after STG, the very young plant can be grafted directly
onto young vigorous rootstocks seedlings. The young grafted plant is sliced just behind
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
30
4.
5.
6.
7.
8.
the graft to obtain a flat surface. Slide the young plant into a T-cut in the root stock and
wrap with budding tape.
Place a plastic bag over the plant and keep in the glasshouse in the shade.
After two weeks, loosen the plastic bag but leave the plant in the shade for about a week.
Move plant out of shade and remove developing suckers as required.
When scion is large enough (about 2-3 months), the plant can be indexed for viruses.
If plants are clean, repropagate onto appropriate rootstocks.
7.1.4 Detached leaf bioassay
This protocol is described in detail in OEPP/EPPO standard PM7/44 (2005) and more
recently in Francis et al., 2010.
Xanthomonas bacteria can be isolated from fruit, leaf or stem lesions. Small pieces of watersoaked tissue at the lesion margin can be removed and chopped in a drop of sterile water. The
resulting suspension can be streaked onto nutrient agar supplemented with 0.1% w/v Dglucose (NGA), or YPGA (0.5% peptone, 0.5% yeast extract, 1% glucose, 1.5% agar). Some
B and C strains of X. citri subsp. citri can be difficult to isolate and may be cultured initially
on 1% sucrose, 0.5% peptone, 0.05% K2HPO4, 03% Mg SO4 and purified agar. After initial
culturing, strains adapt to other nutrient media.
Xanthomonas spp. grow as circular, convex, mucoid, shiny yellow colonies. It is difficult to
distinguish the subspecies by morphological characteristics alone. X. citri subsp. citri, X.
alfalfae subsp. citrumelonis and X. axonopodis pv. aurantifolii can be identified by their
pathogenicity on a panel of indicator hosts such as Duncan grapefruit, Valencia sweet orange
or Mexican lime. In order to carry out a pathogenicity assay, single colonies of each bacteria
can be picked off nutrient agar and grown at 28ºC for 24 h to log phase. The bacterial
suspension should be centrifuged at 10,000 g for 20 min and resuspended in sterile saline
phosphate (PBS: 40 mM Na2HPO4 + 25 mM KH2 PO4), and adjusted to around 106-108 cfu
mL. Leaves can be inoculated with the bacterial suspension.
For the detached leaf bioassay, detached fully expanded but still immature leaftlets of
grapefruit or another susceptible citrus species can be used. The detached leaves should be
surface sterilised in 70% ethanol for 30 seconds, dipped in 0.5% sodium hypochlorite for 30
seconds and then rinsed three times in sterile distilled water. Leaves are placed aseptically
onto sterile paper towel with the abaxial surface of the leaf exposed. Using a 1 cm3 needleless
tuberculin syringe, bacterial suspension is loaded into the syringe. The syringe tip is pressed
against the abaxial surface of the leaf and approx. 2 µl of bacterial suspension is infiltrated
into the leaf until the water-soaked area reaches about 6 mm in diameter. Three areas on each
side of the leaf mid-vein should be infiltrated. Excess inoculum is wiped from the leaf surface
with sterile paper towel. The inoculated leaves are placed onto the surface f a 0.5% water
agar plate. The petiole should be removed and the leaf pressed onto the surface of the agar
with a plastic spreader to obtain as much contact as possible. Note that a negative and
positive control should be included in each test. Petri dishes should be sealed with parafilm
and the plates incubated in a growth chamber at 28ºC with fluoresdent light at 60 µmol m-2 s-1
for 12 hour photoperiods. The leaves should be assessed for symptoms, 2 3, 7 and 21 days
post inoculation. The number of stomatal lesion per injection-infiltration site should be
counted under a stereo microscope at 6X magnification.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
31
Interpretation of results
For a detailed description of lesion phenotypes refer to Francis et al., 2010.
After 7-14 days incubation, flat lesions of X. axonopodis pv. citrumelo can be readily
distinguished from the eruptive callus-like reaction of X. axonopodis pv. citri and X.
axonopodis pv. aurantifolii can be distinguished from X. axonopodis pv. citri as the colonies
are faster growing and flatter, not so gummy when touched with the loop.
7.1.5 Return-polyacrylamide gel electrophoresis (R-PAGE)
This protocol is described in detail in OEPP/EPPO standard PM7/33 (2004).
Sample size
1. Tissue (200 mg) must be taken from each plant to be tested. Up to 10 plants can be
bulked, but no less than 20 mg of tissue per plant should be used.
2. A positive control should be used in each test. No more than 20 mg of viroid-infected
tissue should be mixed with 180 mg of healthy tissue, or if bulking positive plants, no more
than 2 mg of viroid infected tissue mixed with 198 mg of healthy tissue. At least one positive
control must be used per batch of extractions and for each gel.
3. A negative control of healthy tissue (200 mg) should also be included in each batch of
extractions and for each gel. Process the positive control samples last to avoid crosscontamination of negative control.
Sample extraction (see Appendix 4 for buffer recipes)
1. Grind samples in a mortar and pestle with a small pinch of acid-washed sand (white
quartz – 50 + 70 mesh) in 20 µl of 10% SDS and 180 µl of LiCl extraction buffer. Add
400 µl of phenol/chloroform mix and grind further.
2. Pour the slurry into a 1.5 ml centrifuge tube and spin at 12 000 rpm for 20 min.
3. For each sample prepare a further 2 centrifuge tubes, each containing 0.02 g of PEG,
MW 6000.
4. After centrifugation, remove 180 µl of supernatant and place into one of the tubes
containing the PEG (if the supernatant volume is less than 180 µl, make up the volume
with 180 µl of LiCl buffer.
5. Vortex the tubes until all the crystals have dissolved. Centrifuge at 12000 rpm for 30
min. A very small pellet will form on one side of the tube.
6. Draw off the supernatant and discard. Add 300 µl of cold ethanol to each tube. The
remaining PEG will sink to the bottom of the tube.
7. Using a fine-tip pipette, draw up the wash from the bottom of the tube. As the pellet may
dislodge from the side of the tube, take care not to draw this up in the pipette. Note: the
final pellet must be visible; resample and re-extract the sample if necessary.
8. Air-dry the pellets (or dry in a vacuum at room temp for about 5 min).
9. Resuspend the pellet in 10 µl of nuclease-free water and add 3 µl of loading buffer to
each sample and vortex briefly.
Running the gel
1. See Appendix 4 for details of buffer recipes, gel preparation and staining.
2. Load samples and controls into the wells of a 9 8 cm polyacrylamide gel and run the
gel at room temperature at a constant 250 V until the dye front is 1 cm from the bottom
of the gel (~ 1 hour for a 9 8 cm gel).
3. Pour off the running buffer and replace with hot running buffer (70ºC). Reverse the
polarity on the power pack. Place the tank inside an incubator or water bath at 70ºC.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
32
4.
5.
Run the gel at a constant 250 V, until the dye front is at the top of the gel (~ 30 min for a
9 8 cm gel).
Stain the gel with silver stain and view the gel on a light box or gel reader.
Intepretation of results
In positive samples, the viroid band should appear as a distinct band in the lower two thirds
of the gel with no other bands present. The top of the gel will be heavily stained where the
denatured nucleic acids have migrated to form dense bands. Should bands appear in the lower
gel in any of the samples, further investigation should be carried out to confirm whether the
samples are positive.
8.
CONTACT POINT
This manual was developed by:
Drs Francisco Ochoa Corona* and Lisa Ward
Plant Health & Environment Laboratory
Investigation and Diagnostic Centre and Response – Tamaki
Ministry for Primary Industries
231 Morrin Road
St Johns
PO Box 2095
Auckland 1140
Tel: +64 9 909 3015
Fax: +64 9 909 5739
Email: [email protected]
Website: http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops
* Current address
Oklahoma State University
National Institute for Microbial Forensics & Food and Agricultural Biosecurity
Department of Entomology & Plant Pathology
127 Noble Research Center
Stillwater, OK 74078. USA
9.
ACKNOWLEDGEMENTS
We would like to acknowledge the following people who contributed to the preparation of
this manual:
Mr Ted Dawson for developing a draft of Sections 2 „Introduction‟ under contract to
MPI.
Dr Chet Roistacher, University of California, Riverside, USA, for guidance on symptoms
and access to pictures of indexing and viral symptoms.
Dr. Gian Paolo Accotto, Instituto di Virologia Vegetale, Torino, Italy, for providing an
isolate of Indian citrus ringspot virus.
Dr John Hartung USDA-ARS MPPL, Beltsville, USA, for providing an isolate of Citrus
yellow mosaic virus.
Juliana Freitas-Astúa and Eliane Locali-Fabris, Centro APTA Citros Sylvio Moreira,
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
33
IAC, Cordeirópolis/SP, Brazil, for providing an isolate of Citrus leprosis virus-C (CiLVC).
Dr Pedro Moreno, Instituto Valenciano de Investigaciones Agrarias, Moncada (Valencia),
Spain, for providing isolates of the citrus viroids.
Dr Robert Krueger and Richard Lee, National Clonal Germplasm Repository for Citrus
and Dates, Agricultural Research Service, Riverside, CA, USA, for providing information
on shoot-tip grafting and for providing various isolates of citrus viruses.
Dr Marta Francis, IFAS, Citrus Research and Education Center, University of Florida,
USA, for providing us with valuable information on the detached leaf inoculation method
for citrus canker and citrus bacterial spot.
Mr Scott Bauer, United States Department of Agriculture - Agriculture Research Service
(http://www.ars.usda.gov/is/graphics/photos/) for providing the front cover photograph.
10.
REFERENCES
Ahrens, U; Seemüller, E (1992) Detection of DNA of plant pathogenic mycoplasma-like
organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene.
Phytopathology 82: 828-832.
Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori, E; Beck, D L;
Sutherland, P W; Bryan, G T; Gardner, R C; Forster, R L S (1998) Detection of Phormium
yellow leaf phytoplasma in New Zealand flax (Phormium tenax) using nested PCRs. Plant
Pathology 47: 188-196.
Barkley, N A; Roose, M L; Kruger, R R; Federici, C (2006) Assessing genetic diversity and
population structure in a citrus germplasm collection utilizing simple sequence repeat
markers (SSRs). Theoretical and Applied Genetics 112: 1519-1531.
Barrett, H C; Rhodes, A M (1976) A numerical taxonomic study of affinity relationships in
cultivated citrus and its close relatives. Systemic Botany 1: 105-136.
Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of
phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Molecular
Plant Microbe Interactions 17: 1175-1184.
Cubero, J; Graham, J H (2002) Genetic relationship among worldwide strains of
Xanthomonas causing canker in citrus species and design of new primers for their
identification by PCR. Applied and Environmental Microbiology 68: 1257-1264.
Cubero, J; Graham, J H (2005). Quantatative real-time polymerase chain reaction for
bacterial enumeration and allelic discrimination to differentiate Xanthomonas strains on
citrus. Phytopathology 95: 1333-1340.
Deng, S; Hiruki, D (1991) Amplification of 16S rRNA genes from culturable and
nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61.
Francis, M I; Peňa, A; Graham, J H (2010) Detached leaf inoculation of germplasm for rapid
screening of resistance to citrus canker and citrus bacterial spot. European Journal of Plant
Pathology DOI: 10.1007/s10658-010-9620-2.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
34
Fresh Facts (2006) http://www.hortresearch.co.nz/files/aboutus/factsandfigs/ff2006.pdf
Hadidi, A; Terai, Y; Powell, C A; Scott, S W; Desvignes, J C; Ibrahim, L M; Levy, L (1992)
Enzymatic cDNA amplification of hop stunt viroid variants from naturally infected fruit
crops. Acta Horticulturae 309: 339-344.
Heslop-Harrison, J; Heslop-Harrison, Y (1970) Evaluation of pollen viability by
enzymatically induced fluorescence: intracellular hydrolysis of fluorescein diacetate. Stain
Technology 45: 115-120.
Hocquellet, A; Toorawa, P; Bove, J M; Garnier, M (1999) Detection and identification of the
two „Candidatus Liberibacter species‟ associated with citrus huanglongbing by PCR
amplification of ribosomal protein genes of the h operon. Molecular and Cellular Probes 13:
373–379.
Ito, T; Ieki, H; Katsumi, O (2002) Simultaneous detection of six citrus viroids and Apple stem
grooving virus from citrus plants by multiplex reverse transcription polymerase chain
reaction. Journal of Virological Methods 106: 235-239.
Kirkpatrick, B C; Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and detection of
DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238: 197200.
Lee, I M; Hammond, R W; Davis, R E; Gundersen, D E (1993) Universal amplification and
analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike
organisms. Phytopathology 83: 834-842.
Mabberley, D J (1997) A classification for edible citrus (Rutaceae). Telopea 7: 167-172.
MacKenzie, D J; McLean, M A; Mukerji, S; Green, M (1997) Improved RNA extraction
from woody plants for the detection of viral pathogens by reverse transcription-polymerase
chain reaction. Plant Disease 81: 222-226.
Martelli, G P; Yilmaz, M A; Savino, V; Balogu, S; Grieco, F; Güldür, M E (1996) Properties
of a citrus isolate of Olive latent virus 1, a new necrovirus. European Journal of Plant
Pathology 102: 527-536.
Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple viruses by multiplex RTPCR assays with coamplification of plant mRNA as internal control. Journal of Virological
Methods 99: 81-92.
Minsavage, G V; Thompson, C M; Hopkins, D L; Leite, R M V B C; Stall, R E (1994)
Development of a PCR protocol for detection of Xylella fastidiosa in plant tissue.
Phytopathology 84: 456-461.
OEPP/EPPO (2004) Diagnostic protocols for regulated pests. PM7/33, Bulletin 34: 155-157.
OEPP/EPPO (2005). Diagnostics. PM 7/44, Bulletin 35: 271-273.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
35
Roistacher, C N (1991) Graft Transmissible Diseases of Citrus - Handbook for the detection
and diagnosis. International Organisation of Citrus Virologists, FAO, Rome; p 286.
Roistacher, C N; Calavan, E C (1974) Inactivation of 5 citrus viruses in plants held at warm
glasshouse temperatures, Plant Disease Reporter 58: 850-853.
Roistacher, C N; Calavan, E C; Blue, RL (1969) Citrus exocortis viroid - Chemical
inactivation on tools, tolerance to heat and separation of isolates. Plant Disease Reporter 53:
333-336.
Roy, A; Fayad, A; Barthe, G; Brlansky, R H (2005) A multiplex polymerase chain reaction
method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees.
Journal of Virological Methods 129: 47-55.
Scora R W (1998) Biochemistry, taxonomy and evolution of modern cultivated citrus. In:
Goren R; Mendel K (eds). Proceedings of the 6th International Citrus Congress. Balaban
Publishers, Philadelphia.
Schneider, B; Seemüller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification
of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S & Tully, J G
(eds). Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1. Academic Press,
San Diego, CA; p 369-380.
Semancik, J S; Duran-Vila, N (1991) The grouping of citrus viroids: Additional physical and
biological determinants and relationships with diseases of citrus. Proceedings of the 11th
Conference International Organisation of Citrus Virology, IOCV, Riverside, 178-187.
Serra, P; Eiras, M; Bani-Hashemian, S M; Murcia, N; Kitajima, E W; Daròs, J A; Flores, R;
Duran-Vila, N (2008). Citrus viroid V: Occurance, host range, diagnosis and identification of
new variants. Phytopathology 98: 1199-1204.
Shimomura, K; Noguchi, Y (2003) Sensitive detection of Satsuma dwarf virus by Reverse
Transcription Polymerase Chain Reaction. Bulletin Fukuoka Agriculture Research Centre
22: 99-102.
Swingle, W T; Reece P C (1967) The botany of citrus and its wild relatives. In: Reuther, W;
Webber, H J; Batchelor, L D (eds). The Citrus Industry, vol. 1, University of California,
Berkeley; p 190–430.
Tanaka, T (1977) Fundamental discussion of Citrus classification. Studia Citrogia 14: 1-6.
Teixeira, D C; Danet, J L; Jagoueix-Eveillard, S; Martins, E C; de Jesus (Jr), W C;
Yamamoto, P T; Lopes, S A; Bassanezi, R B; Ayres, A J; Saillard, C; Bove, J M (2005)
Citrus huanglongbing in São Paulo State, Brazil: PCR detection of the „Candidatus‟
Liberibacter species‟ associated with the disease. Molecular and Cellular Probes 19: 173179.
Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of
Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR
(TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
36
Whiteside, J O; Garnsey, S M; Timmer, L W (1989) Compendium of citrus diseases.
The American Phytopathological Society Press.
Yokomi, R K; Mello, A F S; Saponari, M; Fletcher, J (2008) Polymerase chain reaction based
detection of Spiroplasma citri associated with citrus stubborn disease. Plant Disease 92: 253260.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
37
Appendix 1. Types of grafting buds used for citrus
Top, „T‟ grafting technique used for propagation, inoculation and indexing, and bottom, the leaf
grafting method used for inoculation and indexing only. (Courtesy EcoPort http://ecoport.org: C.N.
Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
38
Appendix 2. Symptoms of significant regulated pests of Citrus, Fortunella and Poncirus
2.1 ‘Candidatus Phytoplasma aurantifolia’
(Causal agent of Lime witches‟-broom disease)
Left, phytoplasma symptoms on citrus: witches‟-broom symptoms in Omani lime (Citrus
aurantifolia) and right, on a mature tree (Courtesy F. Ochoa Corona (left) & EcoPort
http://ecoport.org: C.N. Roistacher (right)).
2.2 ‘Candidatus Liberibacter spp’
(Causal agent of Huanglongbing disease (HLB)/Citrus greening)
Various types of leaf mottle associated with HLB. These symptoms are similar to the leaf mottle
associated with stubborn disease caused by Spiroplasma citri. (Courtesy EcoPort
http://www.ecoport.org: M. Garnier).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
39
2.3 Spiroplasma citri
(Causal agent of Stubborn disease)
Left, leaf symptoms of stubborn disease showing pinched tips and tip mottle. Right, typical leaf
mottle. This leaf mottle is similar to that caused by Huanglongbing (greening disease). (Courtesy
EcoPort http://www.ecoport.org: C.N. Roistacher).
2.4 Xanthomonas citri subsp. citri
(Causal agent of citrus canker (type A))
Whole leaf symptoms of citrus canker on top and bottom of grapefruit leaves
(Courtesy T. Schubert, Florida Department of Agriculture and Consumer Services).
2.5 Xylella fastidiosa
(Citrus variegated chlorosis strain)
Yellow discolouration in the leaves of a X. fastidiosa-infected orange tree. (Courtesty EcoPort
http://www.ecoport.org: A. Purcell (www.insectimages.org)).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
40
2.6 Citrus leprosis virus
Left, chlorosis on leaves of sweet orange. Right, close-up of tree with leprosis on the trunk. Note that
there is no wood staining caused by leprosis in contrast to the wood staining that might be present
when scaling is caused by Citrus psorosis virus.
(Courtesy EcoPort http://ecoport.org: C.N. Roistacher).
2.7 Citrus psorosis virus
(Synonymous with Citrus ringspot virus and causal agent of Psorosis A & B complex)
Left, shock symptoms in young growth of sweet orange compared with a control plant on the right.
Right, top and bottom, two stages of shock symptoms in the new growth of sweet orange seedlings in
an index greenhouse. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher (left),
V. Manzanero (right top & bottom)).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
41
Left, a mild psorosis reaction in a Eureka lemon leaf. Centre, psorosis leaf symptoms showing
interveinal flecking in a sweet orange indicator plant. Right, psorosis reaction in young leaves of
citron. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher (left & right), V. Manzanero
(centre)).
Left, psorosis symptoms in young emerging leaves of Dweet tangor. A non-inoculated control leaf is
on the right. Right, ringspot symptoms in a grapefruit seedling. (Courtesy EcoPort
http://www.ecoport.org: C.N. Roistacher).
Left, typical ringspot-psorosis in sweet orange leaves. Right, a strong atypical psorosis reaction in a
leaf of a Dweet tangor seedling. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
42
Citrus tatter leaf virus
(synonym of Apple stem grooving virus)
Top, citrange is an excellent seedling indicator for detecting Citrus tatter leaf virus (CTLV); the
mottle leaf reaction can be seen on three leaves of Troyer citrange on the right, with the control leaf
on the left. Bottom, the Rusk citrange is also an excellent indicator for CTLV. This photograph shows
the severe leaf deformation in infected plants (Courtesy EcoPort http://www.ecoport.org: C.N.
Roistacher).
Left, in the field – a severe reaction on a Troyer citrange rootstock with a CTLV-infected satsuma
mandarin scion. Right, severe indentations and bud union crease. The brown line and crease at the
bud union is typical with trifoliate and trifoliate hybrid rootstocks and is diagnostic for the tatter leaf
disease. (Courtesy EcoPort http://ecoport.org: E.C. Calvan).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
43
2.9 Citrus tristeza virus
Left, Citrus tristeza virus will usually induce a vein clearing and cupping (leaf on the right) in leaves
of the small fruited lime (Citrus aurantifolia). Right, vein-clearing symptoms in the leaf of a Mexican
lime seedling (leaf on the right) as viewed from the back of the leaf into direct sunlight. The control
leaf is on the left. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher).
Left, the cupping of the leaf in Mexican lime is helpful in diagnosis of Citrus tristeza virus (CTV) in
greenhouse-grown indicator plants grown under cool conditions. Citrus vein-enation virus may also
induce leaf cupping in Mexican lime indicator seedlings. Right, vein corking symptoms on leaves of a
Mexican lime seedling inoculated with a very severe seedling-yellow CTV isolate. Most CTV isolates
will not induce this vein corking reaction.
(Courtesy EcoPort http://ecoport.org: C.N. Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
44
2.10 Citrus variegation virus
(Synonymous with Citrus infectious variegation virus, Citrus infectious variegation virus [crinkly
leaf strain]).
Left, leaves showing severe crinkling. Right, symptoms of CVV on leaves of a CVV-infected navel
orange (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher).
Olive latent virus 1
Left, Olive latent virus 1 symptoms after a graft transmission assay using mandarin, Right and after a
graft transmission assay using lemon.
(Courtesy EcoPort http://ecoport.org: U. Kersting & C.N. Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
45
2.12 Satsuma dwarf virus
(Synonymous with Citrus leathery leaf virus, Citrus mosaic virus, Navel orange infectious mottling
virus, Satsuma dwarf virus, Satsuma dwarf virus [Natsudaidai dwarf strain], and Hyuganatsu virus)
Top, individual leaves showing striking boat or spoon shapes, taken from a field tree of satsuma
mandarin, Japan. Bottom, boat or spoon shapes after graft indexing, the healthy control is on the left.
(Courtesy EcoPort http://www.ecoport.org: T. Miyakawa).
Severe reaction of Satsuma dwarf virus on leaves of the Gou tou cheng sour orange. (Courtesy
EcoPort http://www.ecoport.org: Z. Changyoung, Z. Xueyuan, J.Yuanhui).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
46
Satsuma dwarf virus graft-inoculated into a satsuma on trifoliate rootstock in the greenhouse 10
months after inoculation (the control plant is on the left). Infected plants show stunting and spoon or
boat-shaped leaves. (Courtesy EcoPort http://ecoport.org: T. Miyakawa, C.N. Roistacher).
2.13 Citrus viroid III
Left, mild petiole browning in citron caused by Citrus viroid III (CVd-III). Right, bent leaf reaction in
citron caused by CVd-III. (Courtesy EcoPort http://www.ecoport.org: L. Marais).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
47
Hop stunt viroid
(Synonymous with Citrus viroid II, Citrus cachexia viroid, Xyloporosis viroid and causal agent of
Gummy bark and Kassala disease)
Top left, a moderate reacting isolate of the Citrus cachexia viroid (CVd-IIb) showing symptoms in
Parson's Special mandarin indicator plants. Top right, a peeled section through the bud union of a
Persian lime tree on Citrus macrophylla rootstock. Note the lack of symptoms in the Persian lime
scion with the symptoms appearing only on the susceptible, C. macrophylla rootstock. Bottom,
characteristic symptoms of cachexia in the trunk of a Cleopatra mandarin rootstock. (Courtesy
EcoPort http://www.ecoport.org: C.N. Roistacher (top left), B. Rangel (top right), F. Ochoa Corona
(bottom)).
Blind pocket/Concave gum
Left, interveinal flecking is the first symptom to appear on emerging leaves within 5 to 8 weeks after
inoculation, as shown in the two leaves on the left; the un-inoculated control leaf is on the right.
Right, an oak leaf pattern then develops on the leaves of indicator plants of sweet orange, usually in
the second flush of growth. Shown here is the early development of the oak leaf pattern around the
midrib. This symptom is highly diagnostic for the concave gum disease of citrus. (Courtesy EcoPort
http://www.ecoport.org: C.N. Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
48
A Valencia sweet orange on Cleopatra mandarin rootstock showing deep pockets typical of blind
pocket/concave gum infection. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher).
Oak leaf patterns characteristic of concave gum infection observed on a mandarin in the field in
spring. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
49
2.16 Cristacortis
Field symptoms of cristacortis. Deep pits and pegs can be seen on this sour orange rootstock. This tree
also had Citrus tristeza virus and there some evidence suggesting that CTV enhances the pitting.
(Courtesy EcoPort http://www.ecoport.org: A.M. D'Onghia).
Left, the deep pits in the outer bark of an Orlando tangelo on sour orange rootstock. This symptom is
indicative of cristacortis. Right, the same tree trunk showing the deep pits and corresponding pegs
after peeling. (Courtesy EcoPort http://www.ecoport.org: R. Vogel).
Left, a typical oak leaf pattern associated with cristacortis, impietratura and concave gum diseases.
Right, Tangelo is an excellent indicator for cristacortis; deep pits can be seen in this inoculated
Orlando tangelo seedling. (Courtesy EcoPort http://www.ecoport.org: C.N. Roistacher (left), R.
Vogel (right)).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
50
Appendix 3. Symptoms of nutrient deficiencies in Citrus, Fortunella and Poncirus
3.1 Manganese deficiency
(Courtesy Ted Dawson, Plant and Food
Research, New Zealand).
3.3 Magnesium deficiency
Healthy on the left (Courtesy Ted Dawson,
Plant and Food Research, New Zealand).
3.2 Zinc deficiency
Healthy on the left (Courtesy Ted Dawson,
Plant and Food Research, New Zealand).
3.4 Nitrogen deficiency
Healthy on the left (Courtesy Ted Dawson,
Plant and Food Research, New Zealand).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
51
Appendix 4. Protocols referenced in manual
3.1
Silica-milk RNA extraction protocol (Menzel et al., 2002)
1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction buffer (6 M guanidine
hydrochloride, 0.2 M sodium acetate, 25 mM EDTA, 2.5% [w/v] PVP-40 adjusted to
pH 5 with acetic acid).
2. Transfer 500 µl of the homogenised extract to a micro-centrifuge tube containing 100
µl of 10% (w/v) SDS.
3. Incubate at 70oC for 10 minutes with intermittent shaking, and then place on ice for 5
minutes.
4. Centrifuge at 13,000 rpm for 10 minutes.
5. Transfer 300 µl supernatant to a new micro-centrifuge tube and add 300 µl high salt
buffer (6 M sodium iodide, 0.15 M sodium sulphite), 150 µl absolute ethanol and 25
µl silica milk (1 g/ml silicon dioxide, 1-5 µM size particles, suspended in 100 mM
glycine, 100 mM NaCl, 100 mM HCl, pH 2).
6. Incubate at room temperature for 10 minutes with intermittent shaking.
7. Centrifuge at 3,000 rpm for 1 minute and discard the supernatant.
8. Resuspend the pellet in 500 µl of wash buffer (10 mM Tris-HCl pH 7.5, 0.05 mM
EDTA, 50 mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm for 1
minute and discard the supernatant. Repeat this wash step.
9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining wash buffer from the
pellet.
10. Resuspend the pellet in TE buffer (10mM Tris-HCl pH 7.5, 0.05 mM EDTA).
11. Incubate at 70oC for 4 minutes then centrifuge at 13,000 rpm for 5 minutes.
12. Transfer 100 µl of the supernatant to a sterile nuclease-free micro-centrifuge tube,
being careful not to disturb the pellet. Store at -80oC.
3.2
Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al.,
1987 and modified by Ahrens & Seemüller, 1992)
1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml ice-cold isolation buffer (0.1
M Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose, 2% (w/v)
PVP-40; Adjust pH to 7.6 and filter sterilise. Just prior to use add 0.15% (w/v) Bovine
Serum Albumin (BSA) and 1 mM ascorbic acid).
2. Transfer crude sap to a cold 2 ml micro-centrifuge tube.
3. Centrifuge at 4ºC for 5 min at 4500 rpm.
4. Transfer supernatant into a clean 2 ml micro-centrifuge tube.
5. Centrifuge at 4ºC for 15 min at 13000 rpm.
6. Discard the supernatant.
7. Resuspend the pellet in 750 µl of hot (55º C) CTAB buffer (2% (w/v) CTAB, 100
mM Tris-HCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40). The
pellet is easier to resuspend in a smaller volume of CTAB buffer (e.g. 100 µl) then the
remaining volume of CTAB buffer is added (e.g. 650 µl).
8. Incubate tubes at 55 ºC for 30 min with intermittent shaking.
9. Cool the tubes on ice for 30 sec.
10. Add 750 µl chloroform:octanol (24:1 v/v) and vortex thoroughly.
11. Centrifuge at 4ºC or at room temperature for 4 min at 13000 rpm.
12. Carefully remove upper aqueous layer into a clean 1.5 ml micro-centrifuge tube.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
52
13.
14.
15.
16.
17.
Add 1 volume ice-cold isopropanol and vortex thoroughly.
Incubate on ice for 4 min.
Centrifuge at 4ºC or at room temperature for 10 min at 13000 rpm.
Discard supernatant.
Wash DNA pellets with 500 µl ice-cold 70% (v/v) ethanol, centrifuge at 4oC or at
room temperature for 10 min at 13000 rpm.
18. Dry DNA pellets in the DNA concentrator or air-dry.
19. Resuspend in 20 µl sterile distilled water. Incubating the tubes at 55 oC for 10 min can
aid DNA resuspension.
20. Store DNA at -20ºC for short-term storage or -80ºC for long-term storage.
3.3
Trizol® Reagent RNA extraction protocol
Where possible, perform centrifugation steps at 2-8 ºC. If not possible, pre-cool samples
prior to centrifugation.
1. Grind 0.1-0.2 g plant leaf tissue in 1 ml of Trizol and mix thoroughly.
2. Transfer the homogenate to a 1.5 ml micro-centrifuge tube.
3. Micro-centrifuge samples at top speed (13000 rpm) for 10 minutes and transfer
supernatant to a fresh 1.5 ml microcentrifuge tube. Discard the pellet.
4. Add 200 µl chloroform to the tube and mix by shaking for at least 15 seconds.
5. Incubate the samples at room temperature for 3 minutes, then micro-centrifuge the
samples for 15 minutes at 13000 rpm.
6. After centrifugation you will observe that the supernatant is separated into three
phases. The upper layer is relatively clear, while the middle is white (DNA level) and
cloudy and the lower level is pink (protein level). The upper level contains RNA.
7. Carefully pipette off this phase and transfer it to a clean tube. You should generally
recover around 400 µl of this supernatant.
8. Either add 500 µl of isopropanol, or if your plant sample contains a high level of
polysaccharides add 250 µl of isopropanol and 250 µl of high salt precipitation
solution, mix by pipetting and incubate at room temperature for 15 minutes.
9. Micro-centrifuge at 13000 rpm, and observe that a pellet should form on the bottom
side of the tube.
10. Discard the supernatant without disturbing the pellet. Add 1 ml of 75% ethanol, mix
the sample by vortexing and micro-centrifuge at 8000 rpm for 5 minutes.
11. Discard the supernatant and air-dry the pellet for 5-10 minutes.
12. Resuspend the pellet in 40 µl-50 µl RNAse free water by pipetting and incubate at 5560ºC to completely dissolve the pellet. Prepare and store aliquots at -20 ºC.
3.4
CTAB RNA extraction protocol
1. Grind 0.1-0.2 g plant leaf tissue in 1 ml of CTAB buffer (2% [w/v] CTAB, 100 mM
Tris-HCl [pH 8.0], 20 mM EDTA [pH 8.0]; 1.4 M NaCl; 1% [w/v] PVP-40).
2. Decant ground sap into a 1.5 ml micro-centrifuge tube and incubate tubes at 65ºC for
10 min.
3. Micro-centrifuge sap at 13000 rpm for 10 min and transfer 700 µl of cleared
supernatant to a fresh 1.5 ml microcentrifuge tube. Add an equal volume of
chloroform:IAA (24:1) and mix to emulsion by inverting the tube.
4. Micro-centrifuge tubes at 13000 rpm for 15 min.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
53
5. Carefully remove upper aqueous layer and transfer to a fresh tube. Add an equal
volume of chloroform:IAA (24:1), mix and spin at 13000 rpm for 15 min.
6. Carefully remove upper aqueous layer and transfer to a fresh tube. Add an equal
volume of 4 M LiCl. Mix well and incubate at 4ºC overnight.
7. Spin at 13000 rpm for 25 min.
8. Discard supernatant and resuspend the pellet in 200 µl of TE buffer (10mM Tris-HCl
pH 7.5, 0.05 mM EDTA) containing 1% SDS. Add 100 µl of 5 M NaCl and 300 µl of
ice-cold iso-propanol. Mix well and incubate at -20ºC for 20-30 min.
9. Spin at 13000 rpm for 10 min to pellet nucleic acid.
10. Decant off the salt/isopropanol and wash pellet with 400 µl of 70% ethanol, then spin
at 13000 rpm for 5 min.
11. Decant off the ethanol and dry the pellet to remove residual ethanol.
12. Resuspend pellet in 100 µl of RNAse free water.
3.5
R-PAGE
Buffers and Gel solutions
Extraction Buffer
Lithium chloride
Glycine
29.69 g
4.50 g
Make up to 180 ml with distilled water and using 10 M or more LiOH, adjust to pH 8.8.
Make up to 200 ml with distilled water and if necessary adjust to pH 9.0 using LiOH. The
buffer should be clear, discard if the buffer has a yellow tinge.
Phenol/Chloroform Mix
Phenol crystals
Chloroform
Octan-1-ol
Hydroxyquinolene
500 g
500 ml
20 ml
1g
Take a 500 g bottle of phenol crystals and a 500 ml bottle of chloroform. Pour the chloroform
directly into the bottle of phenol. The solution will immediately go very cold. Leave at room
temperature for a few hours to dissolve and then add octan-1-ol (20 ml) and
hydroxyquinolene (1 g) and shake. For routine use, decant a small volume into a screw-top
bottle and store the stock solution in a fume cupboard. The stock solution can be stored for
several months; deterioration can result in inadequate separation after centrifugation.
1% SDS
Sodium dodecyl sulphate (SDS)
40.0 g
Make up to 400 ml in distilled water. To dissolve the SDS, warm the buffer on a hot plate.
Ensure buffer is clear before use.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
54
Ethanol/Ether pellet wash 50:50 solution
Ethanol
Ether
50 ml
50 ml
Store solution in the freezer.
R-PAGE - Gel Preparation
Acrylamide solution
Acrylamide
Bis-acrylamide
30.0 g
0.7 g
Make up to 100 ml with distilled water. When dissolved, filter through Whatman filter paper
No.1 and use immediately.
Ammonium persulphate
Ammonium persulphate
0.1 g
Add 900 µl of distilled water to a weigh boat and mix gently. Use immediately.
Gel Mix
Acrylamide stock
5 x TBE
TEMED
Distilled water
83.5 ml
22.4 ml
3.4 ml
390.7 ml
Store in the dark at 4ºC
5
TBE Buffer (Tris-borate-EDTA buffer: Sigma Cat. No. T 3913)
5 TBE buffer is bought as a pre-mixed powder. Dissolve the contents of the pouch in 1 litre
of distilled water.
Loading and running buffers
Loading buffer
Sucrose
Xylene-cynol-FF
Distilled water
12.0 g
0.125 g
30 ml
Autoclave after preparation
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
55
Running buffer
5 x TBE buffer
44 ml
Make up to 1 litre with distilled water
Silver staining
(Silver staining kits are available commercially e.g. BioRad silver stain plus kit Cat. No. 1610449EDU)
Fixing buffer
Ethanol
Acetic acid
Distilled water
20 ml
1 ml
179 ml
Silver stain
Silver nitrate
Distilled water
0.19 g
200 ml
Developer solution
Sodium hydroxide
1.5 g
Formaldehyde
400 µl
Sodium borohydride 0.0088 g
Make up to 200 ml with distilled water
Stop solution
Sodium carbonate
Distilled water
1.5 g
200 ml
3.6 Preparation of media and rootstock seedlings for shoot-tip grafting
Recommended method for media preparation
Seed growing media
Add 8.66 g of Murashige and Skoog salts to 1900 ml of distilled water. Using 1N NaOH, pH
the solution to 5.7 ± 0.1. Make up to 2000 ml using distilled water. Add 4 g of gelrite and
shake. Autoclave at 121ºC for 7 min. Dispense 25 ml of media into each culture tube. Put
caps on tubes and autoclave tubes at 121ºC for a further 15 min.
Shoot-tip grafting media
Add 8.66 g of Murashige and Skoog salts, 20 ml Whites vitamins, 200 mg insital and 150 g
of sucrose to 1800 ml of distilled water. Stir until sucrose is dissolved. Using 1N NaOH, pH
the solution to 5.7 ± 0.1. Make up to 2000 ml using distilled water. Dispense 25 ml of media
into each culture tube.
Make Heller supports:
(a) Place filter paper over the top of a small tube
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
56
(b) Pinch 4 cardinal point and fold around the tube
(c) Using a wooden skewer, punch a hole in the centre of the filter paper
(d) Lower the support into the media tube, but not into the liquid
Put caps on tubes and autoclave tubes at 121ºC for a further 15 min.
Recommended method for producing rootstock seedlings for shoot-tip grafting
Further information on preparation of rootstocks can be found at: http://ecoport.org
Peel both inner and outer integuments of rootstock seed (e.g. Carrizo, rough lemon or citron)
(Figure 1, top). The number will depend on the root stock variety and numbers to shoot-tip
graft (STG).
Place peeled seed on moistened filter paper in a sterile Petri dish and store at 4ºC until ready
to use. Seeds can be peeled up to 24 h before planting.
Place 10 seeds of one variety in a square of cheesecloth and fold cloth over the seeds and
place in a sterile culture tube (Figure 1, bottom). Disinfect the seeds in a 0.5% NaOCl (or
10% solution of household bleach) for 10 minutes. Afterwards, the seeds are rinsed three
times in sterile distilled water and are then ready to plant on an agar media.
Figure 1
Peeled seed and seeds prepared in cheesecloth for disinfection.
(Courtesy EcoPort http://www.ecoport.org: L. Navarro).
The following procedure is carried out in a laminar-air-flow hood using aseptic technique.
Using sterile forceps, place one cheesecloth package of seed in a sterile Petri-dish and open
cheese-cloth with forceps.
Pick-up the seeds with the forceps, open a culture tube containing seed growing media, drop
seed in and close the tube. Carrizo seed may break apart, use 2-3 parts per tube. With rough
lemon or citron, use 2 seeds per tube.
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
57
Place tubes containing seeds in a rack and place rack in a dark chamber at 27°C. When
seedlings reach about 4 to 5 cm as shown in Figure 2, they are ready for grafting. Seedlings
usually take 12-16 days to reach grafting size.
Figure 2
Tubes containing seeds about 4 to 5 cm which are ready for grafting.
(Courtesy EcoPort http://www.ecoport.org: L. Navarro).
Before the rootstock seedling is used for STG, the seedling is removed from the tube and the
cotyledon and root tip are excised using a sterile scalpel (Figure 3).
Figure 3
Left, seedling removed from the culture tube. Right, the top portion of the cotyledon is cut to about 1
cm above the joint of the root and the bottom of the root tip is removed.
(Courtesy EcoPort http://www.ecoport.org: L. Navarro).
Citrus, Fortunella and Poncirus Post-Entry Quarantine Testing Manual - July 2010
58