Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Name: Date: Period: Mutations Worksheet Part 1: Gene Mutations In the chart below, transcribe the DNA sequence into mRNA. Then use the codon chart (below) to indicate what amino acids are being coded for by the base sequences listed for the mRNA. Then, tell what type of gene mutation is being illustrated. Choose from point mutation and frameshift mutation. Type of Mutation DNA sequence TACGCCAGTGGT mRNA sequence Original Amino Acids DNA sequence TACCCCAGTGGT mRNA sequence Amino Acids DNA sequence TACCCAGTGGT mRNA sequence Amino Acids Part 2: Chromosome Mutations For each diagram below, indicate what type of chromosome mutation is illustrated. Choose from: deletion, insertion/duplication, inversion, and translocation A. B. C. D. For numbers 1-5, choose from the following terms. Insertion Inversion Deletion Substitution Point Mutation Translocation 1. Name the three types of point (gene) mutations: 2. Name the four types of chromosome mutations: 3. What mutations would be considered frameshift mutations? 4. Which mutation involves two chromosomes? 5. Can a point mutation be a frameshift mutation? Match the following terms to the descriptions below. A. Deletion B. Frameshift mutation C. Insertion D. Inversion E. Mutagen F. Point mutation (gene mutation) G. Substitution H. Translocation _____ 1. A mutation that involves one or a few nucleotides. _____ 2. Involves the loss of all or part of a chromosome or one base. _____ 3. Produces extra copies of parts of a chromosome or a base. _____ 4. Reverses the direction of parts of chromosomes. _____ 5. Occurs when part of one chromosome breaks off and attaches to another. _____ 6. Affects the DNA sequence of an entire chromosome. _____ 7. A substance that can change the chemical nature of DNA. _____ 8. One base is exchanged for another. For numbers 9 and 10, choose from the following terms: A. Frameshift mutation B. Point mutation _____ 9. A DNA segment is changed from AAGGACATTAGC to AGGACATTAGC _____ 10. A DNA segment is changed from GGTCAT to GGGCAT Show how mutations can cause problems by completing the protein synthesis of the following DNA strands. Use the codon chart below to find the amino acids. 1. “Normal” DNA: TACCCCGTCACCGCCTATATC “Normal” mRNA: “Normal” Protein: 2. “Mutated” DNA: T A C C C C G T C C A C C G C C T A T A T C “Mutated” mRNA: “Mutated” Protein: Circle the type of mutation: POINT FRAMESHIFT Circle the specific type of mutation: INSERTION DELETION 3. “Mutated” DNA: T A C C C C G T SUBSTITUTION ACCGCCTATATC “Mutated” mRNA: “Mutated” Protein: Circle the type of mutation: POINT FRAMESHIFT Circle the specific type of mutation: INSERTION DELETION SUBSTITUTION 4. “Mutated” DNA: T A C C A C G T C A C C G C C T A T A T C “Mutated” mRNA: “Mutated” Protein: Circle the type of mutation: POINT FRAMESHIFT Circle the specific type of mutation: INSERTION DELETION SUBSTITUTION Mutations Worksheet Name _________________________ Date_________ Period_______ There are several types of mutations: SUBSTITUTION (one base is substituted for another) If a mutation changes the amino acid, it’s called a MISSENSE mutation. If a mutation does not change the amino acid, it’s called a SILENT mutation. If a mutation changes the amino acid to a “stop,” it’s called a NONSENSE mutation. DELETION (a base is lost) INSERTION (an extra base is inserted) Deletion and insertion usually cause what’s called a FRAMESHIFT, meaning the reading “frame” changes, changing the amino acid sequence.). Use your the information above to complete the boxes below. Original DNA Sequence: T A C A C C T T G G C G A C G A C T mRNA Sequence: _________________________________________________ Amino Acid Sequence: _________________________________________________ Mutated DNA Sequence #1: T A C A T C T T G G C G A C G A C T mRNA Sequence: _________________________________________________ (Circle the mutation.) Amino Acid Sequence: _________________________________________________ What kind of mutation is this? Deletion, Insertion, or Substitution AND Frameshift, Missense, Silent or Nonsense (circle one from each set) Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T mRNA Sequence: _________________________________________________ (Circle the mutation.) Amino Acid Sequence: _________________________________________________ What kind of mutation is this? Deletion, Insertion, or Substitution AND Frameshift, Missense, Silent or Nonsense (circle one from each set) Mutated DNA Sequence #3: T A C A C C T T A G C G A C G A C T mRNA Sequence: _________________________________________________ (Circle the mutation.) Amino Acid Sequence: _________________________________________________ What kind of mutation is this? Deletion, Insertion, or Substitution AND Frameshift, Missense, Silent or Nonsense (circle one from each set) Mutated DNA Sequence #4: T A C A C C T T G G C G A C T A C T mRNA Sequence: _________________________________________________ (Circle the mutation.) Amino Acid Sequence: _________________________________________________ What kind of mutation is this? Deletion, Insertion, or Substitution AND Frameshift, Missense, Silent or Nonsense (circle one from each set) Mutated DNA Sequence #5: T A C A C C T T G G G A C G A C T mRNA Sequence: _________________________________________________ (Circle the mutation.) Amino Acid Sequence: _________________________________________________ What kind of mutation is this? Deletion, Insertion, or Substitution AND Frameshift, Missense, Silent or Nonsense (circle one from each set)