Download Chloroplast DNA replication is regulated by the redox state

Plant Physiology Preview. Published on February 27, 2013, as DOI:10.1104/pp.113.216291
Running Head: Redox control of chloroplast DNA replication
Research category: Cell Biology and Signal Transduction
Authors: Yukihiro Kabeya and Shin-ya Miyagishima
Address:
Center for Frontier Research, National Institute of Genetics, 1111 Yata, Mishima,
Shizuoka 411-8540, Japan
Phone number: +81-55-981-9411
E-mail:
YK; [email protected]
SM; [email protected]
Corresponding Authors:
Shin-ya Miyagishima
[email protected] (e-mail), +81-55-981-9411 (phone), +81-55-981-9412 (fax)
1
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Copyright 2013 by the American Society of Plant Biologists
Title: Chloroplast DNA replication is regulated by the redox state independently of
chloroplast division in Chlamydomonas reinhardtii.
Authors:
Yukihiro Kabeya and Shin-ya Miyagishima
Address:
Center for Frontier Research, National Institute of Genetics, 1111 Yata, Mishima,
Shizuoka 411-8540, Japan
One-sentence summary
This study elucidates that chloroplast DNA replication is regulated by the redox state in
the cell, which is sensed by the chloroplast nucleoids in Chlamydomonas reinhardtii.
2
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Footnotes
This study was supported by Grant-in-Aid for Scientific Research from Japan Society
for the Promotion of Science (nos. 24117523 and 22770061 to Y.K.; no. 19870033 to
S.M.), by Sasagawa Scientific Research Grant from the Japan Science Society (to Y.K.),
and by Core Research for Evolutional Science and Technology (CREST) Program of
Japan Science and Technology Agency (JST) (to S.M.).
3
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Abstract
Chloroplasts arose from a cyanobacterial endosymbiont and multiply by division. In
algal cells, chloroplast division is regulated by the cell cycle so as to occur only once, in
the S-phase. Chloroplasts possess multiple copies of their own genome which must be
replicated during chloroplast proliferation. In order to examine how chloroplast DNA
replication is regulated in the green alga Chlamydomonas reinhardtii, we first asked
whether it is regulated by the cell cycle, as is the case for chloroplast division.
Chloroplast DNA is replicated in the light and not the dark phase, independent of the
cell cycle or the timing of chloroplast division in photoautotrophic culture. Inhibition of
photosynthetic electron transfer blocked chloroplast DNA replication. However,
chloroplast DNA was replicated when the cells were grown heterotrophically in the dark,
raising the possibility that chloroplast DNA replication is coupled with the reducing
power supplied by photosynthesis or the uptake of acetate. When dimethylthiourea
(DMTU), a reactive oxygen species (ROS) scavenger was added to the photoautotrophic
culture, chloroplast DNA was replicated even in the dark. In contrast, when
methylviologen, a ROS inducer, was added, chloroplast DNA was not replicated in the
light. Moreover, the chloroplast DNA replication activity in both the isolated
chloroplasts and nucleoids was increased by dithiothreitol (DTT), while it was repressed
by diamide, a specific thiol-oxidizing reagent. These results suggest that chloroplast
DNA replication is regulated by the redox state that is sensed by the nucleoids, and that
the disulfide bonds in nucleoid-associated proteins are involved in this regulatory
activity.
4
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Introduction
Chloroplasts are semi-autonomous organelles that possess their own genome,
which is complexed with proteins to form nucleoids and also certain machinery needed
for protein synthesis, as is the case in prokaryotes. It is generally accepted that
chloroplasts arose from a bacterial endosymbiont closely related to the currently extant
cyanobacteria (Archibald, 2009; Keeling, 2010). In a manner reminiscent of their freeliving ancestor, chloroplasts proliferate by the division of preexisting organelles that are
coupled to the duplication and segregation of the nucleoids (Kuroiwa, 1991) and have
retained the bulk of their bacterial biochemistry. However, chloroplasts have
subsequently been substantially remodeled by the host cell so as to function as
complementary organelles within the eukaryotic host cell (Rodriguez-Ezpeleta and
Philippe, 2006; Archibald, 2009; Keeling, 2010). For example, most of the genes that
were once in the original endosymbiont genome have been either lost or transferred into
the host nuclear genome. As a result, the size of the chloroplast genome has been
reduced to less than one tenth that of the free-living cyanobacterial genome. Thus, the
bulk of the chloroplast proteome consists of nucleus-encoded proteins that are translated
on cytoplasmic ribosomes and translocated into chloroplasts. In addition, chloroplast
division ultimately came to be a process tightly regulated by the host cell, which
ensured permanent inheritance of the chloroplasts during the course of cell division and
from generation to generation (Rodriguez-Ezpeleta and Philippe, 2006; Archibald,
2009; Keeling, 2010).
5
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Chloroplast division is performed by constriction of the ring structures at the
division site, encompassing both the inside and the outside of the two envelopes (Yang
et al., 2008; Maple and Moller, 2010; Miyagishima, 2011; Pyke, 2012). One part of the
division machinery is derived from the cyanobacterial cytokinetic machinery that is
based on the FtsZ protein. In contrast, other parts of the division machinery involve
proteins specific to eukaryotes, including one member of the dynamin family. The
majority of algae (both unicellular and multicellular), which diverged early within the
Plantae, have just one or at most only a few chloroplasts per cell. In algae, the
chloroplast divides once per cell cycle before the host cell completes cytokinesis
(Suzuki et al., 1994; Miyagishima et al., 2012). In contrast, land plants and certain algal
species contain dozens of chloroplasts per cell that divide non-synchronously, even
within the same cell (Boffey and Lloyd, 1988). Because land plants evolved from algae,
there is likely to have been a linkage between the cell cycle and chloroplast division in
their algal ancestor that was subsequently lost during land plant evolution. Our recent
study showed that the timing of chloroplast division in algae is restricted to the S-phase
by S-phase-specific formation of the chloroplast division machinery, which is based on
the cell cycle-regulated expression of the components of the chloroplast division
machinery (Miyagishima et al., 2012).
Because chloroplasts possess their own genome, chloroplast DNA must be
duplicated so that each daughter chloroplast inherits the required DNA after division.
However, it is still unclear how the replication of chloroplast DNA is regulated and
6
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
whether the replication is coupled with the timing of chloroplast division, even though
certain studies have addressed this issue, as described below.
Bacteria such as Escherichia coli and Bacillus subtilis possess a single circular
chromosome. In these bacteria, the process of DNA replication is tightly coupled with
cell division (Boye et al., 2000; Zakrzewska-Czerwinska et al., 2007)), in which the
initiation of replication is regulated such that it occurs only once per cell division cycle
(Boye et al., 2000). In contrast, cyanobacteria contain multiple copies of their DNA (e.g.
3-5 copies in Synechococcus elongatus PCC 7942) (Mann and Carr, 1974; Griese et al.,
2011). In some obligate photoautotrophic cyanobacterial species, replication is initiated
only when light is available (Binder and Chisholm, 1990; Mori et al., 1996; Watanabe et
al., 2012). Replication is initiated asynchronously among the multiple copies of the
DNA. Although the regulation of the initiation of DNA replication is less stringent than
that in E. coli and B. subtilis, as described above, a recent study using S. elongatus 7942
showed that this replication peaks prior to cell division, as in other bacteria.
Chloroplasts also contain multiple copies of DNA (~1,000 copies) (Boffey
and Leech, 1982; Miyamura et al., 1986; Baumgartner et al., 1989; Oldenburg and
Bendich, 2004; Oldenburg et al., 2006; Shaver et al., 2008). In algae, chloroplast DNA
is replicated in a manner which keeps pace with chloroplast and cell division in order to
maintain the proper DNA content per chloroplast (i.e. per cell). In contrast, in land
plants, the copy number of DNA in each chloroplast (plastid) changes during the course
of development and differentiation, although contradictory results were reported about
leaf development (Lamppa and Bendich, 1979; Boffey and Leech, 1982; Hashimoto and
7
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Possingham, 1989; Kuroiwa, 1991; Rowan and Bendich, 2009; Matsushima et al.,
2011). Previous studies which synchronized the algal cell cycle by means of a 24-h
light–dark cycle showed that chloroplast DNA is replicated only during the G1 phase,
after which it is separated into daughter chloroplasts during the S-phase by chloroplast
division, implying that chloroplast DNA replication and division are temporally
separated (Chiang and Sueoka, 1967; Grant et al., 1978; Suzuki et al., 1994). However,
under these experimental conditions, G1 cells grow and the chloroplast DNA level
increases during the light period. Cells enter into the S phase, chloroplast DNA
replication ceases, and the chloroplasts divide at beginning of the dark period. Thus, it is
still unclear whether chloroplast DNA replication is directly controlled by the cell cycle
as is the case chloroplast division, or that chloroplast DNA replication simply occurs
merely when light energy is available.
We addressed this issue using a synchronous culture as well as heterotrophic
culture of the mixotrophic green alga C. reinhardtii. The results show that chloroplast
DNA replication occurs independently of either the cell cycle or the timing of
chloroplast division. Instead, it is shown that chloroplast DNA replication occurs when
light is available in photoautotrophic culture and even under darkness in heterotrophic
culture. Further experimental results suggest that chloroplast DNA replication is
regulated by the redox state in the cell, which is sensed by the chloroplast nucleoids.
Results
8
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
The relationship between chloroplast DNA replication and the timing of
chloroplast division
In order to determine the changes in the chloroplast DNA level that take place during
the cell cycle by means of quantitative real-time PCR (qPCR), the green alga C.
reinhardtii was used in this study for the following reasons. The cell cycle in this alga is
synchronized by a light and dark cycle (Surzycki, 1971). Because the cell cycle is linked
to circadian rhythms, cell-cycle synchrony is maintained even under continuous light
after initial entrainment by a light and dark cycle (Goto and Johnson, 1995). C.
reinhardtii cells contain a single chloroplast and this chloroplast divides during the S/M
phase. These features allow an examination of the relationship between chloroplast
DNA replication and the cell/chloroplast division cycle. In addition, cells grow in size
by many fold during the G1 phase and then enter into 1-4 rounds of the S/M phases to
produce 2-16 daughter cells during a single 24-h light and dark cycle. Thus, the levels
of the nuclear and chloroplast DNA increase many fold in a single cycle, which makes it
easier to detect any change in the DNA level by qPCR.
Previous studies using a 24-h light/dark synchronous culture of the red alga
Cyanidioschyzon merolae (Suzuki et al., 1994) and the green alga Scenedesmus
quadricauda (Zachleder et al., 1995) showed that the level of chloroplast DNA
increases only during the light period (the G1 phase) and chloroplasts divide early in the
dark period (the S phase). Thus, it has remained unclear whether the timing of
chloroplast DNA replication is defined by the cell/chloroplast division cycle or is
coupled with the availability of light.
9
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
In order to address this issue, we synchronized two populations of C.
reinhardtii using a light and dark cycle, and then one population was cultured in the
same light and dark cycle while the other was cultured under continuous light. The
nuclear and chloroplast DNA levels were examined by qPCR of the RBCS gene (the
nuclear genome) and the rbcL gene (the chloroplast genome), respectively.
Under the light/dark cycle (L/D/L in Fig. 1B), the chloroplast DNA level
increased only during the light period (corresponding to the G1 phase; 0-12 h and 24-36
h) prior to the increase of the nuclear DNA level and cell division (corresponding to the
S/M phase when the chloroplast divide; 8-20 h, Figs. 1A and B) as observed in previous
studies on other algae (Chiang and Sueoka, 1967; Suzuki et al., 1994; Zachleder et al.,
1995). In contrast, when cells were cultured under continuous light (L/L/L in Fig. 1B)
after the entrainment by a light/dark cycle, the level of chloroplast DNA kept increasing,
even though nuclear DNA replication (8-24 h) and cell division (8-24 h) were restricted
to subjective night. These results indicate that chloroplast DNA replication is linked to
the availability of light and not the cell/chloroplast division cycle.
Although the chloroplast DNA level kept increasing under continuous light,
there was little difference in the ratio of chloroplast DNA to nuclear DNA between the
light/dark culture and the continuous light culture (Fig. 1C). This is because both the
nuclear DNA level and the cell number increased more under continuous light than
under the light/dark cycle (Fig. 1A). In addition, it is known that both the cell and
chloroplast size increase, even in the S/M phase, when light is available (Fig. 1A)
10
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
(Rollins et al., 1983). Thus, it appears that chloroplast DNA replication is linked to
increase of the cell and chloroplast size.
The relationship between chloroplast DNA replication and photosynthesis
The obtained results indicate that the chloroplast DNA is replicated when light is
available during photoautotrophic growth. In order to investigate the relationship
between photosynthesis and chloroplast DNA replication, 3-(3’, 4’-dichlorophenyl)-1,
1-dimethylurea, which blocks electron transfer between photosystem II and
plastoquinone (Taiz and Zeiger, 2010), was added to a non-synchronous log-phase
culture that was grown under continuous light. After the addition of DCMU, cells were
cultured for 12 h under continuous light and the change in the chloroplast and nuclear
DNA levels over 12 h were examined by qPCR (Fig. 2A). After the addition of DCMU,
the increases in the chloroplast and nuclear DNA levels were blocked (Fig. 2A). When
DCMU was removed by replacing the medium with a fresh one lacking DCMU, the
increase in the chloroplast DNA level was resumed (Fig. 2B). These results indicate that
chloroplast DNA replication requires photosynthesis during photoautotrophic growth.
In order to examine whether there are factors specific to photosynthetic electron
transfer that are required for chloroplast DNA replication, we cultured the cells
heterotrophically under darkness. C. reinhardtii cells are capable of efficient
heterotrophic growth in the presence of acetate (Harris, 1989). qPCR analyses showed
that the chloroplast DNA level keep increasing in accordance with replication of the
nuclear DNA and cell division (Fig. 3). Given these results, it is suggested that
11
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
chloroplast DNA replication is coupled with cell growth by photosynthesis or the
uptake of acetate, which supply a carbon source and reducing power to the cell.
Relationship between chloroplast DNA replication and redox state
One possibility raised by the above results is that chloroplast DNA replication is
linked to the cellular redox state, because photosynthesis and acetate uptake metabolism
supply reducing power to the cell. Therefore, we examined the effects of the oxidative
and reductive states on chloroplast DNA replication using membrane-permeable redox
reagents. Methylviologen accepts electrons from photosystem I and transfers them to
oxygen molecules, resulting in the production of ROS in chloroplasts (Taiz and Zeiger,
2010). DMTU quenches ROS and reduces oxidative stress (Levine et al., 1994). Under
the culturing conditions we used, treatment with DMTU for more than 4 h perturbed the
cell shape and decreased both the chloroplast and nuclear DNA levels, probably as the
result of cell death. Therefore, we examined the effects of methylviologen and DMTU
on DNA replication 4 h after the addition of these reagents (Fig. 4, Table I).
First, we examined the effect of redox reagents on cellular redox state by
quantifying cellular glutathione level (Table I). When methylviologen was added to a
nonsynchronous log-phase culture that was grown photoautotrophically under
continuous light, the level of reduced glutathione (GSH) decreased by one-fifth of that
of untreated cells. In addition, the ratio of GSH to oxidized glutathione (GSSG) also
decreased from 3.0 ± 0.5 to 0.7 ± 0.2, which was lower than the ratio in cells cultured in
the dark without methylviologen (2.0 ± 0.1). In contrast, when DMTU was added to
12
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
photoautotrophic synchronous culture at the end of a 12-h dark period, the amount of
GSH increased two fold and the GSH/GSSG ratio also increased from 2.2 ± 0.7 to 7.8 ±
3.2, which was higher than the ratio in cells cultured under light without DMTU (ratio =
3.3 ± 0.5). These results indicate that methylviologen and DMTU treatment changes
cellular redox state as expected. Further, we confirmed that the light and dark treatment
also changes redox state in chloroplasts.
When methylviologen was added to culture as described above, the
replication activities of the chloroplast and nuclear DNA were blocked (Fig. 4A). In
contrast, when DMTU was added to dark culture as described above, the chloroplast
DNA level, but not the nuclear DNA level, increased under the dark condition to the
same level as that in cells grown under light without DMTU (Fig. 4B). We also
examined the effect of DMTU on chloroplast DNA replication by DAPI-staining (Fig.
4C). The DAPI fluorescent intensity in the chloroplast (the foci overlapping the red
chloroplast autofluorescence) did not change under darkness without DMTU. In
contrast, DMTU treatment increased the fluorescent intensity up to 2.5-fold over 4 h.
These results suggest that the chloroplast DNA replication is regulated by the cellular
redox state and that replication occurs when the cells are in a reduced state.
The connection between the cellular redox state and chloroplast DNA synthesis
In order to understand how chloroplast DNA replication is linked to the cellular redox
state, we tested the following three hypotheses: (1) The chloroplast DNA polymerase
level increases under a reducing condition, (2) The chloroplast DNA polymerase
13
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
activity is enhanced under a reducing condition by the modification of the polymerase
or other regulatory proteins, and (3) The intra-chloroplast deoxynucleotide level (dNTP;
the substrate of DNA replication) increases in the reduced state.
To test the first hypothesis, we examined the level of chloroplast DNA
polymerase in synchronous culture. Plant and algae do not possess any DNA
polymerase of cyanobacterial origin. Recent studies showed that the replication of
chloroplast DNA is performed by the plant organellar DNA polymerase (POP) (Ono et
al., 2007; Moriyama et al., 2008; Parent et al., 2011; Udy et al., 2012), which is similar
to bacterial DNA polymerase I and is targeted to both chloroplasts and mitochondria.
We performed BLAST searches in the C. reinhardtii database in an effort to identify
POP orthologs. We observed that the C. reinhardtii POP gene was misannotated as two
adjacent but separate genes (accession No. XM_001695976 and XM_001695977).
XM_001695976 and XM_001695977 encode the 3’-5’ exonuclease domain, which is in
the N-terminus, and the PolA domain, which is in the C-terminus of the POP protein in
other species. By means of reverse transcription PCR, we verified that XM_001695976
and XM_001695977 are indeed transcribed as a single gene. We prepared polyclonal
antibodies against CrPOP that detect a band of 130 kDa (Fig. 5), which is similar to the
molecular mass of the POP proteins in other species (Ono et al., 2007; Moriyama et al.,
2008). The immunoblot analysis showed that the CrPOP level was constant throughout
the cell cycle when synchronized by a light and dark cycle (Fig. 5). This result indicates
that chloroplast DNA is not replicated in photoautrophic culture grown in the dark, even
though the POP protein is present at the same level in culture under light.
14
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
To test the second and the third possibilities, we performed an in vitro
chloroplast DNA synthesis assay using isolated chloroplasts. Intact chloroplasts were
isolated from photoautotrophic synchronous culture either from at the end of the dark
period or at the end of the subjective night phase of continuous light culture. After
chloroplasts were osmotically permeabilized in a hypertonic buffer, an excess amount of
substrates for DNA replication (dNTPs and digoxygenin-labeled dUTP (DIG-dUTP))
were added, and then the DNA synthesis activity was determined as the incorporation of
DIG into the chloroplast DNA. The assay showed that the level of DIG-dUTP
incorporation into the chloroplast DNA was larger in the chloroplasts isolated from
culture under light than under dark (Fig. 6). The incorporation of DIG-dUTP was
blocked when ethidium bromide, which blocks DNA replication, was added to the
reaction mixture, indicating that this DIG incorporation is specific to DNA replication.
To examine whether the redox state has an effect on the activity of chloroplast
DNA replication as observed in vivo (Fig. 4), redox reagents were added to the reaction
mixture (Fig. 6). Addition of reduced thioredoxin, NADPH, and GSH, which are
reducing agents in chloroplasts (Scheibe, 1991), had no significant effect on DNA
synthesis. However, the addition of DTT elevated the DNA synthesis activity of
chloroplasts prepared from dark-grown culture so as to be as high as that in the lightgrown culture. In accordance with this result, the addition of diamide, a sulphydryl
group-specific oxidizing agent, reduced the DNA synthesis in the chloroplasts prepared
from the light-grown culture to as low as that from dark-grown culture. Even though
excess substrate levels were included in the reaction mixture, DNA synthesis activity
15
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
was still affected by either the culture condition (light or dark) or redox reagents.
Although it cannot completely be ruled out that a change in the intra-chloroplast dNTP
level might also be involved in the regulation of DNA replication, the above results
suggest that replication is regulated by the redox state of a sulphydryl group in
chloroplast proteins.
Next, we asked whether chloroplast nucleoids are sufficient to sense the redox
state and thus affect DNA replication activity. To this end, we performed an in vitro
chloroplast DNA synthesis assay using isolated chloroplast nucleoids (Fig. 7). The
isolated chloroplasts were solubilized by a non-ionic detergent Nonidet P-40 and the
nucleoids were isolated. As in the case of isolated chloroplasts, DNA synthesis activity
was found to be higher in the nucleoids isolated from the light-exposed culture than that
from the culture under darkness. DTT increased while diamide reduced the DNA
synthesis activity. These results suggest that the chloroplast nucleoid is sufficient to
respond to changes in the redox state in order to regulate DNA replication.
Discussion
Previous studies using a 24-h light/dark synchronous culture of algae showed
that the chloroplast DNA is replicated only during the light period (G1 phase), prior to
nuclear DNA replication (S phase), chloroplast division and cytokinesis, which occur
during the dark period (Chiang and Sueoka, 1967; Suzuki et al., 1994; Zachleder et al.,
1995). Based on these results, it was concluded that the DNA replication and division
phases are temporally separated in chloroplasts. However, here we have shown that the
16
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
chloroplast DNA is replicated independently of the timing of chloroplast division and
the cell cycle, and that chloroplast DNA continues to be replicated as long as light
energy is available to drive photosynthetic electron transfer during photoautotrophic
growth (Figs. 1 and 2).
Under a continuous light condition after the entrainment with a light/dark
cycle in the photoautotrophic medium, chloroplast DNA continued to be replicated and
the chloroplast and cell size also continued to increase, even in the S/M phase (Figs. 1A
and B). Because cells grown under continuous light undergo more rounds of the S/M
phase than cells grown in a light/dark condition, the chloroplast DNA level per
cell/chloroplast does not change in daughter cells in the two conditions (Fig. 1C). Given
these results, it appears that chloroplast DNA replication is correlated with
cell/chloroplast growth, thereby maintaining the proper DNA content per
cell/chloroplast volume. The significance of chloroplast polyploidy has been much
debated. Mutation in the organellar DNA polymerase in maize reduces the chloroplast
DNA copy number as well as the chloroplast-encoded transcripts and proteins,
suggesting that the DNA copy number is a limiting factor for the expression of
chloroplast-encoded genes (Udy et al., 2012). Other recent studies revealed a reduction
in the chloroplast DNA copy number under phosphate-limited condition in C.
reinhardtii (Yehudai-Resheff et al., 2007) and an increase in the copy number under a
phosphate-rich condition in the green alga Nannochloris bacillaris (Sumiya et al., 2008).
These studies raise the possibility that polyploidal chloroplast DNA may at least serve
as repository of phosphorus. Taken together, one possibility is that the chloroplast DNA
17
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
replication is correlated with cell/chloroplast growth by phosphorus that are assimilated
by reducing power supplied by photosynthesis or uptake of acetate. In this point, further
studies will be required.
When cells were cultured in a photoautotorophic medium, photosynthetic
electron flow was required for the chloroplast DNA replication (Fig. 2). However, even
under darkness, chloroplast DNA replicated in a heterotrophic medium which contained
acetate as sources of carbon and reducing power (Fig. 3). These results raised a
possibility that the chloroplast DNA replication is linked to cellular redox state.
Consistent with this assumption, Lau et al. showed that cells treated with cadmium and
cells growing in a nitrogen-replete medium, in which levels of chloroplast DNA
decreased, contained low GSH levels (Lau et al., 2000). In this study, we showed that
artificial alteration of cellular redox state by redox reagents changes the activity of
chloroplast DNA replication (Fig. 4). In our study, chloroplast DNA replication was
blocked by the addition of methylviologen under light (Fig. 4A). In contrast, replication
of the chloroplast DNA, but not that of nuclear DNA, was activated by the addition of
DMTU under dark (Figs. 4B and C). In addition, we confirmed that cellular redox state
was changed when cells were treated with the above redox reagents (Table I). Thus, our
results suggest that cellular redox state affects the level of chloroplast DNA replication.
For factors that link chloroplast DNA replication and the cellular redox state,
three candidates were considered. These include (1) the level or (2) replication activity
of the POP protein (chloroplast DNA polymerase) and (3) the level of dNTPs
(substrates for DNA replication). The results show that the POP level is constant under
18
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
the light and dark conditions during photoautotrophic growth (Fig. 5). The results
obtained showed that DNA replication activity is higher under light than under dark
even when excessive levels of dNTPs were supplied in vitro (Figs. 6 and 7). Thus, our
results suggest that the activity of the DNA polymerase (probably POP) is a ratelimiting factor in chloroplast DNA replication. However, in vitro DNA synthesis was
still observed in chloroplasts isolated from culture grown under darkness (Figs. 6 and 7).
Therefore, at this point, we can not completely rule out the possibility that change in the
intra-chloroplast dNTP level might also be involved in the regulation of the chloroplast
DNA replication. However, replication of the nuclear DNA occurs during the dark
period in photoautotrophic synchronous culture, indicating that there is at least a
sufficient dNTP level for DNA synthesis in the whole cell.
Chloroplast DNA replication in vitro was activated by DTT, but was
inactivated by diamide, which is a sulphydryl group-specific oxidative agent (Figs. 6
and 7). These results suggest that activity of the chloroplast DNA polymerase is
regulated by redox state of the sulphydryl group, at least in some of the chloroplast
proteins. Besides, given that chloroplast nucleoids are sufficient to sense the redox state
to change the DNA replication activity (Fig. 7), the sulphydryl group in certain
chloroplast nucleoid-associated proteins, including POP itself, may link the redox state
to DNA replication activity. In this regard, FrxB protein is likely a candidate. FrxB
binds to the chloroplast DNA replicative origin in C. reinhardtii. In addition, FrxB is an
iron-sulfur redox protein subunit of chloroplast NADH dehydrogenase, raising a
19
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
possibility that FrxB links redox state the chloroplast DNA replication (Wu et al., 1989;
Wu et al., 1993).
For a better understanding of the regulation of chloroplast DNA replication,
the identification of the redox sensing, replication-related proteins will be required.
Plant and algal genomes do not encode any DNA replication-related proteins of
cyanobacterial origin, such as the DNA polymerase and DnaA protein which are
involved in the initiation of replication in bacteria. Therefore, biochemical approaches,
including disulfide proteomics of the chloroplast nucleoids, will be needed to determine
the eukaryote-specific mechanism of the redox state-based regulation of chloroplast
DNA replication.
Materials and Methods
Synchronous culture
C. reinhardtii 137c mt+ and cw-15 cells were cultured in Sueoka’s high salt
medium (HSM) (Sueoka, 1967) photoautotrophically. For synchronization, the cells in
log phase were subcultured to 1x 106 cells mL-1 and were subjected to a 12-h light/12-h
dark cycle (100 µmol photons m-2s-1) at 24ºC under aeration with ambient air (Surzycki,
1971). Cells in the second and the third cycle were used for further analyses.
Non-synchronous heterotrophic culture
20
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
For heterotrophic culture, the 137c mt+ cells were cultured in Tris-acetatephosphate (TAP) (Gorman and Levine, 1965) medium under complete darkness at 24ºC
and ambient aeration with ambient air (Chen and Johnson, 1996).
Drug treatments
For the drug treatments, 137c mt+ cells were used. For 3-(3,4dichlorophenyl)-1,1-dimethylurea (DCMU) treatment, a 1/1,000 volume of 50 mM
DCMU stock solution in ethanol was added to nonsynchronous log-phase culture that
was grown under continuous light. For methylviorogen treatment, a 1/1,000 volume of 1
mM methylviorogen stock solution in water was added to nonsynchronous log-phase
cultures that were grown under continuous light. For dimethylthiourea (DMTU)
treatment, a 1/100 volume of 2 M DMTU stock solution dissolved in HSM medium was
added to the synchronous culture at the end of the second dark period.
Quantification of nuclear and chloroplast DNA by quantitative PCR
The DNA level was analyzed by quantitative PCR (qPCR). Cells were
harvested from 0.5 mL culture by centrifugation at 1,000 g for 5 min and stored at -80ºC
until DNA extraction. Cells were resuspended in TES buffer (50 mM Tris-HCl pH 8.0,
20 mM EDTA, 200 mM NaCl, 1% SDS) and then DNA was extracted by the
phenol/chloroform method. The extracted DNA was dissolved in 100 µL of distilled
water. qPCR amplification was performed using Power SYBR Green PCR Master Mix
(Applied Biosystems) in a Real-time PCR system (StepOne Plus, Applied Biosystems).
21
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
qPCR was performed using the primers 5’-gcgcccgcagctgtact-3’ and 5’aacatgggcagcttccacat-3’ for the nuclear DNA (RBCS1 gene), and 5’gtcgtgaccttgctcgtgaa-3’ and 5’-tctggagaccatttacaagctgaa-3’ for the chloroplast DNA
(rbcL gene).
Quantification of reduced glutathione and oxidized glutathione
Cells were harvested by centrifugation at 1,000 g for 5 min at 4ºC and then
washed with phosphate buffer saline (PBS). Cells were resuspended in 5% sulfosalicylic
acid solution and disrupted by sonication. Supernatants were obtained by centrifugation
at 15,000 g for 5 min at 4ºC. Chloroplasts isolated as described below were harvested
by centrifugation at 700 g for 5 min at 4ºC and then were washed with 50 mM HEPESKOH pH 7.5 containing 300 mM sorbitol. The isolated chloroplasts were resuspended
in 5% sulfosalicylic acid solution and centrifuged at 15,000 g for 5 min at 4ºC to
remove debris. Reduced glutathione (GSH) and oxidized glutathione (GSSG) extracted
into the supernatants were quantified by using the GSSG/GSH quantification kit
(Dojindo) according to the manufacturer’s instructions.
Antibody preparation
The cDNA sequence encoding a partial fragment of CrPOP was amplified by
PCR using the primers 5’- caccagccgcagcggcaagaagacctacgg -3’ and 5’ctacacattcatgtagcggctcaccttgat -3’. The PCR product was cloned into a pET100
expression vector (Invitrogen) and the 6xHis fusion polypeptide was expressed in
22
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Rosetta (DE3) E. coli cells, purified using HisTrap HP column (GE healthcare).
Polypeptide was further separated electrophoretically in a preparative acrylamide gel.
The antibodies against CrPOP were raised in rabbits using the gel band containing the
recombinant polypeptide and then antibodies were affinity-purified from the anti-sera
using a HiTrap NHS-activated HP column (GE Healthcare), to which recombinant
polypeptide (eluate of the HisTrap HP column) was covalently bound.
Immunoblot analyses
Cells were harvested from 5 mL of culture by centrifugation and stored at 80ºC. Cells were suspended in the protein extraction buffer (50 mM Tris, pH 7.5, 8 M
urea, 0.1% Triton X-100) and sonicated. Protein content was determined by Bradford
assay and equal amounts of the total proteins were subjected to immunoblot analyses.
Immunoblotting assays were performed as previously described (Kabeya et al., 2010).
Anti-CrPOP was used at a dilution of 1:1,000.
Isolation of intact chloroplasts
Chloroplasts were isolated using a modified version of Mason’s method
(Mason et al., 2006). All manipulations were done at 4ºC or on ice. The cw-15 cells
were synchronously cultured to < 1.0 x 107 cells mL-1. Cells were harvested by
centrifugation at 3,000 g for 10 min and resuspended in CP isolation buffer (50 mM
HEPES-KOH pH 7.5, 2 mM EDTA, 1 mM MgCl2, 1% BSA, 300 mM sorbitol). The
cells were then broken by a single passage through an airbrush (0.2-mm aperture
23
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
airbrush, HP-60, OLYMPOS, Japan) at a pressure of 0.7 kg cm-2 according to the
reported airbrush method (Nishimura et al., 2002). The lysate was centrifuged at 750 g
for 2 min and the pellet was gently resuspended in 3 mL of CP isolation buffer using a
paintbrush. The sample was layered on the top of a discontinuous Percoll gradient
(20/45/65% Percoll in CP isolation buffer). After centrifugation at 3,220 g for 30 min,
the green band that appeared at the interface between the 45% and 65% layers was
collected. It was confirmed by DAPI staining that the collected fraction contained scant
nuclear or mitochondrial contamination. The chloroplast-rich fraction was diluted with
CP isolation buffer and then centrifuged at 670 g for 1 min to remove the Percoll. The
purified chloroplasts were used for the in vitro DNA synthesis or isolation of the
nucleoids.
Isolation of the chloroplast nucleoids
Chloroplast nucleoids were isolated using a modified version of Sato’s
method (Sato et al., 1998). All manipulations were performed at 4ºC or on ice. Isolated
chloroplasts were lysed with 2% Nonidet P-40 dissolved in TAN buffer (20 mM TrisHCl pH 7.5, 0.5 mM EDTA, 7 mM 2-mercaptoethanol, 1.2 mM spermidine, 0.5 M
sucrose) for 1 h. Then the sample was centrifuged at 20,000 g for 30 min. The pellet
with the enriched chloroplast nucleoids was resuspended with TAN buffer containing
2% Nonidet P-40 and centrifuged again. The isolated nucleoids were used for in vitro
DNA synthesis.
24
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Detection of newly synthesized chloroplast DNA using the isolated chloroplasts and
chloroplast nucleoids
1 x 107 chloroplasts were suspended in 300 µL of hypertonic replication buffer
(50 mM Tris-HCl pH 8.0, 50 mM KCl, 5 mM MgCl2). Nucleoids isolated from 1 x 109
chloroplasts were suspended in 300 µL of replication buffer. After incubation with or
without 10 mM DTT, 0.5 mM NADPH, 0.1 mM thioredoxin (#203-13041, Wako)
reduced by DTT, 10 mM GSH, 1 mM diamide, or 10 µg/ml ethidium bromide for 15
min at 24ºC, a one-tenth volume of DIG labeling Mix (Roche) was added and then
incubated at 24ºC up to 1 h. After incubation, DNA was extracted at 0, 20, and 60 min
and slot-blotted onto a Hybond-N+ membrane. The signals representing newly
synthesized chloroplast DNA were detected by anti-DIG-AP conjugates (#11585550910,
Roche) and a CDP-Star system (Applied Biosystems).
Acknowledgments
We thank Y. Ono and A. Yamashita for technical support. We also thank Dr. N.
Sumiya, Dr. S. Hirooka, and Ms. M. Nakamura for useful discussions.
Literature Cited
Archibald JM (2009) The puzzle of plastid evolution. Curr Biol 19: R81-88
Baumgartner BJ, Rapp JC, Mullet JE (1989) Plastid transcription activity and DNA
copy number increase early in barley chloroplast development. Plant Physiol 89:
1011-1018
25
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Binder BJ, Chisholm SW (1990) Relationship between DNA cycle and growth rate in
Synechococcus sp. strain PCC 6301. J Bacteriol 172: 2313-2319
Boffey SA, Leech RM (1982) Chloroplast DNA levels and the control of chloroplast
division in light-grown wheat leaves. Plant Physiol 69: 1387-1391
Boffey SA, Lloyd D, eds (1988) The Division and segregation of organelles. Cambridge
University Press, Cambridge
Boye E, Lobner-Olesen A, Skarstad K (2000) Limiting DNA replication to once and
only once. EMBO Rep 1: 479-483
Chen F, Johnson MR (1996) Heterotrophic growth of Chlamydomonas reinhardtii on
acetate in chemostat culture. Process Biochem 31: 601-604
Chiang KS, Sueoka N (1967) Replication of chloroplast DNA in Chlamydomonas
reinhardi during vegetative cell cycle: its mode and regulation. Proc Natl Acad
Sci U S A 57: 1506-1513
Gorman DS, Levine RP (1965) Cytochrome f and plastocyanin: their sequence in the
photosynthetic
electron transport chain of Chlamydomonas reinhardii. Proc Natl Acad Sci U S A 54:
1665-1669
Goto K, Johnson CH (1995) Is the cell division cycle gated by a circadian clock? The
case of Chlamydomonas reinhardtii. J Cell Biol 129: 1061-1069
Grant D, Swinton D, Chiang K (1978) Differential Patterns of Mitochondrial,
Chloroplastic and Nuclear DNA Synthesis in the Synchronous Cell Cycle of
Chlamydomonas reinhardtii. Planta 141: 259-267
Griese M, Lange C, Soppa J (2011) Ploidy in cyanobacteria. FEMS Microbiol Lett
323: 124-131
Harris EH, ed (1989) The Chlamydomonas Sourcebook. Academic Press, San Diego
Hashimoto H, Possingham JV (1989) Effect of light on the chloroplast division cycle
and DNA synthesis in cultured leaf discs of spinach. Plant Physiol 89: 11781183
Kabeya Y, Nakanishi H, Suzuki K, Ichikawa T, Kondou Y, Matsui M, Miyagishima
SY (2010) The YlmG protein has a conserved function related to the distribution
of nucleoids in chloroplasts and cyanobacteria. BMC Plant Biol 10: 57
Keeling PJ (2010) The endosymbiotic origin, diversification and fate of plastids. Philos
Trans R Soc Lond B Biol Sci 365: 729-748
26
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Kuroiwa T (1991) The replication, differentiation, andinheritanceof plastids with
emphasis on the concept of organelle nuclei. Int Rev Cytol 128: 1-62
Lamppa GK, Bendich AJ (1979) Changes in Chloroplast DNA Levels during
Development of Pea (Pisum sativum). Plant Physiol 64: 126-130
Lau KW, Ren J, Wu M (2000) Redox modulation of chloroplast DNA replication in
Chlamydomonas reinhardtii. Antioxid Redox Signal 2: 529-535
Levine A, Tenhaken R, Dixon R, Lamb C (1994) H2O2 from the oxidative burst
orchestrates the plant hypersensitive disease resistance response. Cell 79: 583593
Mann N, Carr NG (1974) Control of macromolecular composition and cell division in
the blue-green algae Anacystis nidulans. J Gen Microbiol 83: 399-405
Maple J, Moller SG (2010) The complexity and evolution of the plastid-division
machinery. Biochem Soc Trans 38: 783-788
Mason CB, Bricker TM, Moroney JV (2006) A rapid method for chloroplast isolation
from the green alga Chlamydomonas reinhardtii. Nat Protoc 1: 2227-2230
Matsushima R, Tang LY, Zhang L, Yamada H, Twell D, Sakamoto W (2011) A
conserved, Mg(2)+-dependent exonuclease degrades organelle DNA during
Arabidopsis pollen development. Plant Cell 23: 1608-1624
Miyagishima SY (2011) Mechanism of plastid division: from a bacterium to an
organelle. Plant Physiol 155: 1533-1544
Miyagishima SY, Suzuki K, Okazaki K, Kabeya Y (2012) Expression of the nucleusencoded chloroplast division genes and proteins regulated by the algal cell cycle.
Mol Biol Evol 29: 2957-2970
Miyamura S, Nagata T, Kuroiwa T (1986) Quantitative fluorescence microscopy on
dynamic changes of plastid nucleoids during wheat development. Protoplasma
133: 66-72
Mori T, Binder B, Johnson CH (1996) Circadian gating of cell division in
cyanobacteria growing with average doubling times of less than 24 hours. Proc
Natl Acad Sci U S A 93: 10183-10188
Moriyama T, Terasawa K, Fujiwara M, Sato N (2008) Purification and
characterization of organellar DNA polymerases in the red alga
Cyanidioschyzon merolae. FEBS J 275: 2899-2918
Nishimura Y, Misumi O, Kato K, Inada N, Higashiyama T, Momoyama Y,
27
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Kuroiwa T (2002) An mt(+) gamete-specific nuclease that targets mt(-)
chloroplasts during sexual reproduction in C. reinhardtii. Genes Dev 16: 11161128
Oldenburg DJ, Bendich AJ (2004) Most chloroplast DNA of maize seedlings in linear
molecules with defined ends and branched forms. J Mol Biol 335: 953-970
Oldenburg DJ, Rowan BA, Zhao L, Walcher CL, Schleh M, Bendich AJ (2006)
Loss or retention of chloroplast DNA in maize seedlings is affected by both light
and genotype. Planta 225: 41-55
Ono Y, Sakai A, Takechi K, Takio S, Takusagawa M, Takano H (2007) NtPolI-like1
and NtPolI-like2, bacterial DNA polymerase I homologs isolated from BY-2
cultured tobacco cells, encode DNA polymerases engaged in DNA replication in
both plastids and mitochondria. Plant Cell Physiol 48: 1679-1692
Parent JS, Lepage E, Brisson N (2011) Divergent roles for the two PolI-like organelle
DNA polymerases of Arabidopsis. Plant Physiol 156: 254-262
Pyke KA (2012) Divide and shape: an endosymbiont in action. Planta
Rodriguez-Ezpeleta N, Philippe H (2006) Plastid origin: replaying the tape. Curr Biol
16: R53-56
Rollins MJ, Harper JDI, John PCL (1983) Synthesis of individual proteins, including
tubulins and chloroplast membrane proteins, in synchronous cultures of the
eukaryote Chlamydomonas reinhardtii. Elimination of periodic changes in
protein synthesis and enzyme activity under constant environmental conditions.
J Gen Microbiol 129: 1899-1919
Rowan BA, Bendich AJ (2009) The loss of DNA from chloroplasts as leaves mature:
fact or artefact? J Exp Bot 60: 3005-3010
Sato N, Ohshima K, Watanabe A, Ohta N, Nishiyama Y, Joyard J, Douce R (1998)
Molecular characterization of the PEND protein, a novel bZIP protein present in
the envelope membrane that is the site of nucleoid replication in developing
plastids. Plant Cell 10: 859-872
Scheibe R (1991) Redox-modulation of chloroplast enzymes : a common principle for
individual control. Plant Physiol 96: 1-3
Shaver JM, Oldenburg DJ, Bendich AJ (2008) The structure of chloroplast DNA
molecules and the effects of light on the amount of chloroplast DNA during
development in Medicago truncatula. Plant Physiol 146: 1064-1074
28
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Sueoka N (1967) Mitotic replication of deoxyribonucleic acid in Chlamydomonas
reinhardi. Proc Natl Acad Sci U S A 46: 83-91
Sumiya N, Hirata A, Kawano S (2008) Multiple FtsZ ring formation and reduplicated
chloroplast DNA in Nannochloris bacillaris (Chlorophyta, Trebouxiophyceae)
under phosphate-enriched culture. J phycol 44: 1476-1489
Surzycki S (1971) Synchronously grown cultures of Chlamydomonas reinhardii.
Methods in Enzymology 23: 67-73
Suzuki K, Ehara T, Osafune T, Kuroiwa H, Kawano S, Kuroiwa T (1994) Behavior
of mitochondria, chloroplasts and their nuclei during the mitotic cycle in the
ultramicroalga Cyanidioschyzon merolae. Eur J Cell Biol 63: 280-288
Taiz L, Zeiger E, eds (2010) Plant physiology, Ed Fifth. Sinauer Associates Inc.,
Sunderland, USA
Udy DB, Belcher S, Williams-Carrier R, Gualberto JM, Barkan A (2012) Effects of
reduced chloroplast gene copy number on chloroplast gene expression in maize.
Plant Physiol 160: 1420-1431
Watanabe S, Ohbayashi R, Shiwa Y, Noda A, Kanesaki Y, Chibazakura T,
Yoshikawa H (2012) Light-dependent and asynchronous replication of
cyanobacterial multi-copy chromosomes. Mol Microbiol 83: 856-865
Wu M, Chang C, Yang J, Zhang Y, Nie Z, Hsieh C (1993) Regulation of chloroplast
DNA replication in Chlamydomonas reinhardtii. Bot. Bull. Acad. Sin. 34: 115131
Wu M, Nie ZQ, Yang J (1989) The 18-kD protein that binds to the chloroplast DNA
replicative origin is an iron-sulfur protein related to a subunit of NADH
dehydrogenase. Plant Cell 1: 551-557
Yang Y, Glynn JM, Olson BJ, Schmitz AJ, Osteryoung KW (2008) Plastid division:
across time and space. Curr Opin Plant Biol 11: 577-584
Yehudai-Resheff S, Zimmer SL, Komine Y, Stern DB (2007) Integration of
chloroplast nucleic acid metabolism into the phosphate deprivation response in
Chlamydomonas reinhardtii. Plant Cell 19: 1023-1038
Zachleder V, Kawano S, Kuroiwa T (1995) The course of chloroplast DNA replication
and its relationship to other reproductive processes in the chloroplast and
nucleocytoplasmic compartment during the cell cycle of the alga Scenedesmus
quadricauda. Protoplasma 188: 245-251
29
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Zakrzewska-Czerwinska J, Jakimowicz D, Zawilak-Pawlik A, Messer W (2007)
Regulation of the initiation of chromosomal replication in bacteria. FEMS
Microbiol Rev 31: 378-387
Figure Legends
Figure 1
The changes in the nuclear and chloroplast DNA levels in the synchronous culture. C.
reinhardtii 137c mt+ cells were cultured in the photoautotrophic medium (HSM
medium). A, Progression of the cell cycle in the synchronous culture. Cells were
entrained by a 12-h light and 12-h dark cycle and then grown under a light/dark cycle
(L/D/L) or continuous light condition (L/L/L). Scale bar = 10 µm. B, Changes in the
cell number and the nuclear and chloroplast DNA levels in the synchronous culture
were determined by qPCR analyses using the primer sets for rbcL (chloroplast DNA,
cpDNA), RBCS1 (nuclear DNA, nuDNA). The gray and white regions in the graph
indicate the subjective night and light periods, respectively. The error bars represent the
standard error of 3 technical repeats of qPCR. C, The ratio of the chloroplast DNA
relative to the nuclear DNA in cells grown under the L/D/L or L/L/L conditions. The
ratio was calculated from the DNA levels in B. The error bars represent the standard
error. Two independent experiments showed similar results.
Figure 2
The effect of an inhibition of photosynthetic electron transfer on chloroplast DNA
replication. C. reinhardtii 137c mt+ cells were cultured in the photoautotrophic medium.
30
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
To inhibit photosynthetic electron transfer, 3-(3,4-dichlorophenyl)-1,1-dimethylurea
(DCMU) was added to the nonsynchronous log-phase culture that was grown under
continuous light. The nuclear (nuDNA) and chloroplast (cpDNA) DNA levels were
determined by qPCR analyses. A, The levels of chloroplast and nuclear DNA and the
cell number 12 h after treatment with DCMU (DCMU dissolved in ethanol was added)
or without DCMU (mock, ethanol was added) DCMU. The DNA levels and the cell
number just before the addition of DCMU are defined as 1.0. The error bars represent
the standard error of 3 technical repeats of qPCR. Two independent experiments showed
similar results. B, Change in the level of chloroplast DNA after the removal of DCMU.
Four hours after the addition of DCMU, medium was replaced by fresh medium without
DCMU and further cultured for 4 hours. The solid line indicates the chloroplast DNA
level in the culture treated with DCMU and the broken line the culture without DCMU
treatment. The error bars represent the standard error of 3 technical repeats of qPCR.
Two independent experiments showed similar results.
Figure 3
The changes in the chloroplast DNA level in the heterotrophic culture under the dark
condition. C. reinhardtii 137c mt+ cells were cultured in the medium containing acetate
(TAP medium) under complete darkness for 2 days. The nuclear (nuDNA) and
chloroplast (cpDNA) DNA levels were determined by qPCR analyses. The error bars
represent the standard error of 3 technical repeats of qPCR. Two independent
experiments showed similar results.
31
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Figure 4
The effects of redox reagents on chloroplast DNA replication in vivo. C. reinhardtii
137c mt+ cells were cultured in the photoautotrophic medium. A, The effect of
methylviologen (MV; a H2O2 producer dependent on photosystem II) on chloroplast
DNA and nuclear DNA replication. Methylviologen was added to a nonsynchronous
log-phase culture that was grown under continuous light. DNA levels in the culture 4 h
after the treatment with (MV) or without (-) methylviologen were examined by qPCR
analyses. The error bars represent the standard error of 3 technical repeats of qPCR.
Two independent experiments showed similar results. B, The effect of dimethylthiourea
(DMTU; a H2O2 scavenger) on chloroplast DNA and nuclear DNA replication. DMTU
added to synchronous culture at the end of a 12-h dark period. Nuclear and chloroplast
DNA levels in the cultures that were treated with or without DMTU for 4 h under dark
(D) or light (L) were examined by qPCR analyses. The error bars represent the standard
error of 3 technical repeats of qPCR. Three independent experiments showed similar
results. C, DAPI-staining images of cells treated with or without DMTU for 4 h under
darkness. The intensity of the fluorescent DAPI staining that overlapped with the
chloroplast red autofluorescence was measured using ImageJ. The error bars represent
the standard deviation (n=50 cells). Scale bar = 10 µm. The levels just before the
addition of the reagents (at 0 h for MV; at 12 h for DMTU) are defined as 1.0.
Figure 5
32
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
The chloroplast DNA polymerase level in the light and dark cycles. Immunoblot
analyses were performed using anti-chloroplast DNA polymerase (CrPOP) antibodies.
Twenty micrograms of proteins were separated in each lane. A, Total proteins from
asynchronous log-phase cells were detected by the CrPOP antibodies that were raised in
two rabbits. B, Aliquots of the synchronous culture were collected at the indicated
timepoints and the total proteins were separated. Level of CrPOP protein was analyzed
with the anti-CrPOP antibodies (rabbit 1), and the Rubisco large subunit (Rubisco LSU)
was detected by CBB staining as the quantitative control.
Figure 6
The effects of redox reagents on chloroplast DNA replication in isolated chloroplasts. C.
reinhardtii cw-15 cells were cultured in the photoautotrophic medium. Chloroplasts
were isolated from synchronous culture either at the end of the second dark period or
the end of the second subjective night under light (indicated by the arrowheads) and
then osmotically permeabilized in hypertonic buffer. To investigate the effects of
reducing reagents on chloroplast DNA replication activity, dithiothreitol (DTT), reduced
thioredoxin (trx), NADPH, or reduced glutathione (GSH) was added to chloroplasts
isolated from the dark culture. To investigate the involvement of disulfide bonds on the
regulation of the chloroplast DNA replication activity, diamide was added to
chloroplasts isolated from the light culture. Ethidium bromide (EtBr), which inhibits
DNA replication, was added as a negative control. Each reagent was added to the
permeabilized chloroplasts. After preincubation for 15 min, chloroplasts were further
33
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
incubated for 60 min with certain substrates (dNTP and digoxigenin-labeled dUTP).
DNA was extracted at the indicated time points and blotted onto a hybond N+
membrane, and digoxigenin, which was incorporated into the chloroplast DNA, was
detected using anti-digoxigenin antibodies. The relative levels of the incorporated
digoxigenin were plotted. The level of the culture grown under darkness at 60 min is
defined as 1.0. The error bars represent standard deviation of 3 biological replicates.
Asterisks indicate that the significant difference from the dark sample by t test (P <
0.0001).
Figure 7
The effects of redox reagents on chloroplast DNA replication in isolated chloroplast
nucleoids. Chloroplast nucleoids were isolated from synchronous culture (the isolated
time points were the same as in Figure 6). Diamide or DTT was added to chloroplast
nucleoids. After preincubation for 15 min, DNA synthesis was examined as the
incorporation of digoxigenin-labeled dUTP, as described in Figure 6. The relative levels
of the incorporated digoxigenin are plotted. The level of the culture grown under
darkness at 60 min is defined as 1.0. The error bars represent standard deviation of 3
biological replicates. Asterisks indicate that the significant difference from the dark by t
test (P < 0.001).
34
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Downloaded from on Jun
Copyright © 2013 America
Downloaded from on J
Copyright © 2013 Amer
Do
Cop
Downloaded from on June 1
Copyright © 2013 American S
Download
Copyright
Downloaded from on Ju
Copyright © 2013 Ameri
Dow
Copy