Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download extra notes chapter 1_2
Document related concepts
no text concepts found
Transcript
Review of Protein Structure A.1 Introduction There are four levels of protein structure: primary, secondary, tertiary and quaternary. The first two levels are one-dimensional while the rest are three-dimensional. In the following sections, brief descriptions of the primary and secondary structure of proteins will be presented. A.2 Primary Structure The primary structure is a sequence of amino acids obtained from the DNA sequence. A DNA sequence is composed of four types of nucleotides called adenine (A), cytosine (C), guanine (G) and thymine (T). An example of the DNA sequence is shown in Table A.1. Table A.1: Nucleotides Nucleotide Symbol DNA Sequence Example adenine cytosine guanine thymine A C G T AGGAAAAGCAGAATT Three consecutive nucleotides in a DNA sequence are called a codon, which specifies an amino acid. Table A.2 lists the 20 naturally occurring amino acids and their symbols. The codon representations of the amino acids can be found in Table A.3. An example of an amino acid sequence translated from a DNA sequence is illustrated in Figure A.1. Table A.2: Symbols of amino acids Amino Acid Symbol Alanine Cysteine Aspartic Acid Glutamic Acid Phenylalanine Glysine Histidine Isoleucine Lysine Leucine A C D E F G H I K L Amino Acid Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tryptophan Tyrosine Symbol M N P Q R S T V W Y Table A.3: DNA Codon representations of amino acids Amino Acid Tryptophan Codon TGG Amino Acid Histidine Codon CAT CAC Methionine Tyrosine ATG TAT TAC Glutamine Asparagine Cysteine Phenylalanine TGT TGC TTT TTC Lysine Aspartic Acid CAA CAG AAT AAC AAA AAG GAT GAC Isoleucine Glysine Alanine Valine Codon GAA GAG ATT ATC ATA GGT GGC GGA GGG GCT GCC GCA GCG GTT GTC GTA GTG Amino Acid Threonine Proline Serine Leucine Arginine Codon ACT ACC ACA ACG CCT CCC CCA CCG TCT TCC TCA TCG AGT AGC TTA TTG CTT CTC CTA CTG CGC CGC CGA CGG AGA AGG Amino Acid Glutamic Acid AGGAAAAGCAGAATTACTAATTACCCTAGG DNA Sequence AGG AAA AGC AGA ATT ACT AAT TAC CCT AGG K S R I T N Y P R Amino Acid R Sequence RKSRITNYPR Figure A.1: DNA to amino acid sequence translation
Related documents