Download Full Text - Clinical Infectious Diseases

E R R ATA
An error appeared in an electronic article published in the
15 November 2003 issue of the journal (Barker JH, Luby JP,
Dalley AS, Bartek WM, Burns DK, Erdman DD. Fatal type 3
adenoviral pneumonia in immunocompetent adult identical
twins. Clin Infect Dis 2003; 37:e142–6). In the second paragraph in the Case Report section, the third-to-last sentence
should read, “There were positive results of an assay for ade-
novirus by indirect fluorescence antibody in endotracheal secretions and bronchoalveolar lavage (BAL) fluid specimens, and
adenovirus was isolated from the endotracheal secretions” (not
“There were positive results of an assay for indirect fluorescence
antibody to adenovirus in endotracheal….”). The authors regret this error.
An error appeared in an article in the 1 December 2003 issue
of the journal (Melzer M, Eykyn SJ, Gransden WR, Chinn S.
Is methicillin-resistant Staphylococcus aureus more virulent than
methicillin-susceptible S. aureus? A comparative cohort study
of British patients with nosocomial infection and bacteremia.
Clin Infect Dis 2003; 37:1453–60). The second affiliation should
read “Department of Infection, Guy’s and St. Thomas’ Hospital” (not “Department of Infection, Lucy’s and St. Thomas’
Hospital”). The journal regrets this error.
An error appeared in an electronic article in the 15 October
2003 issue of the journal (Myjak P, Nahorski W, Pietkiewicz
H, von Nickisch-Rosenegk M, Stolarczyk J, Kacprzak E, Felczak-Korzybska I, Szostakowska B, Lucius R. Molecular confirmation of human alveolar echinococcosis in Poland. Clin
Infect Dis 2003; 37:e121–5). Reference [12] should appear at
the end of the penultimate sentence in the first paragraph of
the “Molecular examinations” subsection of Materials and
Methods (p. e121). The sentence should read, “A fragment of
mitochondrial 12S rDNA was amplified by PCR (AmpliTaq
Gold polymerase; Applied Biosystems) from human genomic
DNA using the cestode-specific primers 60 (forward, TTAAGATATATGTGGTACAGGATTAGATACCC) and 375 (reverse,
5-AACCGAGGGTGACGGGCGGTGTGTACC-3) [12].” The
journal regrets this error.
An error appeared in an article published in the 15 November
2003 issue of the journal (Loeb M. Pneumonia in older persons.
Clin Infect Dis 2003; 37:1335–9). The last 2 words in the abstract were inadvertently cut off. The sentence should end
“… the vaccine is recommended for adults aged 165 years” (not
“… the vaccine is recommended for adults aged”). The journal
regrets this error.
Clinical Infectious Diseases 2004; 38:308–9
2003 by the Infectious Diseases Society of America. All rights reserved.
1058-4838/2004/3802-0025$15.00
308 • CID 2003:38 (15 January) • ERRATA