Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DO NOW Tell your table partner: What is this a picture of? Why is it important? Gregor Mendel Mendel’s Peas Advantages of pea plants for genetic study: ● There are many varieties with distinct heritable features, or traits (such as peacolor) ● Mating of plants can be controlled ● Quick generation time; lots of offspring ● Can isolate true-breeding lines for particular traits Genotype determines Phenotype __________________ = an organism’s genetic makeup __________________ = an organism’s physical appearance Two Possible Phenotypes Mendel said each phenotype is determined by an _____________, which is a version of a gene For each phenotype, there are ___ possible alleles Two Possible Phenotypes Each offspring inherits ____ allele for each gene from each parent An organism’s genotype is made up of ____ alleles for each trait Homozygous vs. Heterozygous If an organism has two copies of the same allele it is called _______________ If an organism has two different copies of the same allele it is called _______________ Dominant vs. Recessive Some alleles are ____________. If an organism has just one dominant allele in its genotype, it will have the dominant phenotype. The other allele is ______________. It It only shows up in the phenotype if an organism has two recessive alleles Dominant vs. Recessive ATGTTCGTACGTAGCATTTAGCGAT CGTATTGCGATATATAGCGTGTAAA G Homozygous or Heterozygous? Phenotype? BB Bb bb B = Brown b = blue Homozygous or Heterozygous? Phenotype? RR Rr rr R = Round r = wrinkled