Download FILAMENTOUS BACTERIOPHAGE Pf3

FILAMENTOUS
BACTERIOPHAGE Pf3
A MOLECULAR QENETIC STUOY.
чииа LUITEN
THE FILAMENTOUS BACTERIOPHAGE PF3
A MOLECULAR GENETIC STUDY
THE FILAMENTOUS BACTERIOPHAGE PF3
A MOLECULAR GENETIC STUDY
PROEFSCHRIFT
t e r verkrijging van de graad van doctor
in de Wiskunde en Natuurwetenschappen
aan de Katholieke U n i v e r s i t e i t t e Nijmegen,
op gezag van de Rector Magnificus
Prof.dr. B.M.F, van l e r s e l
volgens b e s l u i t van het College van Decanen
in het openbaar t e verdedigen
op woensdag 16 december 1987
des namiddags t e 1.30 uur precies
door
RUDOLF GIJSBERTUS MARIE LUITEN
geboren t e K e r k r a d e
T?^
drukkerij vveemen bv
haps
Promotor:
Co-Promotor:
Prof.Dr. J.G.G. Schoenmakers
Prof.Dr. R.N.H. Konings
DANKWOORD
Graag wil ik iedereen van harte bedanken die op enigerlei wijze een
bijdrage heeft geleverd aan de totstandkoming van d i t p r o e f s c h r i f t .
In het
bijzonder wil ik de studenten/ s t a g i a i r e s noemen die in het kader van hun
s t u d i e "gedwongen" waren aan d i t onderzoek mee t e werken: Peter-Paul Biermans,
Ton Beniers, Rik Eggen, Jac. Benen, Marja Timmermans, Eric Claas en Guy
Honnée. J u l l i e hulp was welkom en nodig. Mijn dank s t r e k t zich n a t u u r l i j k ook
u i t t o t al die mensen van binnen of van buiten de afdeling Molekulaire
Biologie, die mij met raad en daad hebben bijgestaan. Tevens dank ik Gerard
Dekker voor de verzorging van de fotografie en Ger Austen voor zijn hulp bij
het leren omgaan met verschillende aspekten van komputersystemen.
I would l i k e to express my g r a t i t u d e t o Diana H i l l , who generously invited me
to the MRC Laboratory (Cambridge), and taught me the l a t e s t techniques in
shotgun cloning and sequencing of l a r g e DNA molecules.
Tenslotte, overal en a l t i j d a l s l a a t s t e genoemd, wil ik mijn ouders en
n a t u u r l i j k Yvonne bedanken, voor hun steun en hulp, maar vooral voor hun
geduld, dat zo vaak op de proef i s gesteld.
CONTENTS
General Introduction
9
Chapter 1
The Major Coat P r o t e i n of t h e F i l a m e n t o u s Pseudomonas a e r u g i n o s a
Phage P f 3 : Absence of an N-Terminal Leader S i g n a l Sequence
21
Chapter 2
N u c l e o t i d e Sequence of t h e Genome of P f 3 , an IncP-1
Plasmid
S p e c i f i c F i l a m e n t o u s Phage of Pseudomonas a e r u g i n o s a
39
Chapter 3
Spontaneous D e l e t i o n Mutants of B a c t e r i o p h a g e P f 3 :
Mapping of S i g n a l s I n v o l v e d i n R e p l i c a t i o n and Assembly
61
Chapter it
I n V i t r o D e l e t i o n Mapping of t h e V i r a l S t r a n d R e p l i c a t i o n O r i g i n
of the Pseudomonas B a c t e r i o p h a g e Pf3
81
Chapter 5
Transcription Initiation and Termination Signals
on the Genome of the Pseudomonas aeruginosa phage Pf3
99
Summary
11 9
Samenvatting
125
Curriculum v i t a e
133
GENERAL INTRODUCTION
Pf3 is a filamentous bacterial virus specifically infecting Pseudomonas
aeruginosa (43). The virion is about 700 nm long and
6 nm wide, and consists
of a circular covalently closed single-stranded DNA (ssDNA) molecule
encapsulated in a long slender protein coat which is composed of at least two
different subunits. The smallest subunit is present in the virion in about
2500 copies, whereas of the largest only a few copies are present (36, 45).
These properties place Pf3 in the genus Inovirus, to which also belong the
Escherichia coli phages Ff (M13, f1, and fd), IKe, Ifl and 12-2, the
Pseudomonas aeruginosa specific phage Pf1, the Xanthomonas oryzae phage Xf,
and some other less well characterized bacteriophages (6, 11, 12, 13, I1*, 2U,
31).
Pf3 has P.aeruginosa (strain 0) harboring a broad host range plasmid of the
incompatibility group P-1 (IncP-1, e.g. RP1) as its natural host (43).
The RP1
encoded pili are essential for infection: the tips of the pili serve as an
attachment site for the phage.
The viral DNA is introduced into the host cell
most probably via a pilus retraction mechanism, similar to that of the F-pilus
(23).
In line with the broad host range character of IncP-1 plasmids
Escherichia coli containing these IncP-1 plasmids are susceptible to infection
by Pf3 as well. The infection process is however very inefficient as
illustrated by the fact that progeny Pf3 virions are only released in very
small amounts (6, 42).
Similar to the other members of the genus Inovirus, infection by Pf3 does not
cause cell death; instead progeny virus is assembled at the cell membrane and
continuously extruded through the cell wall.
Therefore the filamentous virus
must consider the appropriate balance of host and phage metabolism. After an
initial rapid increase in phage DNA and protein, the infected cells settle
into a phage producing steady state that can persist indefinitely (14, 31).
This unique property of the Inoviridae has attracted much attention,
particularly with respect to the elucidation of both the structural and the
genetic prerequisites for this parasitical life-cycle.
Until a few years ago
most if not all studies involved the F plasmid specific filamentous E.coli
phages M13, f1, and fd (Ff). Nucleotide sequence analyses have demonstrated
11
that these viruses are so closely related that they can be considered to be
variants of the same bacteriophage (4, 20, 46). Recently the life-cycle,
molecular biology and genetics of the Ff phages have been extensively reviewed
(2, 17, 38, 10, HT, 19). For this reason these aspects will be dealt with
only briefly.
Structural and genetic properties are discussed in more detail
in the chapters to follow, when comparing Pf3 with Ff.
There were and are several interesting aspects which led us to choose
bacteriophage Pf3 as an object for extensive molecular genetic analyses.
First of all, from an evolutionary point of view, it was Intriguing to answer
the question whether the observed evolutionary relationship between the
filamentous E.coll phages Ff and IKe, an N plasmid specific E.coli phage (6,
38), could be extended also to Pf3, which has another bacterial genus as its
natural host.
The structural and genetic data available for the phages Ff and IKe strongly
suggest that these viruses have evolved from a common ancestor: the
differences in their pilus (plasmid) specificity seem to be the result of
divergence and reshuffling of nucleotide sequences in the capsid protein genes
that are responsible for adsorption of the phage to the pilus tip (37, 38).
The question whether such a relation also exists for the other filamentous
phages can be answered by studying the structural and genetic organizations of
their genomes.
If the genomes are evolutionary related, then a comparison of
these genomes might reveal strongly conserved DNA or protein sequences,
thereby pinpointing regions with possible functional significance.
On the
other hand such a comparison might indicate where divergence of nucleotide or
amino acid sequences has led to acquisition of new biological properties.
It might furthermore be of interest to examine the structural similarities
between filamentous bacteriophages (29, 32, 33) and their cognate pili.
Brinton already hypothesized that conjugative plasmids might be a specialized
form of (filamentous) phage, the pilus being the remnant of the virion
particle which still functions as mediator of DMA transfer, although it does
not contain DNA (7). For at least the phages Ff and Pf1, the apparent
morphological similarity between pilus and phage has been shown to be more
than superficial.
In both cases the symmetry of the major protein
constituents of the pilus, i.e. the pilin molecules, around the pilus axis is
identical to the axial symmmetry of the major capsid proteins in the
bacteriophage filament (16, 28, 30). This symmetry matching may be one of the
12
factors that determine pilus specificity.
In addition there are remarkable parallels between the fate of pil in molecules
and the major coat protein subunits during pilus retraction and phage
infection as well as during pilus assembly and phage morphogenesis.
Particularly the fact that the major coat proteins of an infecting
bacteriophage are stored in the inner cell membrane, and subsequently are
reused for the assembly of progeny phage is strikingly similar to the fate of
pilin molecules during pilus retraction and assembly (1, 23, 42). These
morphological and functional similarities suggest that a comparative study of
the underlying genetics of filamentous bacteriophages and pilus encoding DNA
segments (usually conjugative Plasmids) might well reveal an evolutionary
relationship between these genetic elements. Alternatively, the filamentous
bacteriophages only may appear to make efficient use of an existing mechanism
both for infection and phage assembly.
Returning to the problem of defining the evolutionary relationship between
different filamentous bacteriophages, Pf3 is an attractive candidate, not only
because its natural host is P.aeruginosa, but also because it is able to
infect, though inefficiently, E.coli (6, 42). The latter property might
facilitate the comparison of structural or genetic data of Pf3 with those of
the well studied Escherichia coli specific bacteriophages Ff and IKe.
Another interesting characteristic of Pf3 is the unique structure of the
virion (5, 36, 39), and the conformational properties of its components (44,
45).
Biophysical studies have indicated that the ssDNA molecule inside the
coat envelope has an inside-out conformation (inverted DNA structure or I-form
DNA) with the bases directed outward and the phosphate groups of the backbone
pointing towards the central axis (8, 9, 34, 45). This conformation is
opposite to that observed for the Ff phages, in which the ssDNA molecule is
collapsed upon itself in an antiparallel and right handed, but non basepaired, helix-like structure stabilized by stacking interactions of the
internally localized bases (8, 9, 34, 45). To explain these findings, a very
different interaction of the coat protein molecules and the ssDNA genome
within the respective filamentous phage particles is required.
Particularly
the interaction of aromatic and charged amino acid residues with the bases and
phosphate groups, respectively, of the ssDNA molecule in
ensuring the
structural integrity of the virion particle must be completely different when
comparing Pf3 and Ff (8, 9, 22, 34, 4*1, ¿15, 47). An additional peculiarity of
13
the major coat protein of Pf3 is that it undergoes reversible and irreversible
transitions from α-helix to ß-sheet upon heating i_n vitro, a phenomenon also
observed for Xf but not for the Ff phages, IKe, or Pfl ( M ) . Because similar
conformational transitions do occur in vivo during assembly of Ff phages, the
Pf3 virion might prove to be a useful in vitro model system to study the role
of structural transitions in coat protein molecules during filamentous phage
morphogenesis.
Still another aspect which prompted us to study bacteriophage Pf3 was its host
range. The fact that Pf3 is specific for cells harboring a broad host range
IncP-1 plasmid and primarily infects P.aeruginosa might enable us to use Pf3
as a model system for studying gene expression in Pseudomonas.
Particularly
during the last decade Pseudomonas has attracted much attention in view of its
ability to metabolize a broad variety of xenobiotic compounds (10, 19, 21).
These compounds, usually man made organic chemicals which previously did not
occur in nature, have been and are being released in the environment in huge
amounts, particularly in industrialized countries.
The mineralization of
these compounds is very slow, but microorganisms have been found that are able
to perform this task rather efficiently.
Especially among Pseudomonads,
strains have been isolated that are capable of degrading various classes of
xenobiotics. Most of the enzymes involved in the catabolic pathways are
encoded by large transmissible plasmids thus allowing a rapid spread of these
capabilities in the contaminated environment. For example plasmids encoding
the degradation of n-alkanes (15), substituted or even chlorinated toluenes
and xylenes (26, 27), naphtalenes (25), and salicylates (48) have been
characterized.
Analysis of the expression of genes encoding some enzymes of
these degradative pathways by molecular cloning in E.coli has suggested that
either the signals involved in gene expression or their regulation in
Pseudomonas differs considerably from E.coli (3, 15, 18, 35, 41). In this
context genetic analysis of Pseudomonas bacteriophage Pf3 might shed light on
the nature of sequences signalling gene expression in Pseudomonas.
In
addition analysis of the Pf3 genome could lead to the construction of vector
DNA molecules able to replicate autonomously within Pseudomonas and possibly
also within E.coli.
14
The different chapters of this thesis describe aspects of the molecular
biology of the filamentous bacteriophage Pf3 relevant to one or more of the
questions raised above.
Chapter 1 deals with the localization and primary structure of the gene
encoding the Pf3 major coat protein. The structure of this gene and that of
its encoded protein product is then compared with that of the corresponding
genes and proteins of other filamentous bacteriophages.
In chapter 2 the complete nucleotide sequence of the Pf3 genome is given and a
genetic organization is postulated on the basis of two defined genes and
several observed open reading frames. Differences and similarities with the
genomes of the E.coli specific Inovirldae are discussed.
Chapter 3 describes the isolation and molecular analysis of spontaneous
deletion mutants (miniphages) of Pf3 and the implications of their structure
for the location of signals involved in DNA replication and virus assembly. In
addition a recombination mechanism is proposed to explain the generation of
the respective miniphage genomes. In this hypothesis the rolling circle
mechanism of DNA replication, in particular the single stranded DNA
intermediate, plays an important if not essential role.
In chapter Ί a more detailed study is presented regarding the location and
functional properties of the origin of Pf3 viral strand replication.
Again
the observed properties are compared with those of the equivalent signal of
the well studied E.coli specific filamentous phages.
The last chapter deals with the expression of the Pf3 genome, more
particularly with the analysis of transcription initiation and termination
functions in vivo in P.aeruginosa and both in vitro and in vivo in E.coli.
LITERATURE CITED
Armstrong, J., J. Hewitt, and R. Perham. 1983. Chemical modification of
the coat protein in bacteriophage fd and orientation of the virion
during assembly and disassembly. EMBO J. 2, 1641-1646.
Baas, P.D. 1985. DNA replication of single-stranded Escherichia coli
DNA phages. Biochim. Biophys. Acta 825: 111-139.
Bagdasarian, M., and K.N. Timmis. 1982. Host: vector systems for gene
cloning in Pseudomonas. Curr. Top. Microbiol. Immunol. 96^: 47-67.
Beck, E., R. Sommer, E. A. Auerswald, С. Kurz, В. Zink, G. Osterburg,
H. Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami.
1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res.
22: 4495-4503.
Berkowitz, S.A., and L.A. Day. 1980. Turbidity measurements in an
analytical ultracentrifuge. Determinations of mass per length for
filamentous viruses fd, Xf, and Pf3. Biochemistry _1_9, 2969-2702.
Bradley, D.E. 1981. In: Molecular biology, pathogenicity, and ecology
of bacterial Plasmids. S.B. Levy, R.C. Clowes, and E.L. Koenig (ed.),
Plenum Press, New York. p. 217-226.
Brinton, C. 1971. The properties of sex pili, the viral nature of
'conjugal' genetic transfer systems, and some possible approaches to
the control of bacterial drug resistance. Crit. Rev. Microbiol. J_,
105-160.
Casadevall, Α., and L.A. Day. 1982. DNA packing in the filamentous
viruses fd, Xf, Pf 1 , and Pf3. Nucleic Acids Res. 1_0, 2467-2481.
Casadevall, Α., and L.A. Day. 1983. Silver and mercury probing of
deoxyribonucleic acid structures in the filamentous viruses fd, Ifl,
IKe, Xf, Pf1, and Pf3. Biochemistry 22, 4831-4842.
Clarke, P.H., and M.H. Richmond. 1975. Genetics and biochemistry of
Pseudomonas. Wiley, London.
Coetzee, J.N., D.E. Bradley, R.W. Hedges, V.M. Hughes, M.M. McConnell,
L. DuT Toit, and M. Tweehuysen. 1986. Bacteriophages Folac h, SR, SF:
Phages which adsorb to pili encoded by plasmids of the S-complex. J.
Gen. Microbiol. 232, 2907-2917.
Coetzee, J.N., D.E. Bradley, R.W. Hedges, M. Tweehuysen, and L. Du
Toit. 1987. Phage tf-1 : A filamentous bacteriophage specific for
bacteria harboring the IncT plasmid pIN25. J. Gen. Microbiol. 133.
953-960.
Dai, H., S. Tsay, T. Kuo, Y. Lin, and W. Wu. 1987. Neolysogenization of
Xanthomonas campestris pv. citri infected with filamentous phage Cfl6.
Virology 156, 313-320.
14.
Denhardt, D.T., D. Dressler, and D.S. Ray (ed.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
15.
Egglnk, G., P.H. van Lelyveld, A. Arnberg, N. Arfman, C. Witteveen, and
B. Witholt. 1987. Structure of the Pseudomonas putida alkBAC operon.
J. Biol. Chem. 262, 6400-6406.
16.
Folkhard, W., D.A. Marvin, Т.Н. Watts, and W. Paranchych. 1981.
Structure of polar pill from Pseudomonas aeruginosa strains К and 0.
J. Mol. Biol. J_49, 79-93.
17.
Fulford, W., M. Rüssel, and P. Model. 1986. Aspects of growth and
regulation of the filamentous phages. Progress in Nucleic Acid Research
and Molecular Biology 33^, 141-168.
18.
Haas, D. 1983. Genetic aspects of biodégradation by Pseudomonas.
Experientia 39: 1199-1213.
19.
Harayama, S., and R.H. Don. 1985. Catabolic Plasmids: their analysis
and utilization in the manipulation of bacterial metabolic activities.
Genetic Engineering 8, 283-307.
20.
Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of
bacteriophage fi DNA. J. Virol. 44: 32-46.
21.
Huetter, R., and T. Leisinger (ed.). 1981. Microbial degradation of
xenobiotics and recalcitrant compounds. Academic Press, London.
22.
Hunter, G.J., D.H. Rowitch, and R.N. Perham. 1987. Interactions bewteen
DNA and coat protein in the structure and assembly of filamentous
bacteriophage fd. Nature 327, 252-254.
23.
Jacobson, A. 1972. Role of F pili in the penetration of bacteriophage
fi. J. Virol. 20, 835-843.
24.
Kuo, T., Y. Lin, С. Huang, S. Chang, H. Dai, and T. Feng. 1987. The
lysogenic cycle of the filamentous bacteriophage Cflt from Xanthomonas
campestris pv. citri. Virology 156, 305-31?.
25.
Lindberg, F., В. Lund, L. Johansson, and S. Normark. 1987. Localization
of the receptor-binding protein adhesin at the tip of the bacterial
pilus. Nature 328, 84-87.
26.
Lehrbach, P.R., I. McGregor, J.M. Ward, and P. Broad. 1983. Molecular
relationships between Pseudomonas IncP-9 degradative plasmid T0L, NAH,
and SAL. Plasmid W, 164-174.
27.
Lehrbach, P.R., J.Zeyer, W. Reineke, H.-J. Knackmuss, and K.N. Timmis.
1984. Enzyme recruitment in vitro: use of cloned genes to extend the
range of haloaromatics degraded by Pseudomonas sp. strain ВІЗ. J.
Bacteriol. 158, 1025-1032.
17
28.
Makowski, L., D.L.D. Caspar, and D.A. Marvin. 1980. Filamentous
bacteriophage Pfl structure determined at 7ft resolution by refinement
of models for the α-helical subunit. J. Mol. Biol. U O : 149-182.
29.
Makowski, L., and D.L.D. Caspar. 1981. The symmetries of filamentous
phage particles. J. Mol. Biol. 1jt5: 611-617.
30.
Marvin, D.A., and W. Folkhard. 1986. Structure of F pili: Reassessment
of the symmetry. J. Mol. Biol. Ij^, 299-300.
31.
Marvin, D., and B. Hohn. 1969. Filamentous bacterial viruses.
Bacteriol. Rev. 33, 172-209.
32.
Marvin, D. Α., W. J. Pigram, R. L. Wiseman, E. J. Wachtel. 1974.
Filamentous bacterial viruses 12: Molecular architecture of the class I
(fd, Ifl, IKe) virion. J. Mol. Biol. 88: 581-600.
33-
Marvin, D.A., R.L. Wiseman, E.J. Wachtel. 1974. Filamentous bacterial
viruses 11: Molecular architecture of the class II (Pfl, Xf) virion.
J. Mol. Biol. 82: 121-138.
34.
Marzee, С. J., and L. A. Day. 1983. DNA and protein lattice-lattice
interactions in the filamentous bacteriophages. Biophys. J. 4£: 171180.
35.
Mermod, N., P.R. Lehrbach, W. Reineke, and K.N. Timmis. 1984.
Transcription of the TOL plasmid toluate catabolic pathway operon of
Pseudomonas putida is determined by a pair of coordinately and
positively regulated overlapping promoters. EMBO J. 3'· 2461-2466.
36.
Newman, J., L.A. Day, G.W. Pollack, and D. Eden. 1982. Hydrodynamic
determination of molecular weight. Dimensions and structural parameters
of Pf3 virus. Biochemistry 2j_: 3352-3358
37.
Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings.
1985. Nucleotide sequence and genetic organization of the genome of the
N-specific filamentous bacteriophage IKe. J. Mol. Biol. 181 : 27-39.
38.
Peeters, B.P.H. 1985- The genome of the filamentous bacteriophage IKe.
Ph.D. Thesis, University of Nijmegen, The Netherlands.
39.
Peterson, C , G. Dalack, L.A. Day, and W.T. Winter. 1982. Structure of
the filamentous bacteriophage Pf3 by X-ray fiber diffraction. J. Mol.
Biol. 1_62: 877-881 .
40.
Rashed, I., and E. Oberer. 1986. Ff coliphages: Structural and
functional relationships. Microbiol. Rev. 50, 401-427.
41.
Sakaguchi, K. 1982. Vectors for gene cloning in Pseudomonas and their
application. Curr. Top. Microbiol. Immunol. 96^: 31-45.
42.
Smilowitz, H. 1974. Bacteriophage fi infection: Fate of the parental
major coat protein. J. Virol. J_3, 94-99.
18
43·
Stanisich, V.A. 197*1. The properties and host range of male-specific
bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 8jJ_: 3323^2.
UU.
Thomas Jr., G.J., and L.A. Day. 1981. Conformational transitions in Pf3
and their implications for the structure and assembly of filamentous
bacterial viruses. Proc. Natl. Acad. Sci. USA 78, 2962-2966.
45.
Thomas Jr, G.J., B. Prescott, and L.A. Day. 1983. Structure similarity,
difference, and variability in the filamentous viruses fd, If1, IKe,
Pfl and Xf. J. Mol. Biol. ^65: 321-356.
H6.
Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers.
1980. Nucleotide sequence of the filamentous bacteriophage M13 genome:
Comparison with phage fd. Gene П_: 129-118.
47.
Webster, R. E., and J. Lopez. 1984. In "Virus Structure and Assembly",
S. Casjens, (ed.). Jones and Bartlett Publishers, Inc. Boston, Mass.
48.
Yen, K.-M., and I.e. Gunsalus. 1982. Plasmid gene organization:
Naphtalene/salicylate oxidation. Proc. Natl. Acad. Sci. USA 79_, 874878.
49.
Zinder, N.D., and K. Horiuchi. 1985. Multiregulatory element of
filamentous bacteriophages. Microbiol. Rev. 4£: 101-106.
19
CHAPTER 1
The Major Coat Protein Gene of the Filamentous Pseudomonas aeruginosa
Phage Pf3: Absence of an N-Terminal Leader Signal Sequence
Ruud G.M. Luiten, John G.G. Schoenmakers, and Ruud N.H. Konings
Nucleic Acids Research 11, 8073-8085 (1983)
ABSTRACT
From in vitro protein synthesis studies and nucleotide sequence analysis
it has been deduced that, unlike the major coat proteins of the hitherto
studied filamentous bacterial viruses Ff (M13, fd, and fi), IKe, and Pf1, the
major coat protein of the filamentous Pseudomonas aeruginosa virus Pf3 is not
synthesized as a precursor containing a leader signal polypeptide at its Nterminal end. From the elucidated nucleotide sequence of the Pf3 major coat
protein gene it follows that the coat protein is 44 amino acids residues long
(mol.wt. 4625). No sequence homology was observed with the major coat protein
genes of either the Ff group or IKe but, similar to these phages, З'-ward of
the Pf3 coat protein gene a DNA sequence is located which has many
characteristics in common with rho-Independent transcription termination
signals.
INTRODUCTION
Filamentous
b a c t e r i a l viruses are simple models for studying processes of
molecular assembly. The viruses consist of a closed loop of
single-stranded
DNA (6000-7500 nucleotides) encapsulated in a sheath of several
thousand
i d e n t i c a l major coat protein s u b u n i t s . These molecules are of low molecular
weight c o n s i s t i n g of about 50 amino acid residues (for
a review, see ref.
5).
The ends of the v i r a l filament are distinguished by the presence of a few
copies each of one or more minor coat proteins (6, 14, 28, 29,
38).
Two s t r u c t u r a l c l a s s e s have been defined on the basis of X-ray fiber
diffraction
patterns of the virions (15, 17, 23). Class I includes the F-
s p e c i f i c filamentous b a c t e r i a l viruses Ff, the N-specific virus IKe, and the
I-specific virus I f 1 . They a l l have Escherichia coli as t h e i r h o s t . Class II
includes the viruses Pfl
and Pf3, which infect Pseudomonas aeruginosa s t r a i n s
К and 0, r e s p e c t i v e l y , and Xf,
oryzae.
which infects the plant bacterium Xanthomonas
Pf3 only i n f e c t s c e l l s which harbour
the IncP-1 s p e c i f i c broad host-
range Plasmid RP1 (31).
23
The Ff viruses M13, fd, and fi have been shown to be closely related (1,
7, 36). The DNA of these viruses reveal a mutual homology of about 97?,
clearly indicating that they are derived by mutation from a common ancestor.
Although the nucleotide sequence of the IKe genome shows a great divergence
from that of the Ff group (overall homology 45%) (22), our data nevertheless
indicate unambiguously that also IKe and the Ff viruses have evolved from a
common ancestor (21). Whether the class II viruses, with their different host
requirements, DNA compositions and probably also different phage assembly
processes, are also descendants from this common ancestor is still very
speculative.
With these considerations in mind we have initiated a study towards the
structural and genetic organization of the Pf3 genome. A different genetic
organization might underlie a different process of phage assembly at the host
cell membrane. The Ff viruses have a large number of their major coat protein
subunits inserted into the membrane. These molecules subsequently displace the
DNA-binding proteins from their intracellular complex with DNA, during
assembly and transport of the virus out of the cell. The major coat proteins
of the Ff virus group are all synthesized in the infected cell in a precursor
form (11, 37). Concomitant with deposition into the inner cell membrane a
leader peptide of 23 N-terminal amino acid residues is cleaved off (4, 37). A
similar but not identical precursor-membrane protein relationship has recently
been found for the other E.coll viruses IKe (22) and Ifl (D.Hill i G.B.
Petersen, personal communication) and the P.aeruginosa virus Pfl as well
(unpublished data), suggesting that all filamentous viruses are similar in
this fundamental aspect.
In this study we present the nucleotide sequence of the major coat protein
gene of Pf3 and its adjacent signals for transcription and translation.
Our
results demonstrate that the major coat protein of Pf3, though of low
molecular weight (44 amino acid residues), is not synthesized in a precursor
form, indicating that deposition of this protein into the host cell membrane
is determined by structural parameters different from that of the other
filamentous viruses
24
MATERIALS AND METHODS
Materials
Т^ DNA l i g a s e and the r e s t r i c t i o n endonucleases used were obtained from
Bethesda Research Laboratories.
E.coli DNA polymerase I (large fragment) was
from Boehringer AG. All enzymes were used under the conditions specified by
the suppl-ier. 2',3'-dideoxyribonucleoside t r i p h o s p h a t e s were purchased from
32
PL-Biochemicals. a- P-dATP (¡iiO Ci/mmol, 3 5 s _ s u l p h a t e (955 ci/mmol), and the
•"S and ^H-iabelled amino acids at the highest s p e c i f i c a c t i v i t y a v a i l a b l e
were obtained from Amersham. PEG-6000 was from BDH. All other chemicals were
of a n a l y t i c a l grade.
Bacteria and bacteriophages
Bacteriophage Pf3 and its host P.aeruginosa PA01, harbouring the broad hostrange plasmid RP1, were kindly provided by Dr. D.E. Bradley, St. Johns, New
Foundland. The phages M13 and IKe and their respective host bacteria were from
our own collection.
Pf3 phage growth and isolation of replicative form DNA
P.aeruginosa PA01 cells were grown in R-medium (19) until early log phase and
infected with Pf3 bacteriophages at a multiplicity of infection of 10. After
incubation for 6 hours at 370C, cells were harvested by centrifugatlon and the
Pf3 phage particles were concentrated from the supernatant by the addition of
PEG-6000 and NaCl to final concentrations of 5% and 0.5 M, respectively.
Phages were further purified by CsCl density gradient centrifugatlon in 5 mM
sodium borate, pH 9.0 (20).
Pf3 replicative form DNA (RF) was isolated from infected cells essentially as
described by Humphreys et al. (8) and subsequently purified by two successive
CsCl density gradient centrifugations.
In vivo labelling of Pf3 bacteriophages
To obtain 35s-iabelled Pf3 coat proteins a fresh plaque was resuspended in 10
ml of M9-medium containing MgClg instead of MgSO^ (12). When the culture
entered the early log phase 1 mCi of -"S-sulphate was added and the incubation
was continued overnight at 370C. Subsequently, the labelled Pf3 viruses were
isolated and purified as described above.
25
In vitro protein synthesis and analysis of the products
The procedures for the preparation of t h e DNA-dependent c e l l - f r e e protein
synthesizing system for E.coli and the techniques for SDS-polyacrylamide gel
electrophoresis and fluorography have been described previously (10).
Molecular cloning and DNA sequencing techniques
R e s t r i c t i o n enzyme cleavage maps were constructed as described
(35).
previously
Cloning of i s o l a t e d r e s t r i c t i o n fragments in the phage vectors M13mp8
and Ml3mp9 (18) was by standard methods. Sequencing of the DNA i n s e r t s was
carried out according t o the dideoxy chain-termination method developed by
Sanger et a l .
(27) using an 18 bases long single-stranded universal primer.
Nucleic acid sequences were analyzed using the computer programs written by
Staden (30).
Protein hydrophobicity was calculated according t o Kyte and
D o o l i t t l e (13).
A
1
2
MW
tkO)
46
- 52
- 4І
26
В
_
.
1
Figure 1. (A) Electrophoretio analysis of
the polypeptides present in Pf3 (lane 1) and
Ml 3 (lane 2) v i r i o n s followed by s t a i n i n g of
the gel with Coomassie B r i l l i a n t Blue.
(B) Fluorograph of 3 5 s - i a b e l l e d polypeptides
present in Pf3 v i r i o n s .
RESULTS
To gain information about the protein composition of the Pf3 virion
filament, virions were propagated in P.aeruginosa c e l l s in the presence or
absence of ^^s-sulphate. The capsid proteins were isolated from the purified
virions and subsequently s i z e - f r a c t i o n a t e d on SDS-polyacrylamide g e l s . The
proteins were visualized on the gel by s t a i n i n g with Coomassie B r i l l i a n t Blue
or with the aid of fluorographic techniques.
As shown in Fig. 1, congruent
r e s u l t s were obtained. In both cases i t was found that the Pf3 virion i s
composed of two different polypeptide chains. The major component has a
molecular weight of about ^,500,
whereas the minor protein component has an
apparent molecular weight of ¡16,000. In accordance with the nomenclature of
other filamentous phages, the major and the minor component have further been
denoted as gene VIII and gene I l l - p r o t e i n , r e s p e c t i v e l y .
In contrast to Ff
viruses (6, 14, 28, 29, 38), no evidence was obtained so far from our
e l e c t r o p h o r e t i c analysis for the presence of other minor coat proteins in Pf3
virions.
Previously we have demonstrated that the major coat protein of M13 i s
synthesized both jjn v i t r o as well as in vivo as a precursor molecule with an
extra leader or signal sequence of 23 amino acid residues at i t s aminoterminal end (36, 37). Similar observations have been made for fd and fi ( 1 ,
4, 7, 37) and quite recently also for phage IKe (22) and Pfl (R.Konings,
unpublished d a t a ) . To find out whether t h i s i s also t r u e for Pf3, or more
generally whether t h i s i s a general property of filamentous viruses, we have
investigated the major coat protein synthesis in more d e t a i l . For t h i s
purpose, protein synthesis studies were carried out in a coupled
t r a n s c r i p t i o n - t r a n s l a t i o n system of E.coli which was programmed by the
r e p l i c a t i v e form I DNA of Pf3. As shown in Fig. 2, the genome of the
P.aeruginosa phage Pf3 i s expressed e f f i c i e n t l y in the E.coli
cell-free
system. At l e a s t eleven polypeptides, ranging in s i z e from 4,500 to about
50,000, are formed, of which the smaller polypeptides are the most
predominant.
A similar p a t t e r n , in which p a r t i c u l a r l y the products of genes V
and VIII are most abundantly present, has also been obtained during our
studies on the _in v i t r o synthesis of the proteins encoded by the r e p l i c a t i v e
form DNAs of Ml 3 and IKe (9, 11, 22) (cf. Fig. 2 ) .
27
MW
1 2
3
IkD)
4
"*·
48-
12.6U7-
7.5-
-I
Figure 2. Fluorograph of ^S-methionine
labelled polypeptides synthesized in a DNAdependent _in v i t r o protein synthesizing system
of E.coli in the absence of exogenous DNA (lane
1) or the presence of the r e p l i c a t i v e form DNAs
of the phages Ml 3 (lane 2] and Pf3 (lane 3)
r e s p e c t i v e l y . In lane U ^S-labelleá
Pf3 major
coat protein was run in p a r a l l e l .
The 9 kD protein encoded by Pf3 RF comigrates on the SDS-polyacrylamide gel
with one of the major Pf3 encoded polypeptides synthesized in the infected
c e l l , t h a t p r e f e r e n t i a l l y binds to single-stranded but not to double-stranded
DNA (data not shown). The ^.5 kD protein comigrates exactly with the major
coat protein present in Pf3 v i r i o n s .
To obtain evidence whether the l a t t e r two polypeptides are i d e n t i c a l , and
thus whether they are products of the same gene, we have studied Pf3 RF
directed _in v i t r o protein synthesis in the presence of the ^Η-labelled amino
acids t y r o s i n e , p r o l i n e , and c y s t e i n e , which we knew from our amino acid
a n a l y s i s data to be absent in the Pf3 coat p r o t e i n .
As shown in Fig. 3, under
these l a b e l l i n g conditions the in v i t r o synthesis of the ^.5 kD polypeptide
can no longer be demonstrated. From these data and the observation t h a t both
proteins have i d e n t i c a l e l e c t r o p h o r e t i c m o b i l i t i e s we have concluded t h a t the
major coat protein and the 4.5 kD protein are products of the same gene and
t h a t , in c o n t r a s t to the major coat proteins of the other filamentous phages,
the major coat protein of the Pf3 v i r i o n i s not synthesized as a precursor
molecule.
The l a t t e r conclusion i s strengthened by our following observation.
I t i s well known that the _in v i t r o protein synthesizing system i s not capable
of processing primary t r a n s l a t i o n products unless signal peptidase i s
l i b e r a t e d from residual membrane fragments by the addition of non-ionic
detergent (^, 11).
Pre-addition of such compounds to the system, however, did
not a l t e r the e l e c t r o p h o r e t i c mobility of the _in v i t r o synthesized 4.5 kD
protein (data not shown).
28
MW
в
12
3
4
(kD)
48
_
12 6
-
-
97
-
-
7,5
-
Figure 3. (A) Fluorograph of the polypeptides synthesized _in vitro in the
absence (lane 1 and 3) or presence of replicative form DNA of phage Pf3 (lanes
2 and 4 ) . The polypeptides were labelled with -"s-methionine (lanes 1 and 2)
and 35s- C ysteine (lanes 3 and 4) respectively.
(B) Fluorograph of the polypeptides synthesized i_n vitro in the absence (lane
1 and 5) and presence of Pf3 RF (lanes 2, 3* a n d ^)· The polypeptides were
labelled with ^н-ргоііпе (lanes 1 and 2 ) , "S-methionine (lane 3)1 and ^Htyrosine (lanes 5 and 6) respectively. The arrows refer to the position of
migration of Pf3 major coat protein (cf. Fig. 2 ) .
To obtain information in which respect the structural and biochemical
characteristics of the Pf3 major coat protein differ from those of the major
coat proteins of the class I filamentous viruses, we have elucidated the amino
acid sequence of the Pf3 major coat protein by nucleotide sequence analysis of
its corresponding gene. To this end restriction enzyme cleavage maps of Pf3 RF
were established (Fig. 4 ) . Subsequently, the gene coding for the major coat
protein was localized with the aid of restriction fragment directed _ln vitro
protein synthesis studies (10, 11). The major coat protein gene was found to
be located on the smallest fragment obtained after cleavage of fragment Thal-B
with Hindlll (Fig. 4 ) . This fragment, which is about 410 basepairs long, was
then subcloned in the phage vectors M13mp8 and M13mp9 which had been digested
with both Hindlll and Smal. The nucleotide sequence was established by the
dideoxy chain-termination sequencing technique (27) using an 18 bases long
universal primer. The deduced nucleotide sequence of the Pf3 major coat
protein gene is presented in Fig. 5.
29
,ο«"*™-—-
Figure 4. Restriction enzyme
cleavage maps of Pf3 replicative form
DNA. The region coding for the major
coat protein and the direction of
transcription are indicated. One map
unit corresponds to 5833 basepairs.
Inspection of this sequence revealed that there is only one open reading
frame present. This sequence starts with the ATG codon at position 120 and is
132 nucleotides long (termination codon TAA at position 252). It has the
potential to code for a polypeptide which is ^
amino acids long and in which
the amino acids residues tyrosine, proline, cysteine, glutamic acid, and
asparagine are absent. The size and deduced amino acid sequence of this
protein are in excellent agreement with the molecular weight and the amino
acid composition established for the Pf3 major coat protein and with the data
from our in vitro protein synthesis studies. We therefore conclude that this
open reading frame represents the nucleotide sequence of the major coat
protein gene.
Reading in phase from the ATG start codon at position 120 in
the 5' direction the first nonsense codon (TAA) is already found at position
96 which, in turn, excludes the possibility that the major coat protein is
synthesized with an amino-terminal signal sequence of 15-30 residues as found
for the major coat proteins of other filamentous phages.
Another, though very
unlikely, candidate for translational initiation would be the GTG codon two
triplets upstream of the ATG codon. If so, the major coat protein synthesized
in vitro would clearly have been discriminated from that present in intact Pf3
virions on the SDS-polyacrylamide gel systems used. Moreover, applying the
"perceptron" algorithm derived matrix as published by Stormo et al. (32) to
distinguish translational initiation sites, unambiguously indicated that the
ATG codon is the only candidate for translational initiation.
30
aagcttgccggaaggttcaggcttgcaaattggcgggatgttatt
•
·
·
·
·
ι
gctactttccgccaccgcttggggtattcaacaaatagcccgtttacttttaaatcgtt
·
50
·
·
·
·
·
100
SD
Met Gin Ser Val Ile Thr Asp Val Thr Gly Gin
gatgaggtgtctttt ATG CAA TCC GTG ATT ACT GAT GTG АСА GGC CAA
•
·
·
·
m
150
Leu Thr Ala Val Gin Ala Asp Ile Thr Thr Ile Gly Gly Ala Ile
CTG АСА GCG GTG CAA GCT GAT АТС ACT ACC ATT GGT GGT GCT ATT
•
·
•
»
Ile Val Leu Ala Ala Val Val Leu Gly Ile Arg Trp Ile Lys Ala
ATT GTT CTG GCC GCT GTT GTG CTG GGT ATT CGC TGG АТС AAA GCG
•
•
·
·
«
200
Gin Phe Phe ***
CAA TTC TTT TGA tccgtccttgggcttttggcctcaatcgttataagggggcttc
•
250
·
·
·
·
ggctcccttattcgtttagcggctaaaatttttcaattcacggggcttttatggagatt
•
·
·
•
·
·
300
Э50
atggaatgggtctacattatttatttgggttttgtcttgcccttttttctttttccgcg
·
·
·
·
·
•»00
·
Figure 5. Nucleotide sequence of the 410 basepairs long Thal-B/HindlII
fragment encoding the Pf3 major coat protein. Numbering starts at the first
nucleotide of the Hindlll cleavage site (cf. Fig. 4 ) .
DISCUSSION
The coat of the filamentous Pseudomonas aeruginosa phage Pf3 appears to be
composed of at least two polypeptides of which the major one has a molecular
weight of 4,600, while that of the minor component is 46,000. In this respect
Pf3 resembles the other known filamentous phages which have their DNA
encapsulated in a sheath of several thousand identical coat proteins (ranging
in size from 44 to 53 amino acids) and which ends in a few copies of a high
molecular weight protein. In Ff viruses this minor coat protein (gene III
protein, mol.wt. 44,750) mediates productive infection of the virus to its
bacterial host (16, 24, 26, 39) by adsorption to the F-pilus.
We assume that
the 46 kD protein present in Pf3 virions exerts a similar function by
31
mediating adsorption of the virus to the IncP-1 encoded pili of P.aeruginosa
PA01 cells.
For the major coat proteins of the filamentous phages studied so far it
has been demonstrated that they are transmembrane proteins, and that they are
proteolytic cleavage products of precursor molecules, so called pre-coat,
containing a hydrophobic amino-termiηal leader peptide.
This signal peptide
is cleaved off by the signal peptidase concomitant with the deposition of the
mature coat protein in the inner cell membrane (U, 26). The data presented in
this study demonstrate, however, that such a deposition mechanism is not valid
for the major coat protein of Pf3. In contrast to the F and N-specific
filamentous E.coli phages, the primary translation product of the major coat
protein gene of the P.aeruginosa phage Pf3 is not proteolytically cleaved but
assembled as such in the mature virion.
To find out in how far the basic protein structure of the Pf3 major coat
protein differs from that of the class I viruses, the nucleotide sequence of
the coat protein gene was established. The amino acid sequence predicted from
the DNA sequence confirmed that the Pf3 major coat protein is only НЧ amino
acid residues long and that its real molecular weight is ^625. Moreover, the
amino acid sequence found was completely consistent with the data incorporated
in a recent report (З1*) describing the differences and similarities among
filamentous phages. When the nucleotide sequence of the Pf3 major coat protein
and its border regions is compared with the corresponding gene VIII of the
other filamentous phages, i.e. the Ff phages and IKe, it is evident that they
are completely different.
Within the coding sequence of the Ml 3 and IKe genes
several long stretches of mutual homology were noted, which is consistent with
our conclusion that these DNA genomes, though diverged considerably, are
derived from a common ancestor (21, 22). No regions of homology were found,
however, between either one of the E.coli phages and Pf3, suggesting that Pf3
virus is derived from an independent ancestral virus.
Interesting structural homology is noted 3' ward of the major coat protein
gene.
Immediately distal to gene VIII of the filamentous phages a
transcription termination signal is located, consisting of a G-C rich region,
which has the potential to form a stable stem-loop structure, followed by a
string of Τ residues (22, 25, 33). A nucleotide sequence with similar
secondary structure characteristics (Fig. 6) is found at position 285 through
314 of the Pf3 DNA sequence. Since in Pf3 infected cells several phage
specific RNA transcripts are formed, which have terminated at this site
32
τ с
T G
CG
G С
G Τ
G С
G С
(A)
G С
AT
AT
TA
AT
TCGTT
TCGTTTA
280
310
TT
T T
CG
CG
TA
CG
(В)
GС
GС
AT
AT
AT
ATACAAT
T T
1530
T T T T
1560
Figure 6. S t r u c t u r a l s i m i l a r i t y of the DNA region located 3 ' ward of the Pf3
major coat protein gene (A) and the rho-independent t r a n s c r i p t i o n termination
signal of M13 (B).
(unpublished data) we infer t h a t t h i s DNA sequence represents a P.aeruginosa
specific t r a n s c r i p t i o n termination s i g n a l .
For the F-specific filamentous viruses i t has been demonstrated t h a t
within the major coat protein a " s t o p - t r a n s f e r " sequence i s present which,
after p a r t i a l v e c t o r i a l discharge of the nascent polypeptide through the inner
c e l l membrane, i s responsible for anchoring of t h i s coat protein molecule in
the membrane. This s t o p - t r a n s f e r signal consists of a region of approximately
18 hydrophobic amino acids followed at i t s carboxy-terminal end by several
charged residues (2, 3 ) . Inspection of the Pf3 coat protein sequence i n d i c a t e s
t h a t also in t h i s molecule a region with similar c h a r a c t e r i s t i c s and probably
i d e n t i c a l function i s present (Fig. 7 ) . Which region of the Pf3 coat protein
i s responsible for i t s v e c t o r i a l discharge through the c e l l membrane i s by no
means c l e a r . I t might well be t h a t the s i g n a l s for i n s e r t i o n and s t o p - t r a n s f e r
overlap each other. If t r u e , the amino-termini of the mature coat proteins of
viruses Ff and Pf3 almost c e r t a i n l y have a different
o r i e n t a t i o n with respect
t o the cytoplasmic side of the inner cell membrane.
This in turn will have
significant
consequences for the morphogenetic reactions occurring during the
t r a n s i t i o n of the Pf3 major coat protein from the membrane-bound to the DNAbound s t a t e . With respect to the mechanism of i n s e r t i o n of the major caot
protein of Pf3 i n t o the c e l l u l a r membrane a final remark should be made.
Protein synthesis s t u d i e s have indicated t h a t approximately 'JO amino acids of
the carboxy-terminal end of the nascent polypeptide chain are contained within
the ribosome. This, together with our observation t h a t the primary t r a n s l a t i o n
33
•
¡te
•
Л
•• \
"i
Ч
"' "Ч
i
\
\
7
^-^V' ^'
/
• /
•
'
ι
'
'
VÍ79
r
.
i,
A
M13
1Λ--Λ1
^
"Vy
РІЭ
;
\и
".A
\tl
Amino ¿cid sequence number
Figure 7. Hydropathic index profiles
of the major coat proteins of IKe,
M13, and Pf3. The proteolytic
cleavage sites in the primary
translation products of gene VIII of
IKe and M13, leading to the mature
coat proteins, are indicated (arrow).
The sequences have been aligned by
their C-termini to emphasize the
similar distribution of
hydrophobicity in the proteins.
product of the major coat protein gene of Pf3 is only UH amino acids long and
that it does not contain a signal peptide, suggests that, in contrast to the
major coat protein of the Ff phage, the major coat protein of Pf3 is not
inserted into the membrane co-translationally but instead posttranslationally.
ACKNOWLEDGEMENTS
We thank Gerard Veeneman and Dr. J. van Boom, University Leiden, for the
synthesis and supply of the universal primer used in this study, and Dr.
Wilfried de Jong, University Nijmegen, for his help in the determination of
the amino acid compositions. This investigation was carried out in part under
the auspices of the Netherlands Foundation for Chemical Research (SON) and
with financial aid from the Netherlands Organization for the Advancement of
Pure Research (ZWO).
34
LITERATURE CITED
Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H.
Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978.
Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12:
4495-4503.
Boeke, J.D., P. Model. 1982. A prokaryotic membrane anchor sequence:
carboxyl terminus of bacteriophage fi genelll protein retains it in the
membrane. Proc. Natl. Acad. Sci. USA 79: 5200-5204.
Boeke, J.D., P. Model, and N.D. Zinder. 1982. Effects of bacteriophage
fi genelll protein on the host cell membrane. Mol. Gen. Genet. 186:
185-192.
Chang, C.N., P. Model, and G. Blobel. 1979. Membrane biogenesis: cotranslational integration of the bacteriophage fi coat protein into an
Escherichia coli membrane fraction. Proc. Natl. Acad. Sci. USA 76:
1251-1255.
Denhardt, D.T., D. Dressier, and D.S. Ray, (eds.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
Grant, R.A., T.C. Lin, W. Königsberg, and R.E. Webster. 1981. Structure
of the filamentous bacteriophage f 1. J. Biol. Chem. 256: 539-546.
Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of
bacteriophage fi DNA. J. Virol. 44: 32-46.
Humphreys, C O . , G.A. Willshaw, and E.S. Anderson. 1975. A simple
method for the preparation of large quantities of pure plasmid DNA.
Biochim. Biophys. Acta 383: 457-463.
Konings, R.N.H. 1973. Synthesis of phage Ml 3 specific proteins in a DNA
dependent cell free system. FEBS Letters 35: 155-160.
Konings, R.N.H. 1980. In Methods in Enzymology, L. Grossman, and K.
Moldave (ed.) 65: 795-811.
Konings, R.N.H., T.J.M. Hulsebos, and C.A. Van den Hondel. 1975.
Identification and characterization of the in vitro synthesized gene
products of bacteriophage МІЗ. J. Virol. 1_5: 570-584.
Konings, R.N.H., R. Ward, B. Francke, and P.H. HofSchneider. 1970. Gene
order of RNA bacteriophage Ml 2. Nature 226: 604-607.
Kyte, J., and R.F. Doolittle. 1982. A simple method for displaying the
hydrophobic character of a protein. J. Mol. Biol. 157: 105-132.
35
IH.
L i n , T . C . , R.E. Webster, and W. Königsberg. 1980. I s o l a t i o n and
c h a r a c t e r i z a t i o n of t h e С and D p r o t e i n s coded by gene IX and gene VI
i n t h e f i l a m e n t o u s b a c t e r i o p h a g e fi and f d .
J . B i o l . Chem. 255:
10331-10337.
15.
Makowski, L., D.L.D. C a s p a r , and D.A. Marvin. 1980. F i l a m e n t o u s
b a c t e r i o p h a g e Pfl s t r u c t u r e d e t e r m i n e d a t 7A r e s o l u t i o n by r e f i n e m e n t
:
of models f o r t h e α - h e l i c a l s u b u n i t . J . Mol. B i o l .
1J1£ І І Э - І в г .
16.
Marco, R., S.M. J a z w i n s k i , and A. Kornberg. 1 9 7 1 . B i n d i n g , e c l i p s e ,
p e n e t r a t i o n of t h e f i l a m e n t o u s b a c t e r i o p h a g e M13 i n i n t a c t and
disrupted c e l l s .
Virology 6 2 : 209-233.
17.
Marvin, D.A., R.L. Wiseman, E . J . W a c h t e l . :91^. F i l a m e n t o u s b a c t e r i a l
v i r u s e s 1 1 : M o l e c u l a r a r c h i t e c t u r e of t h e c l a s s I I ( P f l , Xf) v i r i o n .
J . Mol. B i o l . 82: 121-138.
18.
Messing, J . , and J . V i e i r a . 1982. A new p a i r of Ml 3 v e c t o r s f o r
s e l e c t i n g e i t h e r DNA s t r a n d of double d i g e s t r e s t r i c t i o n f r a g m e n t s .
Gene 1 9 : 269-276.
19.
M i l l e r , J . H . 1972. Experiments i n m o l e c u l a r g e n e t i c s . Cold S p r i n g
Harbor L a b o r a t o r y , Cold S p r i n g Harbor, NY.
20.
Newman, J . , L.A. Day, G.W. P o l l a c k , and D. Eden. 1982. Hydrodynamic
d e t e r m i n a t i o n of m o l e c u l a r w e i g h t . Dimensions and s t r u c t u r a l p a r a m e t e r s
of Pf3 v i r u s .
B i o c h e m i s t r y 21_: 3357-3358
21.
P e e t e r s , B . P . H . , R.N.H. Konings, and J . G . G . Schoenmakers. 1983.
C h a r a c t e r i z a t i o n of t h e DNA b i n d i n g p r o t e i n encoded by t h e N - s p e c i f i c
f i l a m e n t o u s E s c h e r i c h i a c o l l b a c t e r i o p h a g e IKe. J . Mol. B i o l . 169:
197-215.
22.
P e e t e r s , B . P . H . , R.M. P e t e r s , J . G . G . Schoenmakers, and R.N.H. Konings.
1985. N u c l e o t i d e sequence and g e n e t i c o r g a n i z a t i o n of the genome of the
N - s p e c i f i c f i l a m e n t o u s b a c t e r i o p h a g e IKe. J . Mol. B i o l . 1_8l: 27-39.
23.
P e t e r s o n , C , G. Dalack, L.A. Day, and W.T. W i n t e r . 1982. S t r u c t u r e of
t h e f i l a m e n t o u s b a c t e r i o p h a g e Pf3 by X-ray f i b e r d i f f r a c t i o n .
J . Mol.
B i o l . 262= 8 7 7 - 8 8 1 .
24.
P r a t t , D . , H. T z a g o l o f f , and J . Beaudoin. 1969. C o n d i t i o n a l l e t h a l
m u t a n t s of t h e small f i l a m e n t o u s c o l i phage МІЗ. I I . Two genes for coat
proteins.
Virology 3£: 4 2 - 5 3 .
25.
R i v e r a , M . J . , M.A. S m i t s , W. Q u i n t , J . G . G . Schoenmakers, and R.N.H.
Konings. 1978. E x p r e s s i o n of b a c t e r i o p h a g e Ml 3 DNA i n v i v o .
L o c a l i z a t i o n of t h e t r a n s c r i p t i o n i n i t i a t i o n and t e r m i n a t i o n s i g n a l of
t h e mRNA coding f o r t h e major capsid p r o t e i n .
N u c l e i c Acids Res. 5:
2895-2912.
26.
R ü s s e l , M., and P. Model. 1981. A m u t a t i o n downstream from t h e s i g n a l
p e p t i d a s e c l e a v a g e s i t e a f f e c t s c l e a v a g e but not membrane i n s e r t i o n of
phage coat p r o t e i n .
P r o c . N a t l . Acad. S c i . USA 7 8 : 1717-1721.
36
and
27.
Sanger, F., S. Nicklen, and A.R. Coulson. 1977. DNA sequencing with
chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7^_: 54635467.
28.
Simons, G.F.M., R.N.H. Konings, and J.G.G. Schoenmakers. 1979.
Identification of two new capsid proteins in bacteriophage M13.
Letters 106: 8-12.
FEBS
29.
Simons, G.F.M., R.N.H. Konings, and J.G.G. Schoenmakers. 1981. Genes
VI, VII, and IX of phage M13 code for minor capsid proteins of the
virion. Proc. Natl. Acad. Sci. USA 78: 1194-4298.
30.
Staden, R. 1980. A new computer method for the storage and manipulation
of DNA gel reading data. Nucleic Acids Res. 8: 3673-3694.
31.
Stanisich, V.A. 1974. The properties and host range of male-specific
bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 84^: 332342.
32.
Stormo, G.D., T.D. Schneider, L.M. Gold, and A. Ehrenfeucht. 1983. Use
of the "perceptron" algorithm to distinguish translational initiation
sites in E. coll. Nucleic Acids Res. 10: 2997-3011.
33.
Sugi moto. К., H. Sugimoto, T. Okamoto, and M. Takanami. 1977. Studies
on bacteriophage fd DNA. IV. The sequence of the messenger RNA for the
major coat protein gene. J. Mol. Biol. 110: 487-507.
34.
Thomas Jr, G.J., B. Prescott, and L.A. Day. 1983. Structure similarity,
difference, and variability in the filamentous viruses fd, If1, IKe,
Pfl and Xf. J. Mol. Biol. 1_65: 321-356.
35.
Van den Hondel, C.A., L. Pennings, and J.G.G. Schoenmakers. 1976.
Restriction enzyme cleavage maps of MI3. Existence of an intergenic
region on the M13 genome. Eur. J. Biochem. 68^: 55-70.
36.
Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers.
1980. Nucleotide sequence of the filamentous bacteriophage M13 genome:
Comparison with phage fd. Gene J_1_: 129-148.
37.
Webster, R.E., and J.S. Cashman. 1978. In : The single-stranded DNA
phages. D.T. Denhardt, D. Dressier, and D. S. Ray, (ed.). Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY. pp 557-569.
38.
Webster, R.E., R.A. Grant, and L.W. Hamilton. 1981. Orientation of the
DNA in the filamentous bacteriophage f1. J. Mol. Biol. 1_52: 357-374.
39.
Woolford, J.L., H.M. Steinmann, and R.E. Webster. 1977. Adsorption
proteins of bacteriophage fi : solubilization in desoxycholate and
localization in the fi virion. Biochemistry 16: 2694-2700.
37
CHAPTER 2
Nucleotide Sequence of the Genome of Pf3, an IncP-1 Plasmid
Specific Filamentous Phage of Pseudomonas aeruginosa
Ruud G. M. Luiten, Debra Gluck Putterman , John G. G. Schoenmakers,
Ruud N. H. Konings, and Loren A. Day
The Public Health Research Institute of The City of New York,
New York, New York 100162
Journal of Virology 5^, 268-276 (1985)
ABSTRACT
The circular, ssDNA genome of the Pf3 bacteriophage has been sequenced in
its entirety by each of two methods, the M13/dideoxy chain termination method
and the chemical degradation method.
It consists of 5833 nucleotides. With
respect to both the DNA and the protein sequences, there is virtually no
homology between Pf3 and the phages Ff (M13. f1, and fd) and IKe.
However.similarities between these phages were noted with respect to their
overall genome organizations.
The gene for the ssDNA-binding protein is
followed by the gene for the major coat protein, and then by a transcription
termination signal.
Open reading frames for seven other proteins were
predicted, and their sizes and order show a fair correspondence to the sizes
and order of the genes of the Ff phages and IKe.
In addition, several regions
have the potential of forming stem and loop structures similar to those in the
intergenic region of the Ff phage genome, but in Pf3 some are within open
reading frames.
Evolutionary relationships between Pf3 and the Ff phages and IKe are thus
apparent through the correspondence of overall gene order rather than through
primary sequence homologies.
INTRODUCTION
Pf3 i s one of the many filamentous viruses having gram-negative b a c t e r i a
as hosts (27). The v i r i o n has a length of about 700 nm and a diameter of about
6 nm (15, 17), and s p e c i f i c a l l y i n f e c t s Pseudomonas aeruginosa 0 harbouring
IncP-1 Plasmids (e.g.
RP1).
Like infection by a l l known filamentous v i r u s e s ,
Pf3 i n f e c t i o n r e s u l t s in extrusion of progeny v i r i o n s into the medium without
cell lysis.
The virion c o n s i s t s of a covalently closed single-stranded DNA
(ssDNA) molecule collapsed upon i t s e l f and held by a protein sheath made of
about 2500 molecules of a small major coat protein of only ЦЦ amino acids (6,
18, 19).
For the well studied IncF (M13, f 1, fd) and IncN (IKe) plasmid
41
specific filamentous Escherichia coll phages (for reviews see refs. 3, 16, and
30), the ssDNA genome encodes 10 proteins, 1 of which is a site-specific
endonuclease involved in DNA replication, another of which is a ssDNA-binding
protein, and 5 of which are components of the virion.
The remaining three
proteins are involved in DNA replication, phage assembly, and virus-host
interaction, but in ways that are not yet well defined.
There are both strong similarities as well as striking differences among
the various filamentous viruses, and several unique features of Pf3 make it
important in comparative studies. For example, X-ray diffraction patterns of
Pf3 (17) have shown that the helix of protein subumts in its sheath has the
same symmetry as the subunit helices of both Pf1, a phage of P. aeruginosa
(strain K) and Xf, a phage of Xanthomonas oryzae (7, 9). This symmetry is
quite distinct from that characteristic of the E. coll phages Ff (M13, f1, and
fd), IKe and Ifl (7, 10). Although Pf3 is in the same protein symmetry class
as Pfl and Xf, it has been proposed that its DNA stucture is inverted, with
phosphates in and bases out, yet quite different from an inverted or insideout DNA structure (I-form DNA) proposed for Pfl (11,19).
The uniqueness of
Pf3 is shown particularly well in that the major coat protein gene does not
encode a signal peptide (6, 18, 19). This was unexpected since it is known
that Ff-phage assembly is a membrane associated process, involving the
exchange of ssDNA-binding protein molecules for major coat protein molecules
that are embedded in the inner cell membrane.
Comparative studies of the filamentous bacteriophages logically require
investigations into the sequence organization of the phage genomes.
The
genomes of M13, fd, f1, and IKe have all been sequenced (1, 5, 16, 30). The
many unique attributes of Pf3 make it a prime choice for detailed sequence
analysis.
In this paper we present the sequence of the Pf3 genome from the
results of two independent studies by two independent methods, namely the
Sanger dideoxy method (21) based on shotgun cloning in Ml 3 phage, which was
performed in the Nijmegen laboratory, and the Maxam and Gilbert chemical
degradation method (12) applied to restriction fragments cloned in a grampositive plasmid vector system, which was performed in New York.
Both studies
yielded a sequence of 5833 nucleotides, but true differences were found at 5
positions.
42
MATERIALS AND METHODS
Bacteria and Bacteriophage.
Pf3 bacteriophage and its host P. aeruginosa (PA01) bearing the broad host
range plasmid RP1 (27) were obtained independently by both laboratories from
D.E. Bradley (Memorial University Medical School, St. Johns, New Foundland,
Canada).
Phage Pf3 was propagated and purified from single-plaque isolates
(6, 15). In each laboratory Pf3 replicative form (RF) DNA was isolated from
infected cells, albeit with somewhat more difficulty than for other
filamentous phage systems, and cloned in the respective vector systems (6, 20)
for use in the sequencing studies.
Sequencing by the dideoxy chain termination method
Preparation of recombinant DNA was performed by standard molecular biological
techniques (8). The single-stranded bacteriophage vectors Ml3mp8 and Ml3mp9
and their host E. coli JM103 have been described previously (13). The
dideoxynucleoside triphosphate chain-termination method was used essentially
as previously described (21). A synthetic deoxy-oligonucleotide primer,
5'-dGTAAAACGACGGCCAGTG-3', a sequence that is complementary to the region
directly preceding the multiple restriction sites in M13mp8 and M13mp9 was
kindly provided by Dr J. van Boom (Leiden University, Leiden, The
Netherlands).
The nucleotide sequence data were stored and handled with the
aid of computer programs developed by Staden and others (25).
Sequencing by the Maxam and Gilbert technique.
The method of Maxam and Gilbert (12) was used, with one modification used by
several laboratories: limited DNA cleavage at guanines and adenines was
accomplished by incubation of labeled DNA in 67? (wt/wt) formic acid at 20oC
for 5 minutes, with subsequent reaction steps identical to those described by
Maxam and Gilbert for limited DNA cleavage at pyrimidines.
sequence analysis was from two recombinant plasmids.
The DNA used for
One contained the
largest EcoRI fragment (3.8 kb), and the other contained the two smaller EcoRI
fragments (1.2 kb, 0.8 kb) of Pf3 DNA inserted into the cloning vector рВ021Ч
as described previously (20).
из
RESULTS
Strategies used for the M13/Sanger technique.
In collaboration with Diana Hill (University of Otago, Dunedin, New Zealand),
a genomic library of Pf3 was constructed by shotgun cloning of blunt-ended DNA
fragments into the unique Smal-site of the vectors МІЗтр
and МІЗтрЭ.
The DNA
fragments were obtained by sonication of Pf3 RF DNA, followed by repair with
ΊΗ DNA-polymerase and size fractionation on agarose gels (2). At a later
stage additional clones were obtained by restriction endonuclease digestion of
Pf3 RF DNA and ligation of the fragments into appropriately cut acceptor DNA
from the MlЗтр
and Ml3mp9 vectors.
Data obtained by nucleotide sequence analysis of all clones were entered into
the computer by using the DBUTIL program (24), which is specifically designed
for the construction of data bases from accumulating data in a shotgun
sequencing project.
At the end of the sequencing project 85% of the genome
was sequenced on both strands from at least two, but usually more than four
separate clones.
Although the nucleotide sequence of the remaining 1 5% was
derived from data from one strand only, the positions of all but 60
nucleotides were derived from at least two separate clones.
A compression at
position 4885 and 4886 could be resolved after comparison with the sequence
established in the New York laboratory.
Strategies used for the Maxam and Gilbert technique.
To provide a convenient source of pure DNA for sequencing, the three fragments
produced by EcoRI cleavage of Pf3 RF DNA were inserted into pBD2l4, a plasmid
vector of B. subtilis (20). Sequencing reactions were carried out on three
EcoRI fragments with the DNA from two clones, one containing the largest EcoRI
fragment (3.8 kb) nd the other containing the two smaller fragments (1.2 kb,
0.8 kb).
End labeling was followed by either secondary cleavage and fragment
separation, or by strand-separation on denaturing gels.
Many of the
restriction sites used were known from mapping data (18, 20), but others were
deduced from the sequence data as they were collected. Sequence data were
obtained for both strands over about 75% of the genome, and the single strand
data for the remainder were, in most cases, drawn from two or more independent
sequencing efforts. Figure 1 summarizes the strategy used and the extent of
the data obtained.
ЦЦ
-s
Hl-
1—.1
M J—ІФ
=c=i^Mfe-^H
*
5Θ13/Ι
О о
ι—t
(+)
-Lb-I 'Г
Mí"
•SE
ΟΙ
ι—f-
1 1 -S S
IX Ω I
43~
Φ4
^шимг
иι
-U-l-
l·
2065
.1 4 r - ^ M
WfT
•£=&
3298
о
υ
Lü
ж)
, > I
t-)|
4073
i
1
""
Is
— г"1I ~ ~ — t tlt
LO
if—
CO
-H !
σ
-5
о
LL
i—J
=*
ι
52S
Figure 1. Strategy for sequence analysis of the three EcoRI fragments of Pf3
by the Maxam and Gilbert sequencing technique. In each sequence, left to
right above the center line is 5' to 3' on the (+) strand, and right to left
below the center line is 5' to 3' on the (-) strand. Filled-in circles
indicate labeling sites. Lines and arrows indicate lengths of sequenced
fragments and the direction of sequencing.
Before the project was completely finished, it was learned that the Nijmegen
study was complete and results from the two laboratories were compared.
Differences were found at at ^3 positions, more than half of which were in a
300 bp region where only preliminary single-strand Maxam/Gilbert data were
available.
Completion of the sequencing in this region, as well as rereading
of gels in other regions yielded a final sequence that differed from the
Nijmegen sequence at 20 positions.
As mentioned above, two of these were
attributable to compression that affected the dideoxy results. Thirteen other
differences were C/T ambiguities in regions where only single-strand data were
available from the Maxam/Gilbert sequencing study; the sequence established in
45
Nijmegen provided the correct bases at these positions.
The 5 remaining
differences, discussed below, were confirmed by each laboratory as true
differences.
Complete sequence obtained by the two methods (with differences at five
positions)
The entire sequence of Pf3 DNA is presented in Figure 2, including the derived
amino acid sequences of the polypeptides encoded by the assigned and proposed
genes.
Differences in the results obtained by the two laboratories occur at
positions: 1618, 3679, 4380, 4696, and 5308.
Three of the five differences
cause amino acid substitutions in unidentified open reading frames.
At
position 1618, a G yields a Leu residue, whereas a Τ yields a Phe residue; at
position 4696, a Τ produces a Tyr codon, whereas а С produces a His codon; and
at position 5308, a Τ gives Val, whereas а С here gives Ala.
The C/T
difference at position 3679 is a silent change: a Pro codon is predicted in
either case.
However, Τ but not С at this position would be part of an Mael
recognition site.
Τ at position 4696, but not C, would be part of an Rsal
recognition site.
Cloning of fragments obtained by Rsal cleavage demonstrated
the presence of this Rsal site in the Nijmegen strain of Pf3.
The A/G
difference at position 4380 occurs in a non-coding region.
The base composition of Pf3 DNA (19.9% A, 21.3% C, 24.0? G, and 34.8? T)
deviates significantly from that of its host P. aeruginosa (G+C content: 60Í).
It is noteworthy that like the DNAs of the other filamentous phages (Ff and
IKe), the total base composition of Pf3 DNA has a high fraction of T.
Figure 2. Nucleotide sequence of Pf3 DNA. Numbering begins at the unique
Hindlll recognition site. Amino acid sequences for assigned genes (p78 and
p44) and orfs for seven proposed genes are shown. Stop codons are indicated by
asterisks. Differences between the New York and the Nijmegen strains are at
positions 1618, 3679, 4380, 4696, and 5308, with nucleotides and derived amino
acids for the New York strain given in parentheses.
46
S L P t G S C L Q I G C H L L L L S A T A W G I Q Q I A B L L L N B · · !
I
AAGCTTGCCCGAAGGTTCAGGCTTGCAAATTGCCGGGATGTTATTGCTACTTTCCGCCACCGCTTCCGGTATTCAACAAATAGCCCGTTTACTTTTAAATCGTTGATGACGTGTCTTTTA
too
I
pU
K g S V I T D V T G Q L T A Y Q A D I T T I G G A I I Ï L A A V V b G I R Ï I K
Tl.CAATCLGTCATTAC7GATGTGACAGGCCAACTGACAGCGGTCCAACCÏGATATCACTACCATTGGTGCTGCTATTATTGTTCTGGCCGCTCTTCÎGCTGGGTATTCCCTGGATCAAAG
'
'
200
'
[
Α
β F Γ · J
CCCAATTCTTTTGATCCGTLCTTGGGCTTTTCCCCTeAATCGTTATAAGGGGGCTTCGGCTCCCTTATTCCTTTAGCGGCTAAAATTTTTCAATTCACCGGGCTTTTATGGAGATTATGC
зов
I
[и G L H ï L Ρ G
F C L A L F S P S A I A A G P V S T t V A A G T T T Ï R Y T H T
AATGGGTCTACATTATTTATTTGCGTTTTCTCTTGCCCTTTTTTCTTTTTCCGCGATAGCTGCTGGGCCTGTTTCTACAGAGGTTGCTCCTCGTACTACTACCTATAGAGTCACCAATAC
400
'
J
T V B T P P N V T L S P V B D I T P Ï V E K I P N K G L A Q A A Q C R L I V A Q
AACCGTTCGAACTCCTCCTAATGTrACGTTGTCTCCTGTTCGTCACATTACCCCTTATGTTGAAAAGATCCCCAATAAAGGTTTGOCACAAGCTGCCCAGGGTCGTTTGATTGTrCCTCA
500
'
·
600
B A A S V P V T G F F N V S G A V V K S G A K S F L B S A G H A S G I G L G L A
ACGTGCGCCTTCTGTTCCTGTTAtTGGCTTTTTTAATGTTTCTCCCGCTGTTGTTAAATCTGGTGCTAAGTCCTTTCTTCGCTCTGCTGCAACGMCATCGGGTATAGCTTTGGGTTTGGC
700
A L L E A A D V V F D E E G E I V K P L P G C G S P V L H P B P V I L M E Y T V
GGCTCTTTTAGAAGCTGCTCATTGGGTTTrCGATGAACAAGGTGAAATAGTTAAGCCCTTACCTGGTCGTGGCAGTCC^GTTCTTATGCCTCGGCCTG-CATTCTCAATGAATACACTGT
600
T C S A C Q V a l S K E Y E F D P B S V F G V Y S Y N G N P V V V S A V E D V C
TACTGGTTCTGCTGCGCAGTGGAGTATTTCTAAACAATATGAGCCTGATCCCACCTCAGTTCCTCGATGGTATTCTTATAATGGCAATCCTGTTTGGGTTTCCCCTGTTCAAGATGTTCG
900
·
'
F T W B Ï W Y F A D V L H D G Q G B P K Ï L V A Ï S B S G P l I E Y W e D V G G Y
ATTTACTTC:CGCTACTGaTAmTGCTGACGTTTrAATGGATGGCCACGGCCGTCCTAATTA7CT"3TTGCCTATTCTGATTCTGGCCCTAA^GA3TATTC3CAGGATGTTGGGGGCTA
orf^83
S L D S L P T E P E P Y P L T D A E L E A G I D I 5 Ï Ï E P D ? D D W R 1 I I , F P Ï
ТТ(.ТиТТОАТТСТСТТСССАСТОАА!;СТОАА'ГГТііТСССТТТСАСТСАТ0СТОААСГГ0АС0.СС2"АфТ0АТ:А0ТАТТАпСАА:СТгДТССТ0АТЗА7Т0ОСаСААТТТСТТТССТТА
1100
1 200
I E P D S F T X E T P I P S L D I . 5 P V V S S S T N I f 4 ' , < : X ' T V T E T T T S
TATTGAGCCGGATAGTTTCACTATAGAAACTCCTATTCCGTCmGGACCTrCGCCTGTTGTrTCCAGrrCGACAAATAATCAGACTGGTAAAGTTAC^GTTACTCAAACCACTACCTC
l'OO
Y D F E V S D N H S S g P S I S Y I I E T T T b . H V Ï Y D G D L V S S E T N T T V
TGTTGATTTÎGAGGTTTCTCATAACAATTCTTCTCAACCTAGTATTAGCGTTAATGAAACTAC'ACCGAGAATGTTrATGTAÎA'ICTGACTTACTATCrrCTGAAACCAATAC'AC-GT
HOO
T N P P S S G T S T P P S S G S G S D F Q - P S F C S l i A T A V C D W F D W T g
TACTAATCCTCCGTCC7CTGGlACTTCAACGCCCCCATCriCTGGTTCCCG'-rCTGATTTCCA57TGCC-ACCTTTTG7-'CC-GGGCAACTGCTGTCTGTGAT"GG'n'?GATTGGACACA
1500
Ë P I D E E P D L S G I I ' D I D D M P j E R T K D I S F C S K S C P A P I A L C i
τ
φ
,
AGAACCAATTGA7GAAGAACC7GAτ7TAAGTCCCATCAT7TCAGA7A77^A GA "Tt,(T)GAACG"ACCAAAGA"A™''TCC7τ7CGCTCAAΛG7CC7G^CCTGCG:C"A7CGCATτGGA7A·
1600
E F b D M S V D L S r E V ' L E L A G I . Y F N V H A S A Y V L A A T I Î L G V
TGAAT7-C77GATATG7C7G77GATCTTICCTTTGAATCG7T77G7CAG 7τCC7CGAA7CA"A"Ά7T7TA,"CGτ7A·1'GGCAT'^TGC7TATG7CC7GGC^CC^A7ATAACC'"^GCGCG7
WOO
«
1800
V R a
(H A B b - A L V
Ï A b S . F V L K L F 7 V L G Y l . I F
Τ Y V G С Τ A l V
J
C^'7LG' , ' J ut7A l ,A 'AL"7G--'.7TJTCATTl,^TlA-GCA7T(.T CAU T " w i rTTAAAACTj-TTACTCTG«, l'i-G" ,~7CGTA77T"CAC'TAÎbTTI<GA77»ACAGLTT7 ^~K
ι
S b t - N
Α ^ ι , ν " ι « . ~ AA
orf93
-
- 3 P K i . T G L i , S t . L D l » A ' A
"ΑΑι.ι.ΑΑ~ι,»τΤ-ι^'·.ΰ^Τ'Ί.Ι
Τ іЛА"А"Ті.І" 1 аАТАТ7і.Т > . ^ - Γ Α " ^ ! , " » 7
G
ι
V ' E A b S . . J ,
*ч.АА.і." ''AT"A' r ":"G,... 1 ""\.7i,
A b L *
ТГГССАА Г^
47
FIG. 2—Conliniied
| Ν Ί
R S
I
I A L U L S
Ρ Α Ι
Υ Ρ Ρ A Ρ A S D R Ι
Τ Y
R A S I N S A K A P V G V L T · !
OTüCeTCAATCAATTCTCCTAAAGCCTTTGTGCGAGTCCTGACATCATCCCTTCAATTATTGCTTTUATGTTCTCrrTTGCTCTTSTGCCTTTTSCTTTTCCATCrGATCCACTTACGCT
I ·
2100
.
.
.
.
.
.
K H H E I D I R V A I P L V A D r C G R S V Y L G P S X q C V V S L D P D D V P
ТАААСАТСАТОАОАТТОАТАТТСОТОТТССТАТТССТТТООТТОСТОАСТТТТОТООІСОаТСТВТТОТТСТТООСССАТСТАТТСАООСТОІСвТАТСТТТАОАТТТТСАТОАТОТТСС
2200
.
.
.
.
.
.
.
.
C S Q A P D L L L E S N H L L S S N Y G D V L V I T A H O g V L N S E R K A D D
TTUCTCTCAAGCGTTTCATCTTTTGCTTGAGTCTAATCATTTGCTTTCTTCTATCGTCCGTGATGTTCTTGTTATCACTCCTATCGATCAGCTTTTAAATTCTGAACGTAAACCGGATGA
2300
.
.
.
.
.
.
.
.
.
2 4 0
I R T P B R C b P « .
A K D I E R R V I I Î I V K A S A S B Y V S I P I C E S P K S
ТТТОАСААСТТГССвССОТСАТСТТТТТААТОССААСОАТАТТОААСОСССТОТТАТСААСАТТСТТСАТОСТТСООСТТСТОАООТТОТТТСАСТОТТІАААОААТССТТСАТСТСТСІ
2500
C
A
P
G
H
S
M
T
V
D
E
R
T
N
S
V
P
A
A
L
P
S
S
P
P
P
A
L
E
S
V
i
g
A
X
D
V
P
V
0
L
R
TGATGCTCCAGGTATGTCCATGACTGTTGATGAACGGACTAACAGTGTTTTTGCTGCATTGCCTTCTTCGTTCTTCCCTGCTCTTGAGTCTGTGATTCAGGCTATTGATGTTCCGGTTCG
2600
orf/»30
Q V A I E A N V V E A S V D V S K R L G L U V C G A L S L C H V S A V T A C D L
TOAGGITGCTATrGAAGCGAAIGTGGÏTGAGGCÎTCCGTGGACTGGTCTAACCGCCTICGÎCTTAATTCGGGTOGTGCGTTATCCenGCTAATTWTCTeCTGTTACTGCTGGTGATTT
2700
.
.
.
.
.
.
S V A A G S S I G P G P L S N T L S L D G L P T A I I E R E G Î C R V V S R P T L
ОТСТСТТОСТССТССТТСТТСТАТСОСАТТТСЗТТТТТТиАОТААТАСССТТТСССТТОАТООТСТТГГТАСТССТАТООАОААТОААООСААТОСвСОТОТССТТТСАСОТССТАСС'ГР
2500
.
.
.
.
.
.
.
.
L T L D H Q S A S V L R G T E L P r Q Q S A C D C A T S V A P K H A A L S L E V
GCTGACACTGGATCGCCAATCGGCTTCTGTCCTTCGTGGTACTGAATTGCCTTATCAOCAATCTGCGGGTGATGGTGCTACCACTGTTGCTTTTAAGGATGCCGCCTTCTCCCPrGAGGT
2900
.
.
.
.
.
.
.
.
.
i o o o
9
K P Y I S P D N S I Y I E Y L V S R D S P B P S N A I D G Y P P I B T R R L Y T
ТААОССООТТАТСТСТССТОАТААТТСААТТОТТАТТСААСТОСТТОТТТСТСОТОАСТСТССТААТТТТТСАААТССТАТТОАТООТОТТССОССТАТТОАТАСАААССОССТГСТААС
3100
T r R V P H O Q T V V L G G V I S T I I I Q e C S S R Y S G I S R I P G I G R b P
TACTATTCGTGTTCCTCATOGTCAAACTGTTGTCCTGGGTGGTGTTTATTCAACTATCAATCACCAAGGTTCTTCCCGTGTTTCTGOTATTTCACGAATCCCAGGTATTGGCCGTTTGTT
3200
.
.
.
.
K K K E H V T E ' Q Ï E L L I P L T P R I L G L E Y E P E K Q S l . V P D E S P P L
CAAAAAGAAAGAACACGTTACTGAACAATATGAATTGCTCATATTTCTTACACCTACAATTCTTGCCCTTGAAGTAGAACCTGAAAAACAATCTTTCCTTTTTGATGAATCGTTTTTCCT
3300
.
.
.
.
.
.
G D L Ρ ·
ΓΗ
Ι
Τ
L
Ι
Τ A V Ρ G S
TGCTCATCTrTTTTAGCGGCTAAAATTTCTTCTATGTTÏTATGTAGTACGCÎACAACATACTACATACTACAAATCTAGOGTGGTGTGATGATTACGTTGATAACAGCGGTCCCGCGTTC
J
'
·
3400
.
.
.
.
C K T L Y A I G L I E A A L S E C R F V F T R I S G L V K D K r S Ï P H L L S D
CGGTAAAACTCTTTACGCTATACGTTTGATTGAGGCTGCCCTTTCCCAAGGGCGGCCAGTTTTCACAAACATAAGTGCCTICGTTAAGCATAAATTCTCTAATCCTCACCrrTTGTCTGA
3500
.
.
.
.
.
.
.
.
.
3 6 0 0
A P D D W R B T P E G S L Y Y Ï D E A Q Q A H L Y
Ρ(Ρ)
S R A Q R G P V T D E R L T
TGCGCCTGATGATTGCCGGGACACTCCAGAGGGATCGTTGGTGGTTTATGACCAGGCCCAGCAAGCGCACTTGTACCCÎTJTAGCAATGCCCAGCGTGGGCCGGTCACGGACGAGCGCCTAAC
3700
orf301
A M E T H R U T G H D L Y P I T e A P T P Y H H H I B K l Y C L H I H L Ï R S I Î
GGCAATCCAAACGCACCGCCATACCCCTCATGATCTCGTTTTCATTACCCACGCTCCCACGTTTGTGCATCATCACATTCGTAAGCTGCTTGGGCTCCATATCCATCiTÌATCGTTCGCG
3ΘΟ0
.
.
.
.
C L g A A S K I E V S l l Y C D S P N D R K E Q a R A D r V L V X r P K E H P A F
TGCCCTCCAAGCCGCTTrTAAGTACGAATGiAGCCATGTTTCTGArrCACCTAACCACCGGAAGGAACAACAAAGCGCTCATTICGTTCTATGGAAGTTCCCCAAAGAACATTTTCCTTT
3900
.
.
.
.
.
.
48
FIG. 2—Continued
r T S A V I I H T H K F K K F K K I C Y L L V r V V I . G L G A V C F N L Y K N S G '
TTACACCACTGCCGTTATCCACACGCACAAATTCAAGATGCCTAAGAAGATAGGTGTTCTGTTGGTTTTTCTTGTTCTCGGTCTGGGTGCTGTCCCTTTTAATCTTTATAACAATTCACC
4000
.
.
.
.
.
.
.
.
L A S N A E A T A S V A E A T P S P L A L H G V I C F S S L A A P T a V S A A A P
GCTGGCTrCGATGGCAGACCCTACCCCTTCTGTGGCAGAGGCTACCCdTCTCCCTTCeCGTTAAACGGCGTTAAACCtTCTTCCTTCGCTGCTCCCTATCACTGGTCTGCTGCGGCTCC
4100
'
'
·
·
'
'
.
.
.
•
4 г о
о
A V P V S C C V A I B S T H B C Q C P D A S C V Y L A I E H A A C L S V I S S P
TGCTGTCCCTGTGTCCGGTTGTGTTGCTAACCGTTCAACGAACCGTTGCCAATGCTTTeATGCTTCTGGTGTCGTCCTGGCGATTGAACACGCGGCCTGCCTTTCTGTTATTAGTTCGCC
1
.
'
'
'
'
'
'
4500
L P B Q L L S T S K · !
GCTTCCTCGTCAGCTTTTCAGTACCACCAACTCATTCCCGAAAGCGAGCAAAAGCCGGAA(C)CGGCTTGCCGCCGCTTGCCCCTCCCTCTTCATTAGTACTCACATATCCGTACCCTCCCCA
•·
|
·
·
'
4400
.
.
.
.
i N B C L K S r R H C r T L G T N C T E P G A K R F R C D R S T
AATCCCCATCCTTGGATCAGGTCATTTATGCGTTGTTTAAAATCCTTTCGTCATCCrrmCCCTTGGAACCAACTGCTATCAACCTCCGGCTAAACGCCCTCCGGGTGATAGGTCTACT
4500
.
.
.
.
.
.
V G G V S H C S T S R K I A P L R S I D E A K L T G H A L A L T L T V R D C P D
GTTGGTGGTTGGTCGCATGGTTCAACCAGTCGGAACATTGCTTTTTTGCGTTCCATTGATGAAGCAAAATTGACTGGTCATGCCTTGGCCTTGACGCTCACTGTTCGGGATTGTCCGGAT
4600
.
.
.
.
.
.
.
.
Τ S D D V Y(H)
X V R B A P E H R L R R l G L I R M H ï y l E W Q H R G V P I I L H C
ACTTCCGATGATTGGTtCjACAAGGTACGCCGTGCTTTTGAAATGCGTTTGCGCCGTCTTGGCTTGAICCGCATGCATTGGGTTATTGAGTGGCAACGTCGAGGGGTTCCGCACCTTCACTGC
4700
.
.
.
.
.
.
.
.
.
4 8 0 0
A A P P D D T A P A L L P A V I U R S W C D L V S D Ï H A S P L S Q r V L P I T
GCTGCrrmTTCATCACACTGCGCCTGCCTTGCTCCCTGCTG'TTATTATGCGTTCCTCGTGCGACTTGGTTTCTCACTATAATGCTTCGCCTCTTTCCCAGTACGTTTTGCCTATTACT
4900
orf278
D A I G V F Q T V S X H ' A A R G V N H Y g R S P E N I P P Q V Q K X T G R H V G
GACGCGATTGCrrGGTTTCAGTACGTCTGAAAGCATGCTGCGCCCCCTGTCAATCACTACCACCGTTCGCCCGAAAACATACCGCCGCAGTGGCACAAAAAAACCGGCCGCATCTCCCGT
5000
.
.
.
.
K Y G B W P V V E K A E I P I 1 G D A T F Ï 9 L R R I V K R W R P A D A R A S G S
AAGGTCGGTGAGTGGCCGGTGGTGGAAAAGGCTGAAATTTTCATGGGTGACCCTACGTTCTATCAGCTTCGCCGTATCGTTAAGCCCTGGCGTTTTGCTGATGCTCCGCCTTCCGCTTCC
5100
.
.
.
.
.
.
I H R i a S A K K r L Q V P E T L S R V L G A S E W K P E N E L L S I L Y P L K
ATCCATCGCATTCGATCTGCAAAAAAGTACTTGCAAGTTCCCGAAACCCTGTCTAGAGTTCTAGGTGCATCTGAATGGATGCCAGAAAATGAACTTTTGTCGATACTTTATTTTTTGAAA
.
'
5200
.
.
.
.
.
.
.
.
S
q
G
I
E
F
L
[*
l
V(A)
H H I C H P P R F H C Q L X L I . C L L I I A K A V S Y F N V G
TCTCAAGGCTATGAATTI.TTATGATTGT(C)TCACAATATCTCTCATCCGCCTCGCCCICACTGTCAGCTCAAGCTCTTATCCTTGCTCAA7CCCAAACCT3TGTCTTACTTTATGCTCG3CA
530o¡
I
.
.
.
.
.
.
.
.
.
540O
ort 7'
T D D K I E A E Y Ï Y P A D E S V A V A R P G Q P V X A Ï H T I Q S V C P H
CTGACGATAAAATCGAAGCTGACGTTTGGGTTTTTGCTGATGAATCCGTTGCTGTTGCTCGCCCAGGTCACCCTGTAAAGGCTTACCATACCATTCAATCTGTTTGCTTCCATTGACGTG
5500
ι
i K I I I Q I T F T D S Y R Q G T S A K G N P Ï T F g E G P L H L E D K P F P L
CATTTTATÜAACATTCAAATTACCTTTACCGATTCCGTCCGCCAGGCTACTTCCGCTAAACGGAATCCTTACACGrtCCAAGAACGGTTCTTGCATTTGGAAGATAAGCCCTTTCCTCTC
5600
p78
Q C Q P F V E S V I P A C S i q V P T R I N V N H G R P E L A P D F K A H X R A
САОТСССАОГГСТТТОТТСАОТСОСТСАТТССТОСССОТТСТТАТЗАООТОССйТАТСССАТТААСОТОААСААТООССОТССТСААТТСССГГТТОАТТТГАААО^С^ТОААОСгтаса
5700
.
.
.
.
.
i H i t I V C V O L V N D V C H E W A E R S D L L
TAATGA'GTTATTATCTTTÜTGTTCAGCTTGTTAATGATGTTTGTCAIGAATSCJCTGAACGTTCAGATTTGCT
1
I
'
'
'
5800
.
orf58
49
DISCUSSION
Genetic organization
To establish the organization of the genome, we first searched the viral
strand for orfs.
A schematic representation of all start and stop codons, and
consequently of all orfs is given in Figure 3.
On the basis of the arguments
presented below, we postulate that the nine orfs (orf) shown in Figures 2 and
3 are actual protein coding sequences.
It has been established previously that orf78 and orfHH are coding
sequences for the genes for the single-stranded DM-binding protein and the
major coat protein, respectively (6, 18, 19), and therefore we shall refer to
them as p78 and pUk.
In addition to the major coat protein there is a protein
of about 50 kd present in small amounts in the virion (6, 18, 19). The coding
sequence for this protein may be orf483, located 107 nucleotides downstream
from рЧЧ.
rf3
rf2
rtl
93
•' ι • Ί Ί Ι Ί ' Ί Ί Γ , Ί Ι Ι Ι ' Μ ι
5β
483
-"•Ч
1
1
I
71
1
· 4 '1 II· 'Λ λ ^ ' " . Η Ί
' ' "
430
i.' ' i ! !
И 'I
Β
|ι11
• ' "'Ί'Ι •
58
ιιιι1|
30!
!
li
1
'Ίΐ,Μη1
„•
i1,1,,"
__278
I T I
π ι
um
ιι
J
1000
ц,
L
II . Ι , Τ Β Ι Μ 1 .
|
2000
I
мм.
.ІІЛІ.І
I
3000
¡lil,
. и
|
:.|-.
:ι
ι ini
7B_
ι
L
¿.OOO
5000
Figure 3. Orfs in the Pf3 sequence. For each reading frame, the bars above
the center line represent stop codons (TAA, TAG, TGA), and the bars below
represent ATG start codons. The positions and sizes (in numbers of codons) of
the assigned and proposed genes are indicated. Orf93 starts with a GTG,
instead of a ATG, that is not indicated (see the text). It should be noted
that because the genome is circular and the total number of nucleotides is not
evenly divisible by 3, a diagram like this represents a three surface Moebius
strip; the reading frame labeled rfl continues into rf2, and rf2 continues
into rf3 etc., where nucleotide 5833 joins nucleotide 1. Orf58 merely appears
split because of our choice of the physical origin within it.
50
ι
58
The main observation was that after cleavage of Pf3 RFI at the unique Avail
site located within orf483, the resulting linear (RFIII) molecule no longer
yields, in an i_n vitro transcription-translation system, a product that comigrates with the 50 kD protein component of the virion (D. Putterman,
unpublished results).
The remaining six large orfs are orf93, orfUSO,
orf301,
orf278, orf71 , and orf58, which follow in order after orfi)83 in the 5' to 3'direction along the viral strand.
OrfSS, which lies between p78 and p44,
includes a previously proposed 22 amino acid protein in the same reading
frame; an ambiguity in the original sequence data (19) within this region was
resolved with the data from the dideoxy method.
Orf93 starts with a GTG
codon, and all others start with an ATG codon.
In addition to these considerations, the arguments which led us to
postulate that the seven unassigned orfs represent real genes, are as follows:
(i). On the basis of a preferential codon usage among all genes of a small
replicón, the FRAMESCAN computer program of Staden and McLachlan (26)
correlates the codon usage of all orfs present in a sequence with that of
assigned genes. With the codon usage of both the ssDNA-binding protein gene
and the major coat protein gene providing the basis set, strong correlations
are observed only within the orfs mentioned above.
Table 1.
Codon usage of the assigned and proposed genes of the Pf3 genome.3'
^cid
Codon
Acid
Codon
No
Acid
Codon
No
Ser
Ser
Ser
Ser
ТСГ
TCC
TCA
TCG
76
31
19
19
Тчг
"Ivr
TAT
TAC
ТЛА
TAG
37
14(13)
1
Cys
Cys
Trp
TGT
TGC
TGA
TGG
14
10
6
34
CTG
62
8
8
22
Pro
Pro
Pro
Pro
CCT
CCC
CCA
CCG
66
8
10
21
His
HIS
Gin
Gin
CAT
CAC
CAA
CAG
26
13 (14)
30
31
Arg
Arg
Arg
Arg
CGI
CGC
CGA
CGC.
43
20
5
14
lie
He
He
Mel
ATT
АТС
ATA
ATG
65
20
14
34
Thr
Thr
Thr
Thr
ACT
лес
АСА
ACG
50
26
13
16
\sn
Asn
Ivs
L-ys
ΑΛΤ
AAC
АЛЛ
AAG
45
16
30
28
Ser
Ser
Arg
Arg
Val
Val
Val
Val
GTT
GTC
G H
GTG
Ala
Ala
Ala
Ala
OCT
GCC
GCA
GCC.
96(97)
21
14
26
Asp
Asp
Glu
Glu
GAT
GAC
САЛ
GAG
80
17
63
25
Gly
Gly
Glv
Gly
Acid
Todon
No
Phe
Phe
Leu
Leu
UT
TTC
ТТЛ
TIG
61 (64)
25
19
62(61)
Leu
leu
Leu
Leu
LIT
a
ere
СТЛ
113(112)
19
7
28
No
->
лет
AGC
AG\
AGG
16
6
5
4
GGT
GGC
GGA
GGC.
77
24
9
19
Note the highly preferential use of Τ as the third base.
Numbers in parentheses are for the New York strain.
51
Table 2.
Shine/Dalgarno sequences for the assigned and
proposed genes of the Pf3 genome.3
E. coli 16S rRNA
P. aeruginosa 16S rRNA
3'-auuccuccacuag-5'
3'-auuccucuc-5'
p44 (Major coat protein)
Orf483
Orf93
Orf430
OrDOl
Orf278
Orf71
p78 (ssDNA-binding protein)
Orf58
gaugaggugucuuuuAUG
uauggagauuauggaAUG
ccugggggugguucG UG
ugugggaguccugacAUG
uguaggguggugugAUG
gaucaggugauuuAUG
cucaaggcuaugaauucuuAUG
auugaggugcauuuuAUG
caugaagcgugcguaAUG
a
P . a e r u g i n o s a and E. c o l i 16S rRNA sequences a r e from r e f e r e n c e 2 3 .
Note both t h e mutual homology among t h e sequences and t h e complementarity t o
the 16S rRNA species.
The codon usage of a l l these reading frames resembled t h a t of the Ff phages
and IKe with respect to the p r e f e r e n t i a l use of Τ (U) as the t h i r d base of the
codon (Table 1).
(ii).
Each of the nine orfs i s preceded by a Shine/Dalgarno sequence (23), as
defined by s i g n i f i c a n t homology to the 3 ' terminal nucleotide sequence of both
P. aeruginosa and E. c o l i 16S rRNA (Table 2 ) .
In a d d i t i o n , the nine orfs
ranked high when the Pf3 sequence was searched for probable i n i t i a t i o n s i t e s
by programs based on the perceptron algorithm (28, 29). In the absence of a
l i b r a r y of characterized sequences from P. aeruginosa, we used matrices
published by Stormo et a l .
(29) containing i m p l i c i t l y t h r e e consensus
sequences for i n i t i a t i o n regions spanning 51, 71, and 101 nucleotides derived
from t r a n s l a t i o n a l s t a r t s i t e s of 12^ genes of E. c o l i and Salmonella
typhimurium.
Considering only s i t e s beginning with ATG or GTG, we found the
nine proposed genes among the top 20 or so in each of the rankings based on
the t h r e e matrices. Only six or seven other positions received high rankings
by a l l t h r e e matrices, with the C-terminal 87 amino acids of orf301 and the
C-terminal 287 amino acids of огГЧЗО being especially high. The r e s u l t s give
a d d i t i o n a l confidence in the nine genes proposed and suggest the possible
existence of a few overlapping genes.
( i i i ) . The s i z e s of the polypeptides produced under the d i r e c t i o n of Pf3 RF
DNA in E. col i based coupled t r a n s c r i p t i o n - t r a n s l a t i o n systems in v i t r o
roughly support the assignments.
52
Figure 4. Comparison of orfs, genes, and non coding regions for the Pf3 and
the Ff (МІЗ) phage genomes. The maps are aligned at the major coat protein
genes.
As mentioned, the ssDNA-binding protein (p78), the major coat protein ( p W ) ,
and a presumed minor coat protein component of 50 kD, probably encoded by
orf483, have been identified with these systems.
In addition, other major
polypeptides are synthesized in these in vitro systems, which have the
apparent sizes of at least four of the proposed gene products.
Since all of these analyses ultimately led to the same results, we conclude
that the orfs of the viral strand, as presented in Figure 2, are real coding
sequences.
On the complementary strand, no reading frames larger than 115
codons are present. Of those found, none has a codon usage resembling that of
the two established genes, nor are any of the ATG and GTG codons preceded by a
Shine/Dalgarno sequence, as analyzed by the computer programs mentioned.
We
therefore conclude that only the complementary strand of Pf3 RF DNA functions
as a template for transcription. In accordance with this is the observation
that Pf3-specific mRNA hybridizes only to Pf3 RF DNA but not to ssDNA isolated
from purified virions (R. Luiten, unpublished observation).
Exclusive use of
the non-viral strand as template for transcription is characteristic of the
other filamentous bacteriophages.
Intergenic regions
It is well established that in the Ff phages and IKe there are two
principal intergenic regions (1, k, 5, ΙΊ, 16, 22, 30). One of approximately
60 bases lies just beyond the major coat protein gene in the 5'-3' direction,
whereas a larger one of approximately 500 bases (IKe 730) lies between genes
53
IV and II. Both regions are characterized by a high potential for forming base
paired stem and loop structures.
The Pf3 genome contains three small non coding regions; interestingly,
nucleotide sequences present in all of these regions can potentially form stem
and loop structures.
The first region is a sequence of 107 nucleotides
between рЧЧ and огГНбЗ, and within it is an exact inverted repeat of 10 bases
that functions as a transcription termination signal (6, 18, 19, and R.
Luiten, unpublished data).
The second non-coding region is a 72 base sequence
between orf430 and orf301 (Figures 4, 5 and 6). Beginning 9 bases from the
stop codon of orf430 are 51 bases capable of forming a stem and loop
structure.
The structure of this inverted repeat is remarkable in that each
arm of the stem consists of two direct repeats of a 7 base sequence and a
third near repeat having a modification at one position.
Four bases
downstream begins a sequence of 98 nucleotides (that extends into orf301)
capable of forming three stem and loop structures. The two-dimensional basepairing diagrams one can draw for these inverted repeats are quite similar to
those one can draw for part of the Ff intergenic region (Figures 5 and 6 ) .
Pf3
orf 276
Ff
Figure 5. Schematic representation of potential secondary structures in the
Ff intergenic region and part of the Pf3 genome from orf430 to orf278. Note
the overlap of the stem and loop structures in Pf3 with the coding region of
orf 301 .
51
Figure 6. Nucleotide sequence of the potential hairpin loops as depicted in
fig. 5. Note the occurrence of direct repeats (indicated by arrows) within
these inverted repeats.
Within orf301 starting at position 4079 there is another inverted repeat of 50
nucleotides, which is partly composed of a nearly perfect (one mismatch) 20
bases direct repeat.
The third non coding region comprises 113 bases between
orf301 and orf278. Within this region, again, an inverted repeat is observed,
in this case containing two tandem repeats of 8 and 9 bases, respectively.
Finally, we have also noticed a nearly perfect inverted repeat extending from
position 5237 through position 5283 within orf278.
Pf3 seems to be quite efficient m
the use of its 5833 nucleotides.
Non-
coding regions comprise only 5* of the genome (Ff: 8%, IKe: 11?) and
constitute five junctions between genes or orfs: the three non-coding regions
discussed in the preceding paragraph, totaling 292 bases, and two others of 10
bases each before p78 and p44, representing almost identical ribosome binding
sites (Table 2).
Four of the postulated genes have start codons that either
overlap with the stopcodon of preceding genes (orfSB, orf430, orf71), or fall
within the C-terminal coding region of the preceding gene (orf93).
Comparison with the filamentous E. coli phages.
The nearly identical Ff-phages (МіЗі fi, and fd) have been studied
intensively over the past ten years, and recently the sequence has become
available for IKe, an IncN specific filamentous E. coll phage.
The Ff and IKe
phages have an identical genetic organization and show an overall sequence
55
homology of 'JSÏ (16). The genomic sequence of Pf3 however, shows virtually no
sequence homology with any of these filamentous E. coli phages. There is,
however, similarity with respect to the overall pattern of large and small
orfs following the major coat protein gene (рЧИ) in Pf3 as compared to the
arrangement of the Ff an IKe genes following gene VIII (Figure Ό .
In
addition, similarities were detected between the secondary structure diagrams
of one of the non-coding regions of Pf3 and the intergenic region of the Ff
phages and IKe.
Differences in the genetic organization can be observed in the regions
immediately upstream and downstream from the genes coding for the ssDNAbinding proteins. In the Ff phages and IKe, the ssDNA-binding protein gene
(gene V) and the major coat protein gene (gene VIII) are separated by two
small genes (genes VII and IX), encoding minor coat proteins with lengths of
33 and 32 amino acids, respectively. In contrast, the Pf3 sequence has only
one orf of 58 amino acids between these two structural protein genes. Gene V
of Ff and IKe is preceded by two overlapping genes in the same reading frame,
namely gene II ( Ή Ο codons) and gene X (the C-terminal 111 codons of gene II),
whereas In Pf3 two separate reading frames, one of 278 codons and then one of
71 codons precede the ssDNA-binding protein gene.
As discussed above, a resemblance can be seen between hairpin structures 2
through 5 in the intergenic region of Ff and IKe and the four closely spaced
hairpins following orf^SO and overlapping orf301 in Pf3 (Figures 5 and 6).
These hairpins in Ff are involved in transcription termination, DNA
replication, and phage morphogenesis (4, It, 24,
31). There is as yet no
evidence that any of these secondary structures is functionally important for
the Pf3 genome.
However, the clustering of such structures, and the
observation that symmetric DNA sequences usually are involved in DNA-protein
interactions, strongly suggest that this region of the Pf3 genome indeed
contains such signals.
The evolutionary relationship between Pf3 and the other well studied
filamentous E. coli viruses pose interesting questions. The lack of sequence
homology, but the similarity in overall genome organization, may indicate a
divergent evolution from a common ancestor to very distantly related phages.
However, we can not at present exclude the possibility of convergent evolution
from independent ancestral viruses and/or Plasmids toward morphologically
similar phages with a gene order that may be most efficient for the life cycle
of this type of virus.
56
ACKNOWLEDGEMENTS
We thank Diana Hill, Ger Austen, Carol J. Lusty, and Roy Smith for their
assistance with various aspects of this study. Financial support for the work
in New York was through Public Health Service grant AI090H9 (L.A.D.).
LITERATURE CITED
1.
Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H.
Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978.
Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12;
Чч95-4503.
2.
Deininger, P.L. 1983. Random subcloning of sonicated DNA: Application
to shotgun DNA sequence analysis. Anal. Biochem. 129: 216-223.
3.
Denhardt, D.T., D. Dressier, and D.S. Ray, (ed.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
4.
Dotto, G.P., V Enea, and N.D. Zinder. 1981. Functional analysis of
bacteriophage fi intergenic region. Virology 114: 463-473.
5.
Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of
bacteriophage fi DNA. J. Virol. 44: 32-46.
6.
Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The
major coat protein gene of the filamentous Pseudomonas aeruginosa phage
Pf3: Absence of an N-terminal leader signal sequence. Nucleic Acids
Res. П_: 8073-8085.
7.
Makowski, L., and D.L.D. Caspar. 1981. The symmetries of filamentous
phage particles. J. Mol. Biol. 1_45: 611-617.
8.
Maniatis, T., E.F. Fritsch, and J. Sambrook. 1982. Molecular cloning. A
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
9.
Marvin, D.A., R.L. Wiseman, E.J. Wachtel. 1974. Filamentous bacterial
viruses 11: Molecular architecture of the class II (Pfl, Xf) virion.
'. Mol. Biol. 82: 121-138.
10.
Marvin, D.A., W.J. Pigram, R.L. Wiseman, E.J. Wachtel. 1974.
Filamentous bacterial viruses 12: Molecular architecture of the class I
(fd, Ifl, IKe) virion. J. Mol. Biol. 88: 581-600.
57
11.
Marzee, C.J., and L.A. Day. 1983. DNA and protein lattice-lattice
interactions in the filamentous bacteriophages. Biophys. J. >j2_·. 171180.
12.
Maxam, A.M., and W. Gilbert. 1977. A new method for sequencing DNA.
Proc. Natl. Acad. Sci. USA 7^: 560-564.
13.
Messing, J., and J. Vieira. 1982. A new pair of Ml 3 vectors for
selecting either DNA strand of double digest restriction fragments.
Gene 1_9: 269-276.
14.
Meyer, T.F., K. Geider, C. Kurz, and H. Schaller. 1979. Cleavage site
of bacteriophage fd gene II-protein in the origin of viral strand
replication. Nature (London) 278: 365-367.
15.
Newman, J., L.A. Day, G.W. Dalack, and D. Eden. 1982. Hydrodynamic
determination of molecular weight, dimensions, and structural
parameters of Pf3 virus. Biochemistry 21_: 3352-3358.
16.
Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings.
1985. Nucleotide sequence and genetic organization of the genome of the
N-specific filamentous bacteriophage IKe. J. Mol. Biol. JJLlj 2 7-39.
17.
Peterson, C , G.W. Dalack, L.A. Day, andW.T. Winter. 1982. Structure
of the filamentous bacteriophage Pf3 by X-ray fiber diffraction. J.
Mol. Biol. J_62: 877-881.
18.
Putterman, D.G. 1983. The filamentous bacteriophage Pf3: an
investigation of its genomic sequence. Dissertation, New York
University, New York, NY.
19.
Putterman, D.G., A. Casadevall, P.D. Boyle, H.-L. Yang, B. Frangione,
and L.A. Day. 1984. Major coat protein and single-stranded DNA binding
protein of filamentous virus Pf3. Proc. Natl. Acad. Sci. USA 8j_: 699703.
20.
Putterman, D.G., T.J. Gryczan, D. Dubnau, and L.A. Day. 1983. Cloning
of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa into the
PBD214 vector of Bacillus subtilis. J. Virol. 47: 221-223.
21.
Sanger, F., A.R. Coulson, B.G. Barrel, A.J.H. Smith, and B.A. Roe.
1980. Cloning in single-stranded bacteriophage as an aid to rapid DNA
sequencing. J. Mol. Biol. 1_43: 161-178.
22.
Schaller, H., A. Uhlmann, and К. Geider. 1976. A DNA fragment from the
origin of single to double strand DNA replication of bacteriophage fd.
Proc. Natl. Acad. Sci. 73: 49-53.
23-
Shine, J., and L. Dalgarno. 1975. Determinant of cistron specificity in
bacterial ribosomes. Nature (London) 254: 34-38.
24.
Smits, Μ.Α., J. Jansen, R.N.H. Konings, J.G.G. Schoenmakers. 1984.
Initiation and termination signals for transcription in bacteriophage
M13. Nucleic Acids Res. 12: 4071-4081.
58
Staden, R. 1980. A new computer method for the storage and manipulation
of DNA gel reading data. Nucleic Acids Res. Θ: 3673-3694.
Staden, R., and A.D. McLachlan. 1982. Codon preference and its use in
identifying protein coding regions in long DNA sequences. Nucleic
Acids Res. 10: 141-156.
Stanisich, V.A. 197Ч. The properties and host range of male-specific
bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. θ^_: 3323^2.
Stormo, G.D., T.D. Schneider, and L.M. Gold. 1983. Characterization of
translational initiation sites in E. coll. Nucleic Acids Res. 10:
2971-2996.
Stormo, G.D., T.D. Schneider, L.M. Gold, and A. Ehrenfeucht. 1983. Use
of the "perceptron" algorithm to distinguish translational initiation
sites in E. coli. Nucleic Acids Res. 10: 2997-3011.
Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers.
198O. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome:
Comparison with phage fd. Gene 1_1_: 129-148.
Webster, R.E., and J. Lopez. 1984. In "Virus Structure and Assembly",
S. Casiens, (ed.). Jones and Bartlett Publishers, Inc. Boston, Mass.
CHAPTER 3
Spontaneous Deletion Mutants of Bacteriophage Pf3:
Mapping of Signals Involved in Replication and Assembly.
Ruud G.M. Luiten, Rik I.L. Eggen, John G.G. Schoenmakers,
and Ruud N.H. Konings.
DNA 6, 129-137 (1987)
ABSTRACT
Defective deletion mutants, !_·£.
miniphages, spontaneously a r i s e during
s e r i a l propagation of the filamentous bacteriophage Pf3.
They contain a
circular single-stranded (ss) DNA molecule, which i s up to 80Ï smaller than
the wildtype ss genome.
Analysis of the genomic s t r u c t u r e of three of these
miniphages revealed that they consisted of sequences, t h a t in the wildtype
genome are flanked by d i r e c t repeats, which are 5-8 nucleotides long; only one
copy of these repeats was found again in the miniphage genome.
One miniphage
genome contained a tandemly duplicated sequence, and from i t s s t r u c t u r e i t
could be concluded that the duplication had occurred after a primary deletion
event.
In the duplication process, also short direct repeats must have been
involved.
I t i s concluded that the deletion and duplication events have
occurred via an i d e n t i c a l recombination process, probably via the "slipped
mispai ring" mechanism.
Because, in the presence of helper functions, the three miniphage genomes are
replicated and assembled into ssDNA containing v i r u s - l i k e p a r t i c l e s , i t i s
concluded that the assembly signal and the r e p l i c a t i o n origins for v i r a l and
complementary strand synthesis are located within the region shared by a l l
three miniphage genomes, _i.e.
nucleotides 4092 through 4678 of the wildtype
genome (Luiten, R.G.M., Putterman, D.G., Schoenmakers, J.G.G., Konlngs,
R.N.H., and Day, L.A. 1985.
J. Virol. 56, 268-276).
INTRODUCTION
The Pseudomonas aeruginosa specific bacteriophage Pf3 belongs to the c l a s s
of filamentous viruses (Inoviridae) (27).
These viruses contain a c i r c u l a r , covalently closed, single-stranded (ss) DNA
genome encapsulated in a long slender protein coat consisting of about 3000
identical protein subunits and a few copies of other phage encoded p r o t e i n s .
63
Figure 1. Genetic organization of the Pf3
genome. СепеЧЧ and gene78 encode the major
coat protein and the ssDNA-binding
protein, respectively. The assignment of
the other genes/orfs has been discussed
previously (17).
The length of the filament is virus specific and varies from 700 to 2000 nm
(for a review see ref. 5). For adsorption and host cell penetration
filamentous phages are dependent on specific, usually conjugative plasmid
encoded, pili present at the surface of the host cell.
After productive
infection, progeny virions are continuously produced by viable and reproducing
bacteria, carrying the phage genome in a double-stranded (ds) replicative
form.
The complete nucleotide sequence and part of the genetic organization of
the Pf3 genome have been established (Fig. 1) (16, 17, 25). Despite the fact
that the genetic organization of Pf3 is similar to that of the well known Fspecific (Ff: K e .
M13, fd, fi) and N-specific (IKe) filamentous Escherichia
coli phages, the lack of nucleotide sequence and amino acid sequence
homologies forces one to conclude that Pf3 and Ff or IKe are not evolutionary
related.
Currently we are interested in identifying the cis and trans-acting
elements involved in Pf3 DNA replication and virus assembly.
For this
purpose, we have analyzed the genomic structure of viable, spontaneous
deletion mutants, or miniphages, of Pf3.
For Ff phages, the structural analysis of spontaneous deletion mutants has
been of great help for the localization of the signals involved in DNA
replication and phage assembly.
The genomes of these miniphages consist of
only a minor part (about 25?) of the wt genome, which during propagation is
assembled into an equally shortened filamentous particle. Without exception,
64
these miniphage genomes contain the large non codogenic or intergenic region
(IR) located between genes IV and I I of the Ff genome (8, 11, 12).
Within
t h i s region a l l c i s - a c t i n g elements required for complementary and v i r a l
strand synthesis (the (-) and ( + ) - o r i g i n , r e s p e c t i v e l y ) , and virus assembly
are located (30).
Replication and assembly of miniphages i s possible only, if
t r a n s - a c t i n g protein functions are provided by a helper v i r u s .
We have found
t h a t , similar to the Ff phages, Pf3 miniphages accumulate after multiple
passages of wt Pf3 phage at high m u l t i p l i c i t i e s of i n f e c t i o n .
In t h i s paper the properties and genomic s t r u c t u r e s of three different
Pf3
miniphages are described, and a mechanism for the origin and evolution of t h i s
type of mutants i s proposed.
The significance of the miniphage genomic
s t r u c t u r e s for the position of the c i s - a c t i n g elements required for Pf3 DNA
r e p l i c a t i o n and virus assembly, will be discussed.
MATERIALS AND METHODS
B a c t e r i a and phages:
Pf3 virus and i t s host P. aeruginosa PA01[RP1], o r i g i n a l l y obtained from D.E.
Bradley (St.Johns, New Foundland), were from our own stock.
Bacteria were
grown in 2xYT medium (20), containing
2 mM CaClj for e f f i c i e n t phage adsorption and propagation.
Pf3 virus and miniphage were i s o l a t e d from the c u l t u r e supernatant as
described ( 1 6 ) .
Sucrose density gradient centrifugation:
To purify miniphage, phage suspensions were loaded onto a linear sucrose
gradient (5-20$), and centrifuged for 16 hr at 25 krpm (^C)
SW28.II rotor.
in a Beekman
Fractions were collected from the bottom of the tube and
monitored with the aid of a LKB Uvicord at 25^ nm.
Peak fractions were pooled
and recentrifuged under identical conditions in a SW28.I rotor.
65
DNA purification and analysis:
ssDNA was isolated from purified virions or miniphages as described (16).
dsDNA was isolated from infected cells according to procedures given
previously (16, 17).
Miniphage dsDNA was separated from wt Pf3 dsDNA by electrophoresis on 1?
agarose gels followed by electro-elution of the miniphage DNA band from the
ethidiumbromide stained gel (18).
Restriction fragments were recovered by electro-elution after separation on 5%
Polyacrylamide gels.
Southern blotting was performed by standard methods (18).
DNA sequences were determined by cloning of restriction fragments in the
sequencing vector Ml3mp8 (19). using the dideoxy chain termination method as
described (17).
Enzymes and biochemicals:
All enzymes were obtained from Bethesda Research Laboratories, New England
Biolabs, or Boehringer Mannheim, and used as recommended by the supplier.
The
sources of all other biochemicals and reagents have been given previously
(16).
RESULTS
Detection and cloning of miniphages
During our studies on the structure and genetic organization of the genome
of the filamentous P.aeruginosa phage Pf3t a dsDNA preparation from infected
cells was obtained, in which, as analyzed by agarose gel electrophoresis,
besides wt Pf3 dsDNA considerably smaller, circular, covaiently closed dsDNA
molecules were present.
These small dsDNA molecules were not found in DNA
preparations isolated from uninfected P.aeruginosa cells.
66
Pf3
rf
^А^
ss ss'' rf
Г
2
3
Д
^BN
ss
ss rf
5
6
7
^Ç4
SS
8
ss
rf ss
9
10 11
Figure 2. Agarose gel analysis of ssDNA, isolated from three different Pf3
miniphage stocks (A, B, and C), and of dsDNA isolated from cells infected with
these stocks. Lane 1, wt Pf3 dsDNA isolated from Pf3 infected P. aeruginosa
cells; lane 2, wt Pf3 ssDNA isolated from Pf3 virus particles; lanes 3, 6, and
9, ssDNA isolated from the plaque-purified Pf3 miniphage stocks A, B, and C,
respectively; lanes 4, 7, and 10, dsDNA isolated from cells infected with Pf3
miniphage stocks A, B, and C, respectively; lanes 5, 8, and 11, ssDNA isolated
from filamentous particles produced by the infected cells of lanes 4, 7, and
10, r e s p e c t i v e l y
Historical tracing of the Pf3 phage stock, used for infection, revealed that
it was obtained by serial passage of the wt virus at high multiplicity of
infection, without intermediate plaque purification. Analysis of this stock by
sucrose density gradient centrifugation, followed by the isolation of ssDNA
from the pooled peak fractions, revealed that it already contained filamentous
particles and ssDNA molecules, which were smaller in size than the wt Pf3
viruses and the wt Pf3 ss genome, respectively.
On the basis of these observations we hypothesized that, similar to Ff
(11, 12). during the infection cycle of Pf3, deletion mutants of the wt
genome were generated. With the aid of helper functions delivered by the wt
genome, these deletion mutants are replicated, and subsequently packaged into
equally shortened filamentous particles: miniphages.
To obtain evidence that this hypothesis was correct, and to acquire
information about the structure of the genomes of these miniphages, we have
studied the properties and genetic content of a number of the Pf3 deletion
mutatin more detail.
To this end several miniphages were cloned via
plating of serial dilutions of the miniphage containing Pf3 stock on
P.aeruginosa [RP1].
After incubation overnight, the bacteria of 24 randomly
67
в
1
2
3
Д
Figure 3· P u r i f i c a t i o n of Pf3 miniphage A via centri fugati on through 5-20%
sucrose density gradients. A. Absorption p r o f i l e s of the sucrose gradients as
monitored at 254 nm. For each peak, the pooled f r a c t i o n s are i n d i c a t e d .
I. P r o f i l e of the f i r s t centrifugation s t e p . I I . P r o f i l e obtained after
r e c e n t r i f u g a t i o n of the slow sedimenting f r a c t i o n from I . I I I . Profile
obtained after r e c e n t r i f u g a t i o n of the f a s t sedimenting f r a c t i o n from I .
B. Gelelectrophoretic a n a l y s i s of the ssDNA i s o l a t e d from the pooled sucrose
gradient f r a c t i o n s (Fig. ЗА). Lane 1, wildtype Pf3 ssDNA; lane 2, ssDNA
i s o l a t e d from the Pf3 phage stock containing miniphage A; lane 3> ssDNA
i s o l a t e d from pooled f r a c t i o n s of gradient 3A-II; lane 4, ssDNA i s o l a t e d from
pooled f r a c t i o n s of gradient 3A-III.
selected plaques (which in fact are zones of retarded b a c t e r i a l growth) were
s e p a r a t e l y propagated in 10 ml of 2xYT medium. Analysis on agarose gels of the
DNA molecules i s o l a t e d from t h e infected c e l l s and from secreted filamentous
p a r t i c l e s revealed t h a t in t h r e e c u l t u r e s a mixed population of miniphage was
present, while in
t h r e e others a s i n g l e species of miniphage was found. The
l a t t e r miniphages were plaque purified once more and the r e s u l t i n g miniphage
stocks A, B, and С (see Fig. 2) have subsequently been used for the i s o l a t i o n ,
on a preparative s c a l e , of miniphage s p e c i f i c ss and ds DNA.
68
Purification of miniphage particles
To study the properties of the miniphage particles, the phage stocks were
analyzed with respect to particle size, infectivity, and DNA content.
Separation of wt and miniphage particles was performed with the aid of sucrose
density gradient centrifugation (Fig. ЗА) (8). Subsequently the number of
plaque forming units (pfu), present in the original phage stock and in the
peak fractions was established. The results indicated that more than 99% of
the recovered pfu was associated with the fast sedimenting fraction.
Inspection of the ssDNA content of the particles present in each peak fraction
revealed the exclusive presence of wt Pf3 ssDNA in the fast sedimenting
particles, whereas only miniphage ssDNA could be detected in the slow
sedimenting particles (Fig. 3B). The particles of both fractions were
indistinguishable from each other or from wt Pf3, with respect to the UV
absorption profile and protein composition (16, 25, data not shown).
Thus,
although significantly smaller, miniphage particles apparently are
morphologically and structurally similar to wt Pf3 virions.
Structure of miniphage genomes
Mapping and sequencing strategy
Initial analysis of the miniphage genomes was performed by comparison of
restriction fragment patterns of purified miniphage and wt Pf3 dsDNA (cf.
Fig. 4).
Generally with the exception of only one fragment, all miniphage DNA
fragments comigrated with a subset of wt Pf3 fragments.
Hybridization of
3 P-labeled miniphage DNA to wt Pf3 restriction fragments, bound to
nitrocellulose, revealed first, that the fragments with the same
electrophoretic mobility were identical, and second that miniphage DNA was
derived from a contiguous region of the wt Pf3 genome.
In all cases these
techniques enabled us to establish unambiguously from which region of the wt
Pf3 genome the miniphage DNAs were derived (see below).
To establish the
exact extent of the deletion in the wt Pf3 genome, miniphage DNA fragments,
which did not comigrate with any of the wt Pf3 DNA fragments, were isolated,
cloned in Ml3mp8 and subsequently sequenced.
The rationale behind this
approach was that this fragment was presumed to have been generated by fusion
of the borders of the deletion, thereby creating a unique fusion or
69
1
2
3
Д 5
6
7
8
Figure 1. Restriction
enzyme digestion patterns of
the dsDNA of wt Pf3 (lanes
1, 4, 7), and of rainiphages
A (lanes 2, 3), В (lane 8),
and С (lanes 5, 6) digested
with Hpall (lanes 1 , 2 ) ,
Sau3A (lanes 3, 4, 5), and
Haelll (lanes 6, 7, 8),
respectively. Miniphage DNA
fragments that are not
identical to wildtype Pf3
DNA fragments (see text) are
indicated with asterisks.
"circularization" sequence.
Following this strategy, the genomic structure of
the three different miniphages could be established.
The genome of miniphage A
As deduced from different restriction enzyme digestions, the genomic structure
of miniphage A appeared to be fairly simple: most digests contained a only one
fragment, which did not comigrate with a wt Pf3 DNA fragment.
One enzyme,
i.e. Hpall, produced only fragments that comigrated with and hybridized to the
same subset of wt Pf3 fragments (Fig. 4), indicating that both the begin- and
endpoint of the deletion was located within or very close to a Hpall
recognition site.
Sequence determination of the single non-comigrating Sau3A
fragment (Fig. 4) revealed that the fusion point was formed by the sequence
TCCGG.
Interestingly, this sequence was found to be present in the wt Pf3
genome as a direct repeat on both sides of the DNA sequence (nucleotides 3^84
to 4673, 1-е.
1190 bp) preserved in miniphage A DNA.
In the genome of
miniphage A, one copy of this repeat sequence linked nucleotides 3484 and 4673
of the wt Pf3 genome (Fig. 5, Table 1). In addition the direct repeat
included the recognition sequence for Hpall, thus explaining the results of
the initial mapping experiments.
70
Figure 5.
Schematic presentation of the origin of the genomes of miniphage A,
B, and C. The regions of the wt Pf3 genome from which the respective
miniphage DNAs are derived, are indicated. Numbers refer to the nucleotides in
the wt genome that are fused.
—I
The genome of miniphage В
Miniphage В DNA also proved to be a simple deletion mutant of Pf3: the major
part consisted of nucleotide sequences found to be present in the genome of
miniphage A. Cloning and sequencing of the single
non-comi grating НаеІІІ fragment (Fig. H) revealed that in the genome of
miniphage B, the oligonucleotide GGGTTCCG linked nucleotides 3^83 and 4780
(i_.e. 1297 bp) of the wt Pf3 genome.
Again the sequence, preserved in the
genome of miniphage B, is flanked in the wt Pf3 genome by a direct repeat of
the circularization sequence (Fig. 5, Table 1).
The genene of miniphage С
The genomic structure of the third miniphage turned out to be more complex
than that of the miniphages A and B.
Southern blot analysis indicated that
this DNA consisted of nucleotide sequences, which in the wt Pf3 genome were
located between nucleotides 4000 and 5000. The electrophoretic mobility of
miniphage С DNA on 1Í agarose gels (Fig. 2) as well as the sum of the lengths
of the restriction fragments (Fig. 4) indicated however, that the genome of
miniphage С was about 500 bp larger. Furthermore, the restriction endonuclease
Bgll, which has only two recognition sites in wt Pf3 DNA, cleaved miniphage С
dsDNA into three fragments.
These rather peculiar results might be explained
in two different ways: either the genome of miniphage С consists for a part of
sequences which are not Pf3-specific, or it consists of Pf3 sequences, that
are partially present in a multimeric form.
To distinguish between these alternatives, the genome of miniphage С was
sequenced in its entirety via cloning all Haelll and Sau3A fragments (Fig. 4)
in Ml3mp8 (19). The data obtained, unambiguously proved that the genome of
miniphage С consisted exclusively of Pf3 specific sequences, and that part of
these sequences was present in a tandemly duplicated form. The "core" sequence
was shown to be derived from positions 4099 to 5010 of the wt Pf3 genome,
which is in accordance with the results of the hybridization experiments.
The
tandemly duplicated part was 586 bp long, and encompassed positions 4092-4412
and 4746-5010 of the wt Pf3 genome (Fig. 5).
Similar to the genomes of the miniphages A and B, the "core" sequence of
miniphage С DNA, was flanked in the wt Pf3 genome by a 7 bases direct repeat
sequence TGGCAGA.
Only one copy of this repeat was found again in the genome
of miniphage C, linking nucleotides 4099 and 5010 (Fig. 5, Table 1).
Interestingly, the circularization sequence and its flanking regions were
72
found in the DNA segment of the miniphage С genome, that is tandemly
duplicated.
This observation unambiguously proved that the duplication event
must have occurred after formation of the primary fusion between nucleotides
4099 and 5010, leading, as depicted in Fig. 5, to the precursor molecule
"pre-MiniC".
Inspection of the nucleotide sequence of the pre-MiniC molecule
revealed that also the region to be duplicated (nucleotide 47^6 to nucleotide
4406, including the primary fusion between nucleotides 5010 and 4099) was
flanked on both sides by a direct repeat of the sequence CTTGAT; only one copy
of this sequence was found to be present at the fusion sequence located
between the duplicated segments (Fig. 5, Table 1).
Table 1. Repetitive sequences in the wildtype genome that border the DNA
regions, preserved in the genomes of the miniphages A, B, and С (pre-mini-C).
MiniA
МІПІВ
3484
4673
I
I
TCCGG == 1190 bp == TCCGG
3483
4780
I
I
GGGTTCCG == 1297 bp -= GGGTTCCG
4099
pre-Mini-C
MiniC
5010
I
I
TGGCAGA == 912 bp =- TGGCAGA
4746
5010
4099
4406
I
I
I
I
CTTGAT = 272 bp = TGGCAGA = 307 bp = CTTGAT
Also included is the sequence that in pre-mini-C borders the DNA region, found
to be duplicated in the miniphage С genome.
73
DISCUSSION
Because of the lack of nucleotide sequence homology between the genomes of
Pf3 and the E.coli specific filamentous bacteriophages Ff and IKe (3, 13, 17,
22, 29) and the unknown requirements of the Pf3 specific DNA replication
system, an identification of the cis-acting DNA elements involved in Pf3 DNA
replication and phage assembly was a priori not possible.
For this reason,
other routes needed to be employed to map these functional elements.
In this paper the properties and genomic structures of three spontaneous
deletion mutants (miniphages) of Pf3 are described.
The data indicate that
these miniphages are functionally comparable to the Ff miniphages previously
described (8, 11, 12). Furthermore, the molecular structure of Pf3 miniphages
answers several fundamental questions with respect to the mechanism by which
the deletions are generated, and adds new information about sequence
duplications that might follow a primary deletion event.
In addition the
structural data allow a localization of the Pf3 specific cis-acting elements
involved in the processes of viral and complementary strand synthesis, and
phage assembly.
Location of signals involved in Pf3 DNA replication and virus assembly.
Within the genomes of the single-stranded DNA bacteriophages two
replication origins are located: one origin, the complementary or
(-)-strand origin, is required for efficient conversion of ssDNA into dsDNA,
while the other, the viral or (+)-strand origin, is essential for initiation
of viral strand replication via a rolling circle mechanism (2, 30).
The properties of the three different Pf3 miniphages, together with the
DNA sequence data of their genomes, unequivocally indicate that both the (-)strand origin and the (+)-strand origin of Pf3 are present on the miniphage
genomes.
Furthermore, the observation that miniphage ssDNA is efficiently packaged into
virus-like filamentous particles indicates that the miniphage genome harbors
the DNA sequences required for phage morphogenesis. The functional
significance of such a signal for the assembly of the Ff phages and IKe has
been well documented (6, 24).
74
В
Figure 6. A. Region of the wildtype Pf3
genome, that is shared by all three
miniphage DNAs. B. Sequences within the
"common region" that have the potential
to form stable stem-loop structures (see
text).
The fact that the above mentioned DNA elements must be present on all three
Pf3 miniphage genomes delimits their location within the sequence shared by
all miniphage DNAs, i.e. between position 4092 and position 4678 of the wt Pf3
genome (Fig. 6). This sequence includes a non-coding region of the wt Pf3
genome, but does not contain the sequences previously suggested to be involved
in these processes (17). Аз depicted in Fig. 6, within this region several
sequences of dyad symmetry (palindromes) are present.
As is known for the Ff
phages, IKe, and other systems (21, 24, 30), DNA-protein interactions often
are mediated by palindromic sequences on the target DNA.
We therefore suggest
that at least some of the palindromes, indicated in Fig. 6, are involved in
Pf3 DNA replication and virus assembly.
A more detailed analysis of this DNA
region with the aid of in vitro deletion mapping techniques, is in progress.
Origin and evolution of the miniphage genomes
Similar to the Ff phages, Pf3 miniphages arise by spontaneous deletion of
a large part of the wt genome.
The factors that determine the specificity of
these recombination processes are, however, still unclear (9, 14, 26).
75
The genomes of all three miniphages studied, are flanked in the wt Pf3 genome
by identical oligonucleotide sequences, varying in length from 5-8 basepairs;
only one copy of this repeat sequence was found again at the circularization
site that fuses the endpoints of the deletion.
Thus without exception, these
sequences must have played a fundamental role in the recombination processes,
finally resulting in deletions and duplications, for instance by mediating a
homologous recombination event.
The genomes of miniphage A and В are the result of a "simple" deletion of
80Í and 75% of wt Pf3 DNA, respectively (Fig. 5). Because the genome of
miniphage A is completely contained within that of miniphage B, the generation
of miniphage A can also be envisioned as a two-step process: i_.e.
first a
deletion event that results in the genome of miniphage B, followed by a second
deletion of another 150 bp.
Evidence that a primary deletion mutant can undergo additional
modifications, and even can evolve into more complex molecules, is apparent
from the structure of the genome of miniphage С
of a tandemly duplicated sequence of 586 bp.
Part of this genome consists
From the fact that the
duplicated sequence contains the fusion point between nucleotides 4092 and
5010 of the wt Pf3 genome, it is evident that this sequence arrangement must
have been present before the duplication event could occur (Fig. 5).
Inspection of the nucleotide sequence of pre-MiniC with respect to the region
"to be duplicated" shows that the borders of this region are flanked by a
direct repeat of the oligonucleotide CTTGAT. Only one copy of this repeat is
present at the fusion point of the tandemly reiterated segments.
For the E.coli filamentous phages it is as yet unclear whether short direct
repeats are involved in the generation of deletion mutants.
Only one
1
circularization sequence of a Ff (f1) miniphage genome has been reported (I ));
in the wt genome this sequence, however, does not flank the miniphage DNA
region on both sides.
In fact, no homology at all can be detected between the
DNA regions fused in the deletion process.
On the other hand, it is well documented that short repetitive sequences have
played an important role in the generation of extensive deletions in the lac
operon and other systems (1, 15). In analogy to the significantly larger
deletions in the Pf3 genome, these deletions probably occurred by
recombination between these directly repeated sequences. In this context it is
of interest to note the resemblance of the deletion process with the excision
76
of transposable elements (4, 28).
With respect to duplications and multiplications, Edlund and Normark (7)
observed extensive (up to 10 kb) tandem duplications of a DNA segment
encompassing the E.coll ampC gene, which apparently were caused by
recombination of direct repeats of 12-13 bp that flanked this DNA region.
With respect to duplications, an identical observation is made in the genomes
of at least some Ff (fi) miniphage DNAs. (14, 26). Ravetch et al. (26) have
proposed two mechanisms to explain the generation of tandem duplications in Ff
miniphage genomes.
Without significant alterations, these mechanisms can be
adapted to explain the observed duplication in Pf3 miniphage С DNA.
A mere straightforward mechanism takes into account the involvement of short
direct repeats in both the deletion and the duplication process.
Thus the
deletion could be the result of an intramolecular homologous recombination
event. In addition, when acting upon a completely duplicated pre-mini-C
molecule, the same mechanism could be responsible for the deletion of part of
one reiterated sequence, resulting in the genome of miniphage C.
An even simpler mechanism for the generation of deletions and duplications is
the "slipped mispairing" mechanism (1, 10). This mechanism assumes that
during replication of one copy of a short direct repeat, the newly synthesized
sequence pairs with another repeat on the template strand. The relative
position of the second direct repeat determines whether a deletion or a
duplication will occur.
Thus, in case the newly synthesized repeat sequence
slips forward with respect to the direction of DNA synthesis, the region
located between the repeats will be deleted. On the other hand, if slipped
mispairing occurs towards a sequence which already has been replicated, the
region between the repeats will again act as a template for replication, thus
resulting in a (tandem) duplication of the DNA region located between the
short repetitive sequences.
It should be noted that for Pf3, and for the filamentous phages in general,
this process of slipped mispairing can occur during dsDNA replication, as well
as during complementary strand synthesis.
In the latter case slipped mispairing even might be facilitated by the
single-stranded nature of the template molecule, thus eliminating the
dependence of the recombination process on a recA type protein. In this
context it is interesting to note that recA-independent evolution of Ff (fi)
mimphages already has been reported by Honuchi ( H ) .
77
LITERATURE CITED
Albertini, A.M., M. Hofer, M.P. Calos, and J.H. Miller. 1982. On the
formation of spontaneous deletions: the importance of short sequence
homologies in the generation of large deletions. Cell 2£: 319-328.
Baas, P.D. 1985. DNA replication of single-stranded Escherichia coli
DNA phages. Biochim. Blophys. Acta 825: 111-139.
Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H.
Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978.
Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12:
ІЙ95-И503.
Calos, M.P., and J.H. Miller. 1980. Transposable elements.
579-595.
Cell 20:
Denhardt, D.T., D. Dressier, and D.S. Ray, ed. 1978. The singlestranded DNA Phages. Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY.
Dotto, G.P., and N.D. Zinder. 1983. The morphogenetic signal of
bacteriophage f1. Virology IJCb 252-256.
Edlund, T., and S. Normark. 1981. Recombination between short DNA
homologies causes tandem duplication. Nature (London) 292: 269-271.
Enea, V., and N.D. Zinder. 1975. A deletion mutant of bacteriophage fi
containing no intact cistrons. Virology 68: 105-114.
Enea, V., K. Horiuchi, B.C. Turgeon, and N.D. Zinder. 1977. Physical
map of defective interfering particles of bacteriophage f1. J. Mol.
Biol. 1_n_: 395-414.
Farabaugh, P.J., U. Schmeissner, M. Hofer, and J.H. Miller. 1978.
Genetic studies of the lac repressor. VII. On the molecular nature of
spontaneous hotspots in the lad gene of Escherichia coli. J. Mol.
Biol. 1_26: 847-857.
Griffith, J., and A. Kornberg. 1974. Mini M13 bacteriophages: Circular
fragments of Ml 3 DNA are replicated and packaged during normal
infections. Virology 59: 139-152.
Hewitt, J.A. 1975. Miniphage, a class of satellite phage to M13.
Gen. Virol. 26: 87-94.
J.
Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of
bacteriophage fi DNA. J. Virol. 4£: 32-46.
Horiuchi, K. 1983. Co-evolution of a filamentous bacteriophage and its
defective interfering particles. J. Mol. Biol. 169: 389-407.
15.
Jones, I.M., S.B. Primrose, and S.D. Ehrlich. 1982. Recombination
between short direct repeats in a recA host. Mol. Gen. Genet. 188:
486-489.
16.
Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 19Θ3. The
major coat protein gene of the filamentous Pseudomonas aeruginosa phage
Pf3: Absence of an N-terminal leader signal sequence. Nucleic Acids
:
Res. Γ|_ 8073-8085.
17.
Luiten R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings, and
L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1
Plasmid specific filamentous phage of Pseudomonas aeruginosa. J.
Virol. 56: 268-276.
18.
Maniatis, T., E.F. Fritsch, and J. Sambrook. 1982. Molecular Cloning.
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
19.
Messing, J., and J. Vieira. 1982. A new pair of Ml 3 vectors for
selecting either DNA strand of double digest restriction fragments.
Gene ]9_·. 269-276.
20.
Miller, J.H. 1972. Experiments in Molecular Genetics. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.
21.
Miller J.H., and W.S. Reznikoff, ed. 1978. The Operon. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.
22.
Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings.
1985. Nucleotide sequence and genetic organization of the genome of the
N-specific filamentous bacteriophage IKe. J. Mol. Biol. 1_81_: 27-39.
23.
Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H. Konings. 1986. The
genell proteins of the filamentous phages IKe and Ff (M13, fd, and fi)
are not functionally interchangeable during viral strand replication.
Nucleic Acids Res. 1j4: 5067-5080.
24.
Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H. Konings. 1987.
Functional comparison of the DNA sequences involved in the replication
and packaging of the viral strands of the filamentous phages IKe and Ff
(M13, f1, and fd). DNA 6: 139-147.
25.
Putterman, D.G., A. Casadevall, P.D. Boyle, H.-L. Yang, B. Frangione,
and L.A. Day. 1984. Major coat protein and single-stranded DNA binding
protein of filamentous virus Pf3. Proc. Natl. Acad. Sci. USA 8j_: 699703.
26.
Ravetch, J.V., K. Horiuchi, and N.D. Zinder. 1979. DNA sequence
analysis of the defective interfering particles of bacteriophage f1.
J. Mol. Biol. 2^8: 305-318.
27.
Stanisich, V.A. 1974. The properties and host range of male-specific
bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 8£: 332342.
79
Starlinger, P. 1980. IS elements and transposons.
Plasmid 3: 211-259.
Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers.
1980. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome:
Comparison with phage fd. Gene 1_1_: 129-148.
Zinder, N.D., and К. Horiuchi. 1985. Multiregulatory element of
filamentous bacteriophages. Microbiol. Rev. 49: 101-106.
CHAPTER 4
In Vitro Deletion Mapping of the Viral Strand Replication Origin
of the Pseudomonaâ Bacteriophage Pf3.
Ruud G.M. Luiten, Marja C.P. Timmermans, John G.G. Schoenmakers,
and Ruud N.H. Konings
ABSTRACT
The origin of viral strand replication of the filamentous bacteriophage Pf3
has been characterized in Escherichia coli by in vitro deletion mapping
techniques. The origin region was functionally identified by its ability to
convey replicative properties to a recombinant plasmid in a poiA host where
Plasmid specified replication was not possible.
The origin of Pf3 viral strand replication is contained within a region of 139
basepairs. This DNA sequence covers almost completely one of the intergenic
regions, and specifies replication initiation as well as replication
termination functions.
Although no nucleotide sequence homology is present
between the Pf3 origin of viral strand replication and that of the Escherichia
coli filamentous phages Ff (M13, f1, and fd) and IKe, their map positions and
functional properties are however very similar.
INTRODUCTION
Pf3 is a member of the filamentous bacteriophages that contain a circular
single stranded (ss) DNA genome (Inovlrldae).
Its natural host is Pseudomonas
aeruginosa harboring the broad host range plasmid RP1 (30). The plasmid
encodes specific pili that are required for phage adsorption and penetration.
After infection the viral genome
is replicated under the instruction of both
phage and host encoded proteins (10). Similar to the filamentous viruses that
are specific for other bacterial genera, progeny phage is continuously
extruded through the cell membrane without lysis or killing of the host cell.
Although the filamentous viruses studied thus far strongly resemble each
other with respect to their morphology, overall macromolecular composition and
life cycle, sequence analyses have however indicated that the nucleotide
sequences of their genomes can be completely different.
For Pf3 we have found
that its genome is not homologous at all to that of the well studied
filamentous E.coli phages Ff (M13, fd, f1) or IKe (4, 14, 20, 21, 26, 32).
Consequently the genetic organization of the Pf3 genome could not simply be
83
Figure 1. The structure of the Pf3 miniphage A genome and its relation to the
wt Pf3 genome. The arrow delineates the region present in all miniphage
genomes studied (20).
deduced from a comparison of the nucleotide sequences, and thus other
strategies needed to be followed in order to localize specific genetic
properties of the Pf3 genome.
In a previous paper we already have reported a preliminary identification
of the DNA region in which the origins of replication (i.e. the viral strand
and the complementary strand origin) and the morphogenetic signal of the Pf3
genome are located (19). This region was found to extend from nucleotide
position 4092 to 4670 of the wt Pf3 genome (Fig. 1). The studies presented in
this paper are focussed on a further characterization the origin of Pf3 viral
strand replication.
By making use of in vitro deletion mapping techniques, we
demonstrate that the region containing the functional viral strand origin is
contained within a DNA sequence of 139 basepairs.
84
MATERIALS and METHODS
B a c t e r i a , b a c t e r i o p h a g e s , and
B a c t e r i o p h a g e Pf3 and i t s
Plasmids.
h o s t Pseudomonas a e r u g i n o s a 0 [RP1] (30) were
from
our own s t o c k .
The genome of miniphage A i s a s p o n t a n e o u s d e l e t i o n mutant of t h e c i r c u l a r
genome, and c o n s i s t s
of n u c l e o t i d e s З^в^ t o 4673 of t h e wt Pf3 genome
For p r o p a g a t i o n of recombinant pUC9 P l a s m i d s
q
lacI ZAM15, a r a , A l a c p r o , s t r A , t h i )
(24) E s c h e r i c h i a c o l i JM83 (Ф80
(23) was used as a h o s t .
recombinant P l a s m i d s on t h e p r e s e n c e of a f u n c t i o n a l
of r e p l i c a t i o n ,
Pf3
(19).
To t e s t
Pf3 v i r a l
strand
origin
use was made of E . c o l i N4156 (polA, end, t h y , gyrA) ( 1 3 ) .
This
s t r a i n does not produce a f u n c t i o n a l DNA p o l y m e r a s e I and t h e r e f o r e i s
unable
t o s u s t a i n v e c t o r plasmid r e p l i c a t i o n v i a t h e ColEI r e p l i c a t i o n o r i g i n
(31)·
C o n s t r u c t i o n of Plasmids pMinil through pMini9.
The p r o c e d u r e s f o r t h e i s o l a t i o n of plasmid DNA and f o r t h e c o n s t r u c t i o n of
recombinant Plasmids were e s s e n t i a l l y
as d e s c r i b e d
by M a n i a t i s e t a l .
(22).
Plasmid pMinil was c o n s t r u c t e d v i a i n s e r t i o n of EcoRI c l e a v e d miniphage A
replicative
form (RF) i n t o t h e unique EcoRI s i t e of plasmid pUC9.
pMini2 was o b t a i n e d by r e l i g a t i n g
the largest
Aval fragment
Plasmid
of pMinil
and
t r a n s f o r m a t i o n t o JM83.
S t a r t i n g with plasmid pMini2, Plasmids рМіпіЗ t h r o u g h pMini9 were
v i a p r o g r e s s i v e d e l e t i o n s of t h e Pf3 i n s e r t .
w i t h EcoRI and s u b s e q u e n t l y
intervals
To t h i s end pMini2 was
i n c u b a t e d with e x o n u c l e a s e
samples were t a k e n and t h e DNA was p u r i f i e d
ethanol p r e c i p i t a t i o n .
Subsequently
constructed
ВаІЗІ.
linearized
At r e g u l a r
time
by phenol e x t r a c t i o n and
each sample was t r e a t e d w i t h T4 DNA l i g a s e
and t r a n s f o r m e d t o E . c o l i JM83.
D e l e t i o n s from t h e o t h e r s i d e of t h e Pf3 i n s e r t were c r e a t e d
after
l i n e a r i z a t i o n w i t h BamHI, u s i n g t h e same p r o c e d u r e .
The n u c l e o t i d e sequence of t h e Pf3 i n s e r t s was d e t e r m i n e d by t h e dideoxy
t e r m i n a t i o n t e c h n i q u e as a d a p t e d for
DNA by Chen and Seeburg
t h e sequence a n a l y s i s
( 7 ) . For t h i s purpose t h e u n i v e r s a l
s e q u e n c i n g p r i m e r s , and a Pf3 s p e c i f i c
double-stranded
and
synthetic oligonucleotide
sequence 5 '-GGGCAGCGTACCG-3', h y b r i d i z i n g
4427 t o 4439 were
of
chain
reverse
of
t o Pf3 DNA a t n u c l e o t i d e
the
position
used.
85
Transformation.
E.coll N4156 was made competent and transformed according to standard
procedures (22).
Q
For (co)transformation experiments, 1x10
competent E.coli N4156 c e l l s were
incubated in the presence of 0.1 vg plasmid DNA and, if appropriate, 0.1 ug
Pf3 RF.
Enzymes and Biochemicals
R e s t r i c t i o n enzymes were obtained from Boehringer Mannheim. Tk DNA l i g a s e and
exonuclease Bal31 were from Bethesda Research Laboratories.
All enzymes were
used as recommended by the s u p p l i e r .
Ampicillin (Sigma) was used at a concentration of 100 μg/ml.
RESULTS
The r e p l i c a t i o n of t h e ssDNA genome of filamentous b a c t e r i a l viruses
requires the presence of two different
r e p l i c a t i o n o r i g i n s . One, the
complementary strand o r i g i n , i s required for the conversion of the i n f e c t i n g
v i r a l DNA into a double stranded r e p l i c a t i v e form (RF), while the o t h e r , the
v i r a l strand o r i g i n , is e s s e n t i a l for asymmetric r e p l i c a t i o n of the v i r a l
strand according t o a r o l l i n g c i r c l e mechanism ( 1 , 34).
To i n i t i a t e
r e p l i c a t i o n at the complementary strand o r i g i n only host encoded functions are
r e q u i r e d , whereas for the I n i t i a t i o n of v i r a l strand r e p l i c a t i o n one phage
encoded prot ein i s needed. This protein i s a s i t e - s p e c i f i c
topoisomerase
which, by introducing a nick in the v i r a l strand o r i g i n , c r e a t e s a free
end for t h e i n i t i a t i o n of v i r a l strand synthesis
3'-0H
( 1 , 34).
The a n a l y s i s of spontaneous deletion mutants (miniphages) has allowed a
preliminary mapping of the r e p l i c a t i o n o r i g i n s of the Pf3 genome (19). A
further d e l i n e a t i o n of the o r i g i n of r e p l i c a t i o n by in v i t r o deletion mapping
r e q u i r e s molecular cloning techniques which a r e , for lack of
efficient
transformation procedures and s u i t a b l e b a c t e r i a l mutants, not yet possible
using Pseudomonas.
We t h e r e f o r e sought E.coli as a host. Productive i n f e c t i o n
of E.coli by Pf3 has been reported, however the efficiency
86
of t h i s i n f e c t i o n
E 110721
Figure 2 . Construction of plasmids pMinil and pMini2. Numbers refer to
nucleotide positions of the wt Pf3 genome. Symbols used are as follows: bla:
ß-lactamase gene, o r i : ColEI origin of r e p l i c a t i o n , aLacZ: LacZ gene fragment
encoding the α-peptide of ß-galactosidase.
Restriction enzyme recognition
s i t e s are indicated as follows: A, Aval, B, BamHI, E, EcoRI, H, H i n d l l l , Hp,
H p a l l , N, Nari, Ρ, P s t I , S, S a l i .
i s low, as i l l u s t r a t e d by the fact t h a t after p l a t i n g no individual plaques
can be observed (5, unpublished r e s u l t s ) . A different functional assay for Pf3
r e p l i c a t i o n was thus developed : the genome of one Pf3 miniphage (miniphage A)
was cloned i n t o a ColEI derived vector plasmid (pUC9) with a s e l e c t a b l e marker
(ampicillin r e s i s t a n c e ) and the recombinant DNA molecule pMinil (Fig. 2) was
subsequently introduced i n t o a polA E.coli s t r a i n . Since the ColEI plasmid
origin of r e p l i c a t i o n i s not a c t i v e in a polA host (8, 31), r e p l i c a t i o n of the
recombinant plasmid, and thus the establishment of b a c t e r i a l colonies under
s e l e c t i v e pressure, should be dependent upon a functional Pf3 origin of
replication.
The v a l i d i t y of t h i s system was tested with plasmid pMinil,
which contained a l l Pf3 s p e c i f i c r e p l i c a t i o n functions of the parent miniphage
A genome (19).
Transformation of E.coli N4156 (polA) with pUC9, Pf3 RF, or
pMinil separately never r e s u l t e d in the appearance of ampicillin r e s i s t a n t
colonies, nor did cotransformation of pUC9 and Pf3 RF. On the other hand,
cotransformation of plasmid pMinil and Pf3 RF oroduced a large number of
ampicillin r e s i s t a n t colonies (Table 1).
By c u l t u r i n g these amp
plasmid pMinil could be recovered unmodified, though in r e l a t i v e l y
amounts (see also Fig. *i).
cells
small
These r e s u l t s indicated t h a t r e p l i c a t i o n of
87
Figure 3- Construction of Plasmids pMiniS and pMini9.
explained in the legend t o Fig. 2.
Symbols used are as
Plasmid pMinil in a pol A host requires helper functions encoded by wt Pf3 DNA
and therefore i s l i k e l y to be i n i t i a t e d at the Pf3 origin present in the
insert.
To map the Pf3 r e p l i c a t i o n origin more accurately the s i z e of the Pf3 DNA
i n s e r t in pMinil was systematically reduced by r e s t r i c t i o n enzyme digestion
and ВаІЗІ d e l e t i o n .
The r e s u l t i n g constructs were subsequently tested with
the cotransformation procedure.
By digestion of pMinil with Aval, followed by l i g a t i o n of the l a r g e s t fragment
Plasmid pMini2 was obtained (Fig. 3).
Simultaneous introduction of pMini2,
which only contained nucleotides 4072 through 451*6 of the wt Pf3 genome, with
Pf3 RF in E.coll N4156 e f f i c i e n t l y
yielded ampicillin r e s i s t a n t colonies,
i n d i c a t i n g t h a t no sequences e s s e n t i a l for Pf3 s p e c i f i c r e p l i c a t i o n had been
deleted (Table 1).
This observation was a n t i c i p a t e d because previous
comparison of the nucleotide sequences of several independently i s o l a t e d
miniphage genomes had already indicated t h a t most of the sequences deleted in
the above experiment, were not required for miniphage DNA r e p l i c a t i o n (19).
To determine the l e f t most l i m i t of the Pf3 o r i g i n of r e p l i c a t i o n , the i n s e r t
of plasmid pMini2 was progressively deleted from the l e f t by Bal31 digestion
(see Materials and Methods).
Deletions to approximately position 4310 (in
pMini5, Fig. 4) of the wt Pf3 genome had no effect
on the yield of ampicillin
r e s i s t a n t c o l o n i e s , whereas larger deletions (upto position 4350 in рМіпіб)
significantly
(Table 1).
reduced the transformation efficiency
of E.coli poi A c e l l s
The r i g h t hand boundary of the o r i g i n was delineated by
systematically d e l e t i n g the i n s e r t of pMini5 from the BamHI s i t e , again by
ВаІЗІ digestion.
88
Testing several of the r e s u l t i n g Plasmids in the
Figure Ч. Ethidiumbromide stained gel (A) and Southern blot analysis using
^ 2 P-labeled Pf3 RF DNA as a probe, of Pf3 RF DNA (lane 1) and several pMini
Plasmids as present in E.coli s t r a i n JM83 (lanes 2, Ц, and 6) and in E.coli
N4156 c e l l s cotransformed with Pf3 RF (lanes 3, 5, and 7 ) . Lanes 2 and 3,
pMini2; lanes 4 and 5, pMini5; lanes 6 and 7, pMini9.
cotransformati on assay indicated t h a t deletions ranging from position 4541 t o
position 4450 (pMini9, Fig. 4) had no effect on the production of ampicillin
r e s i s t a n t E.coli N4156 colonies (Table 1 ) .
Nucleotide sequence analysis of the Pf3 i n s e r t of plasmid pMini9, revealed
that exactly 139 basepairs
(position 4312 t o 4450) of the wt Pf3 genome were
s t i l l present.
These r e s u l t s , together with the deletion mapping experiments and
cotransformation procedure presented in Table 1, c l e a r l y indicated t h a t both
the presence of a Pf3 r e p l i c a t i o n o r i g i n on the recombinant plasmid and Pf3
encoded functions are e s s e n t i a l for r e p l i c a t i o n of the plasmid in E.coli polA
cells.
Having established which region of the Pf3 genome contains the o r i g i n of
r e p l i c a t i o n , we now devised ways to analyze the functional p r o p e r t i e s of t h i s
origin on the Pf3 DNA i n s e r t i n terms of i n i t i a t i o n and termination of
replication.
For the Ff phages and IKe i t has been shown t h a t the origin of
v i r a l strand r e p l i c a t i o n functions not only in the i n i t i a t i o n of
( u n i d i r e c t i o n a l ) r o l l i n g c i r c l e r e p l i c a t i o n but also i s involved in the
termination r e a c t i o n (11, 12, 28). As a consequence of t h i s combination of
functions a c i r c u l a r DNA molecule containing two a c t i v e functional o r i g i n s i n
89
Figure 5. Construction of plasmids рМіпіі and pMinilS.T. These plasmids were
constructed by i n s e r t i o n of one (pMinilS) or two (рМіпіі .Т) copies of the 267
bp Narl/Hpall of from pMini9, in the unique Acci s i t e of pUCIÖ. Symbols are
as in the legend t o Fig. 2.
an i d e n t i c a l o r i e n t a t i o n will be unstable, because r e p l i c a t i o n i n i t i a t e d at
one o r i g i n will terminate at the second origin and vice versa (12, 17).
Replication of such a plasmid through a c t i v a t i o n of the phage derived o r i g i n
by the homologous phage encoded r e p l i c a t o r protein will thus resolve t h i s
molecule i n t o two molecules each containing only one complete o r i g i n .
This phenomenon was used to assay for the i n i t i a t i o n and termination functions
of the Pf3 o r i g i n of r e p l i c a t i o n as present on pMini9. A 267 bp fragment of
pMini9 which included the complete 139 bp Pf3 i n s e r t was recloned in pUCI 8
such that recombinants containing e i t h e r a s i n g l e i n s e r t (pMinilS) or two
tandemly arranged copies of the fragment (pMinilS.T) were obtained (see Fig.
5 ) . The plasmid with the tandem duplication was perfectly s t a b l e as long as
r e p l i c a t i o n of the plasmid occurred from the ColEI r e p l i c a t i o n origin of t h e
pUC vector. When pMinilS and pMinilS.T were cotransformed with Pf3 RF into
E.coli N4156, thus s e l e c t i n g for Pf3 s p e c i f i c r e p l i c a t i o n of the plasmids,
they both e f f i c i e n t l y yielded ampicillin r e s i s t a n t colonies. However when
plasmid DNA, i s o l a t e d from independently obtained transformants was subjected
to r e s t r i c t i o n enzyme mapping and nucleotide sequence a n a l y s i s , plasmids from
cotransformation of рМіпіі
from each other (Fig. 6 ) .
as well as of pMinilS.T proved to be i n d i s c e r n i b l e
The plasmid obtained a f t e r cotransformation of
pMinilS.T produced ampicillin r e s i s t a n t E.coli N4156 colonies as e f f i c i e n t as
the independently constructed pMinilS.
These observations indicated t h a t
exactly one of two copies of the 267 bp fragment in pMinilS.T had been deleted
during Pf3 directed r e p l i c a t i o n .
We thus conclude t h a t the region of the Pf3
genome (position 4312 through 4450) present in pMinilS (or pMini9) not only
90
ì 2 3~4 5 6 7 8 9
Figure 6. R e s t r i c t i o n fragment p a t t e r n s
o b t a i n e d a f t e r H l n f l d i g e s t i o n of t h e
Plasmids pMinilS ( l a n e 1) and pMinilS.T
(lane 2 ) . In lanes 3 through 9 the
fragment p a t t e r n r e s u l t i n g from H i n f l
d i g e s t i o n of t h e Plasmids p r e s e n t i n
seven i n d e p e n d e n t l y i s o l a t e d c o l o n i e s of
E . c o l i N1)156 c o t r a n s f o r m e d w i t h
pMinilS.T and Pf3 RF a r e shown.
f u n c t i o n s i n t h e i n i t i a t i o n but a l s o i n t h e t e r m i n a t i o n of
replication,
s i m i l a r t o t h e o r i g i n of v i r a l s t r a n d r e p l i c a t i o n of t h e phages Ff and IKe.
DISCUSSION
We have s t u d i e d t h e l o c a t i o n of t h e o r i g i n s of v i r a l s t r a n d r e p l i c a t i o n of
t h e b a c t e r i o p h a g e Pf3 genome, and examined i t s f u n c t i o n w i t h r e s p e c t t o t h e
r e q u i r e m e n t of Pf3 encoded t r a n s - a c t i n g e l e m e n t s i n t h e r e p l i c a t i o n p r o c e s s by
complementation s t u d i e s i n E . c o l i .
The use of E . c o l i i n s t e a d of
P.aeruginosa
as t h e organism f o r s t u d y i n g DNA r e p l i c a t i o n was p r i m a r i l y based on t h e low
e f f i c i e n c y of DNA t r a n s f o r m a t i o n .
Although some t r a n s f o r m a t i o n p r o c e d u r e s
s p e c i f i c Pseudomonas s t r a i n s have been d e s c r i b e d ( 3 ) . no g e n e r a l l y
and e f f i c i e n t
protocol
is available.
In a d d i t i o n , s e l e c t i o n of
for
applicable
e.g.
Pseudomonas a e r u g i n o s a t r a n s f o r m a n t s by an a n t i b i o t i c r e s i s t a n t phenotype i s
difficult
because t h i s s p e c i e s e x h i b i t s a very high c e l l u l a r r e s i s t a n c e t o a
wide r a n g e of a n t i b i o t i c s ( 6 , 2 5 , 2 6 ) .
The c h o i c e of E . c o l i s h o u l d however
not be a l i m i t a t i o n w i t h r e s p e c t t o t h e i n t e r p r e t a t i o n of the r e s u l t s
d e s c r i b e d , b e c a u s e , as mentioned above, Pf3 has been r e p o r t e d t o
infect E.coli
( 5 , 30, u n p u b l i s h e d r e s u l t s ) .
productively
This was confirmed a g a i n by t h e
91
Table 1.
Results of transformation of E.coli N4156 polA with different pMini c o n s t r u c t s
separately or in combination with Pf3 RF. Efficiencies of transformation are
expressed as t h e number of ampicillin r e s i s t a n t colony forming u n i t s (cfu)
from a standard transformation experiment (see Materials and Methods).
# ampR cfu
Cotransformed Pf3 RF
Transformed pi asmid
(Pf3 i n s e r t )
РІК200
*
pUC9
Pf3 RF
pMinil
pMini2
pMiniS
рМіпіб
pMini9
5
2.3 χ 1 0
(3484-4673)
(4072-451*6)
(4312-45^6)
(4350-4 546)
(4312-4450)
pMinilO (4312-4410)
0
0
0
0
0
0
0
0
1.9 x
0
0
2.1 χ
1.7 x
1.2 χ
20
1.0 χ
Ю
5
.,
IO;
IO;
IO4
IO4
3
Plasmid pIK200 contains the complete replicón of the filamentous
bacteriophage IKe (27), and was used as a p o s i t i v e control for transformation.
i n i t i a l experiments described in t h i s paper, in which a recombinant plasmid,
pMinil, containing the complete genome of a Pf3 miniphage (and thus the
r e p l i c a t i o n origins of Pf3 ( 1 9 ) ) , was shown t o be r e p l i c a t e d in E.coli if
helper functions were provided in trans by a cotransformed wt Pf3 genome.
We assume t h a t only the o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n i s required for
maintenance of the recombinant plasmid in t h e E.coli host.
No d e f i n i t e
conclusion can be reached with respect to the o r i g i n of complementary strand
s y n t h e s i s , because t h i s origin in our experiments could be provided by pBR322
derived sequences of the vector plasmid, as has been demonstrated by the
analysis of r e p l i c a t i o n functions of ФХ174 and of t h e filamentous phages Ff
(8, 9, 16, 33).
Using a cotransformati on assay we were able t o reduce the DNA
region, in which t h e o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n i s located to 139
bp, i . e . p o s i t i o n 4310 through 4450 of the wt Pf3 genome.
Additional evidence
t h a t t h e recombinant plasmid pMini9 thus obtained i s r e p l i c a t e d under the
i n s t r u c t i o n of the Pf3 i n s e r t , p a r a l l e l e d s t u d i e s of the r e p l i c a t i o n o r i g i n s
of the filamentous E.coli bacteriophages fi and IKe (11, 12, 17). Detailed
analysis of these o r i g i n s of viral strand r e p l i c a t i o n revealed the presence of
a r e p l i c a t i o n i n i t i a t i o n as well as a r e p l i c a t i o n termination signal.
This
combination of functions was i l l u s t r a t e d by the r e s o l u t i o n of a plasmid,
92
containing two origins in the same orientation, into two Plasmids each
containing only one functional origin.
A similar experiment with a tandemly arranged Pf3 origin fragment from pMini9
resulted in the deletion of exactly one fragment copy, indicating that also
the Pf3 viral strand origin encodes a replication initiation and a replication
termination function.
The results of the deletion experiments indicate that the complete 139 bp
fragment, encompassing position 4312 through HH50 of the wt Pf3 genome, is
essential for a functional origin of Pf3 viral strand replication.
Further
support for this conclusion comes from the structure of the genome of
miniphage С (19). This genome is characterized by the presence of a tandem
duplication generated in vivo.
The duplicated fragment comprises sequences up
to position 1412 of the wt Pf3 genome, i.e. all but 38 bp of the 139 bp
fragment identified in this paper.
This sequence arrangement is perfectly
stable and thus the duplicated sequence cannot contain a functional
replication initiation or termination site.
As has been shown for a similar
reiteration in Ff miniphage genomes (15, 19) this duplicated sequence in the
minphage С genome may even confer a growth advantage to this miniphage.
τ τ
с с
G С
ос
А
С G
*G
G
G
С
G
А
,Α
С
С
G
С
Τ
Τ
"С О
G С
4
Ar.
G С
G С
0RF301
С G - 41)00
GС
S S P L P R Q L L S T S K »
AT
TAGTTCGCCGCTTCCTCGTCAGCTTTTGAGTACCAGCAAGTGATTCCCGAA
CGCTCTTCATTAGTAGTCACATATCGGTACGCTGCCCAAATCGGCATC
1320
I4H50
Figure 7. Nucleotide sequence of the fragment in which the Pf3 origin of
viral strand replication is located. The inverted repeat sequence present in
this region is drawn as a stem and loop structure.
93
However, in view of the r e s u l t s presented above i t can be concluded t h a t part
of the duplicated segment of miniphage С DNA, a t l e a s t from position ^310 t o
1)1112, i s necessary but obviously not sufficient
specific replication.
t o i n i t i a t e or terminate Pf3
Apparently the 38 bp following position 4412 are
e s s e n t i a l for proper functioning of the r e p l i c a t i o n o r i g i n .
This sequence
arrangement may be comparable t o the r e p l i c a t i o n "enhancer"
sequence observed in Ml 3 (9) but not in IKe (28).
Thus the o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n comprises almost completely
the t h i r d non coding region of the Pf3 genome (20).
A major c h a r a c t e r i s t i c of
t h i s non coding region i s the presence of one inverted repeat s t r u c t u r e , which
may function as a s i t e for recognition by the Pf3 encoded t r a n s - a c t i n g
factor(s).
In the genomes of the E.coli specific filamentous bacteriophages Ff and IKe
the v i r a l strand o r i g i n i s located in a much larger non coding region (of 507
and 738 n u c l e o t i d e s , r e s p e c t i v e l y )
t h a t in addition contains the s i g n a l s
required for complementary strand r e p l i c a t i o n , and for packaging of the v i r a l
strand i n t o progeny filamentous phage (4, 14, 26, 32).
All s i g n a l s involved
in Pf3 DNA r e p l i c a t i o n and phage morphogenesis are located between position
4092 and 4678 of the wt Pf3 genome, as has been concluded from the genomic
s t r u c t u r e s of several miniphages (19).
This observation and the r e s u l t s
presented in t h i s paper leave an i n t e r e s t i n g p o s s i b i l i t y with respect t o the
position of the Pf3 complementary strand origin and the morphogenetic s i g n a l .
These s i g n a l s may overlap with the o r i g i n of v i r a l strand r e p l i c a t i o n , or
otherwise may be located in protein coding regions of the genome. Both
positions would be unique among the filamentous bacteriophages studied thus
far.
Further analysis of the Pf3 genome should allow the positioning of the
complementary strand origin and the morphogenetic s i g n a l , and might also
reveal requirements for gene expression and DNA r e p l i c a t i o n in P.aeruginosa,
and thus be of importance for the development of vector systems in t h i s
bacterium. In t h i s context i t should be noted t h a t Pseudomonas species are
able to degrade a large number of xenobiotic compounds such as aromatic and
a l i p h a t i c hydrocarbons. The a v a i l a b i l i t y
of cloning vectors able t o r e p l i c a t e
in t h i s genus will speed up the genetic analysis of these properties and open
ways to improve or enhance them (2, 3, 29).
94
ACKNOWLEDGEMENTS
The a u t h o r s t h a n k Dr. L e t t i e Lubsen f o r c r i t i c a l r e a d i n g of t h e m a n u s c r i p t and
helpful
suggestions,
and Dr. J . van Boom (Department of O r g a n i c C h e m i s t r y ,
U n i v e r s i t y of L e i d e n ) f o r s y n t h e s i s
of t h e Pf3 s e q u e n c i n g
primer.
REFERENCES
1.
Baas,
P.D. 1985. DNA r e p l i c a t i o n of s i n g l e - s t r a n d e d E s c h e r i c h i a c o l i DNA
phages.
2.
Biochim. B i o p h y s . Acta 825:
B a g d a s a r i a n , M., M.M. B a g d a s a r i a n ,
111-139.
S. Coleman, and K.N. Timmis. 1979.
In:
Plasmids of m e d i c a l , e n v i r o n m e n t a l , and commercial i m p o r t a n c e . K.N.
Timmis and A. P u e h l e r ( e d . ) ,
E l s e v i e r / N o r t h H o l l a n d , Amsterdam, p . 4 1 1 -
422.
3.
B a g d a s a r i a n , M., and K.N. Timmis. 1982. H o s t : v e c t o r s y s t e m s for
c l o n i n g i n Pseudomonas.
4.
C u r r . Top. M i c r o b i o l . Immunol. 9 6 :
Beck, E., R. Sommer, E.A. Auerswald, С
S c h a l l e r , К. Sugimoto, H. S u g i s a k i ,
gene
47-67.
Kurz, В. Z i n k , G. O s t e r b u r g , H.
T. Okamoto, and M. Takanami. 1978.
N u c l e o t i d e s e q u e n c e of b a c t e r i o p h a g e fd DNA.
N u c l e i c A c i d s Res.
12:
4495-4503.
5.
B r a d l e y , D.E. 1 9 8 1 . I n : M o l e c u l a r b i o l o g y , p a t h o g e n i c i t y , and e c o l o g y
bacterial
P l a s m i d s . S.B.
P r e s s , New York. p .
6.
Bryan, L.E. 1979.
of
Levy, R.C. Clowes, and E.L. Koenig ( e d . ) , Plenum
217-226.
Resistance t o antimicrobial agents:
of t h e problem and t h e b a s i s of r e s i s t a n c e ,
the general
nature
i n Pseudomonas a e r u g i n o s a :
c l i n i c a l m a n i f e s t a t i o n s of i n f e c t i o n and c u r r e n t t h e r a p y . R.G. Dogget
( e d . ) , Academic P r e s s I n c . , New York.
p219-270.
95
7.
Chen, E.Y.,
and P.H. S e e b u r g .
1-985. S u p e r c o i l s e q u e n c i n g : A f a s t
s i m p l e method f o r s e q u e n c i n g plasmld DNA.
8.
DNA ^ :
and
165-170.
C l e a r y , J . M . , and D.S. Ray. 1980. R e p l i c a t i o n of t h e plasmid pBR322 under
t h e c o n t r o l of a c l o n e d r e p l i c a t i o n o r i g i n from t h e s i n g l e - s t r a n d e d DNA
phage M13.
9.
Cleary,
P r o c . N a t l . Acad. S c i . USA 7 7 : Ч638-46И9.
J . M . , and D.S. Ray. 1981. D e l e t i o n a n a l y s i s
r e p l i c a t i o n o r i g i n from b a c t e r i o p h a g e M13.
10.
J.
o f ^ t h e cloned
V i r o l . ^10: 197-203.
D e n h a r d t , D . T . , D. D r e s s i e r , and D.S. Ray ( e d . ) . 1978. The s i n g l e s t r a n d e d DNA p h a g e s . Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g H a r b o r ,
NY.
11.
D o t t o , O . P . , К. H o r i u c h i , К.S. J a k e s , a n d N . D .
origin
162:
USA 7 9 :
335-343.
phage f i
plus-strand synthesis.
G e l i e r t , M., К. M i z u u c h i , M.H. O'Dea, T. I t o h , and J .
gyrase a c t i v i t y .
DNA.
a second g e n e t i c c h a r a c t e r i n v o l v e d
P r o c . N a t l . Acad. S c i . USA 7 ^ :
J. Virol.
interfering particles.
i n DNA
^772-4776.
bacteriophage
b a c t e r i o p h a g e and i t s
J . Mol. B i o l . J_69:
389-407.
P r o c . N a t l . Acad. S c i . USA 7 8 :
6784-6788.
Konings, R.N.H., R.G.M. L u i t e n , and B.P.H. P e e t e r s . 1986. Mike, a
chimeric filamentous
phage designed f o r t h e s e p a r a t e p r o d u c t i o n of
DNA s t r a n d of pKUN v e c t o r Plasmids by F
96
1977.
Kim, M.H., J . C . H i n e s , and D.S. Ray. 1981. V i a b l e d e l e t i o n s of t h e Ml 3
complementary s t r a n d o r i g i n .
17.
Sci.
HH_: 32-46.
H o r i u c h i , K. 1 9 8 3 . C o - e v o l u t i o n of a f i l a m e n t o u s
defective
16.
Tomizawa.
H i l l , D . F . , and G.B. P e t e r s e n . 1982. N u c l e o t i d e s e q u e n c e of
fi
15.
P r o c . N a t l . Acad.
7122-7126.
Nalidixic acid r e s i s t a n c e :
14.
J.
D o t t o , G . P . , К. H o r i u c h i , and N.D. Z i n d e r . 1982. I n i t i a t i o n and
t e r m i n a t i o n of
13.
Replication
of b a c t e r i o p h a g e fi : Two s i g n a l s r e q u i r e d f o r i t s f u n c t i o n .
Mol. B i o l .
12.
Z i n d e r . 1982.
+
cells.
Gene 4 6 :
269-276.
either
Livermore, D.M., and T.L. P i t t . 1986. Dissociation of surface properties
and i n t r i n s i c r e s i s t a n c e t o ß-lactams in Pseudomonas aeruginosa.
Microbiol.
J. Med.
22: 217-224.
Luiten, R.G.M., R.I.L. Eggen, J.G.G. Schoenmakers, and R.N.H. Konings.
1987. Spontaneous deletion mutants of bacteriophage Pf3: Mapping of
s i g n a l s involved in r e p l i c a t i o n and assembly.
DNA 6: 129-137.
Luiten, R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings, and
L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1
Plasmid s p e c i f i c filamentous phage of Pseudomonas aeruginosa.
J. Virol.
56: 268-276.
Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The major
coat protein gene of the filamentous Pseudomonas aeruginosa phage Pf3·.
Absence of an N-terminal leader signal sequence.
Nucleic Acids Res. 11 :
8073-8085.
Maniatis, T., E.F. F r i t s c h , and J. Sambrook. 1982. Molecular cloning. A
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor.
Messing, J.M. 1979. A multipurpose cloning system based on the single
stranded DNA bacteriophage M13·
Recombinant Technical Bulletin 2: 43-48.
Messing, J . , and J. Vieira. 1982. A new pair of Ml 3 vectors for s e l e c t i n g
either DNA strand of double digest r e s t r i c t i o n fragments.
Gene _1_9: 269-
276.
Nlkaido, H., and M. Vaara. 1985. Molecular basis of b a c t e r i a l outer
membrane permeability.
Microbiol. Rev. 4£: 1-32.
Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings.
1985. Nucleotide sequence and genetic organization of the genome of the
N-specific filamentous bacteriophage IKe.
J. Mol. Biol. 1_81_: 27-39.
Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H.Konings. 1986. The genell
proteins of the filamentous phages IKe and Ff (M13, f i , and fd) are not
functionally interchangeable during viral strand r e p l i c a t i o n .
Nucleic
Acids Res. 14: 5067-5080.
97
28.
Peeters,
B . P . H . , J . G . G . Schoenmakers, and R.N.H. Konings.
F u n c t i o n a l comparison of t h e DNA s e q u e n c e s i n v o l v e d
29.
s t r a n d s of t h e f i l a m e n t o u s
(M13, Π ,
139-1 »?.
DNA 6 :
S a k a g u c h i , K. 1982.
application.
30.
in the r e p l i c a t i o n
and packaging of t h e v i r a l
and f d ) .
Stanisich,
Vectors
V.A.
phages IKe and Ff
1
for
gene c l o n i n g i n Pseudomonas and t h e i r
C u r r . Top. M i c r o b i o l . Immunol. 9 6 :
-1
ЗІ ·?.
197^. The p r o p e r t i e s and h o s t r a n g e of
b a c t e r i o p h a g e of
1987.
Pseudomonas a e r u g i n o s a .
male-specific
J . Gen. M i c r o b i o l . 8 4 :
332-
342.
31.
S t a u d e n b a u e r , W.L. 1978. S t r u c t u r e and r e p l i c a t i o n of t h e c o l i c i n El
Plasmid.
32.
C u r r . Top. M i c r o b i o l .
Van Wezenbeek,
Immunol. 8 3 :
P . M . G . F . , T.J.M. H u l s e b o s , and J . G . G . Schoenmakers.
N u c l e o t i d e sequence of t h e f i l a m e n t o u s
Comparison with phage f d .
33·
Gene U_:
bacteriophages.
and P . J .
complementary s t r a n d DNA s y n t h e s i s
N u c l e i c Acids R e s . J_1_: 4957-4975.
Z i n d e r , N . D . , and K. H o r i u c h i . 1985. M u l t i r e g u l a t o r y
filamentous
98
b a c t e r i o p h a g e M13 genome:
Van der Ende, Α., R. T e e r s t r a , H.G.Α.M. van der Avoort,
on s i n g l e s t r a n d e d Plasmid DNA.
1980.
129-148.
Weisbeek. 1983. I n i t i a t i o n s i g n a l s for
34.
93-157.
M i c r o b i o l . Rev. 49:
element of
101-106.
CHAPTER 5
Transcription Initiation and Termination Signals on the GenGme
of the Pseudomonas aeruginosa Phage Pf3
Ruud G.M. Luiten, John G.G. Schoenmakers, and Ruud N.H. Konings
ABSTRACT
Transcription i n i t i a t i o n and termination signals of Pseudomonas aeruginosa
have been studied using the genome of the filamentous bacteriophage Pf3 as a
model system. Two t r a n s c r i p t i o n i n i t i a t i o n and one t r a n s c r i p t i o n termination
signal have been i d e n t i f i e d , that are located within the DNA region encoding
the Pf3 single-stranded DNA binding protein and the major coat p r o t e i n .
Despite the fact that the nucleotide sequence of one of the two Pf3 promoters
differed s i g n i f i c a n t l y from the Escherichia coli consensus promoter sequence,
the t r a n s c r i p t i o n i n i t i a t i o n s i g n a l s were recognized both _in vivo and _in v i t r o
by Escherichia c o l i RNA polymerase.
The t r a n s c r i p t i o n termination signal identified on the Pf3 genome was shown t o
be functional in Escherichia coll as well,
These observations i n d i c a t e that the RNA polymerases encoded by Pseudomonas
aeruginosa and Escherichia coll recognize i d e n t i c a l c o n s t i t u t i v e promoter
sequences and termination s i g n a l s on template DNA.
With respect t o the expression of the genes encoding the Pf3 single-stranded
DNA binding protein and major coat protein, Pf3 employs a similar
t r a n s c r i p t i o n s t r a t e g y as the Escherichia coli s p e c i f i c filamentous phages Ff
and IKe, i_.e.
i n i t i a t i o n of t r a n s c r i p t i o n at different promoters but
termination at the same termination s i t e , thus r e s u l t i n g in a nested set of 3 '
overlapping messenger RNAs.
INTRODUCTION
During the l a s t few years there has been a growing i n t e r e s t in the use of
bacteria belonging t o the genus Pseudomonas for biotechnological purposes. In
p a r t i c u l a r the capacity to metabolize a broad variety of xenobiotic compounds
such as a l i p h a t i c and aromatic hydrocarbons (4, 15), has drawn much a t t e n t i o n ,
and consequently has directed research towards the analysis of genes involved
in the respective degradative pathways (7, 8, 11, 12, 22). The data from a
number of these studies have suggested that t r a n s c r i p t i o n i n i t i a t i o n in
101
ori 279
I
ori 71 ~\\
ρ ТВ
| ог<Ь9 Ц pU |
НпсІШ
ИЬоІ
1
огІШ
EcoBÏ
Sell
mio
«21.
«15
5зиЗД
С
μ.(Ι
$лиЗД
93Ьр
ÏSlbp
171 up
Alu I
D
ІЭ9Ьр
ЙІЭІ/НІГКШ
libit
Figure 1. A. Genetic map of the highly expressed region of the Pf3 genome
encoding ssDBP (p78) and MCP (рНЧ), and open reading frames (orfs) of unknown
function (18, 19). R e s t r i c t i o n s i t e s relevant t o the in v i t r o t r a n s c r i p t i o n
s t u d i e s are indicated by arrows. B. Genomic l o c a t i o n of ssDNA probes used for
the i d e n t i f i c a t i o n of Pf3 s p e c i f i c mRNAs by hybrid!zat i o n - s e l e c t i o n . С Pf3
r e s t r i c t i o n fragments used for SI nuclease mapping experiments. D. Pf3
r e s t r i c t i o n fragments i n s e r t e d in promoter and terminator probe plasmids.
Pseudomonas differed
significantly
from t h e same process in Escherichia coll
(7, 8, 22). Although in a number of systems these differences
could be
a t t r i b u t e d t o the absence of p o s i t i v e l y r e g u l a t i n g t r a n s c r i p t i o n f a c t o r s (7,
11, 22), the DNA sequence requirements of Pseudomonas RNA polymerase remained
uncertain.
We have used the genome of bacteriophage Pf3 as a model system to study
t r a n s c r i p t i o n s i g n a l s in Pseudomonas.
Pf3 i s a filamentous, single stranded
(ss) DNA containing virus that infects Pseudomonas aeruginosa harboring the
broad host range plasmid RP1 (29).
The nucleotide sequence and part of the
genetic organization of i t s genome have been elucidated (18, 19).
Comparison
of these data with those of the d i s t a n t l y r e l a t e d E.coli phages Ff (M13, f 1,
and fd) and IKe ( 1 , 14, 23, 30) revealed an almost complete absence of
homology both at the nucleotide sequence level and at the level of the amino
acid sequence of t h e i r encoded p r o t e i n s . I n t e r e s t i n g l y however, a s i m i l a r i t y
was observed with respect t o the overall genetic organization as i l l u s t r a t e d
by the r e l a t i v e map position of several genes and the o r i g i n of v i r a l strand
r e p l i c a t i o n (17, 18).
In t h i s paper the c h a r a c t e r i z a t i o n of t r a n s c r i p t i o n i n i t i a t i o n and
termination s i t e s within the highly expressed region of the Pf3 genome,
102
encoding t h e s i n g l e - s t r a n d e d DNA-binding p r o t e i n (ssDBP) and t h e major
p r o t e i n (MCP), a r e d e s c r i b e d ( s e e F i g . 1A).
coat
In a d d i t i o n t h e Pf3 t r a n s c r i p t i o n
i n i t i a t i o n and t e r m i n a t i o n s i g n a l s have been f u n c t i o n a l l y t e s t e d i n E . c o l i
by
both in v i t r o and in v i v o methods.
MATERIALS AND METHODS
B a c t e r i a , b a c t e r i o p h a g e s , and Plasmids
B a c t e r i o p h a g e Pf3 and i t s h o s t P . a e r u g i n o s a PA01 h a r b o r i n g t h e broad h o s t
r a n g e plasmid RP1 (29) were from our own s t o c k .
The Pf3 genomic l i b r a r y i n M13mp8/9 (18) was used as a s o u r c e f o r
p r e p a r a t i o n of s t r a n d s p e c i f i c ssDNA probes ( s e e F i g .
the
IB).
Promoter probe Plasmids pK02 and pKM2 and t e r m i n a t o r probe plasmid pKG1900 ( 3 ,
21) were used in combination with E . c o l i s t r a i n N100 ( r e c A l 3 , galK2)
(21).
Methods
The p r e p a r a t i o n of ^H l a b e l e d
RNA and t h e i s o l a t i o n of RNA from
b a c t e r i a was performed a s d e s c r i b e d by R i v e r a e t a l . ( 2 5 ) .
further
infected
G e n e r a l l y RNA was
p u r i f i e d by c e n t r i f u g a t i o n t h r o u g h a c u s h i o n of 5.7 M CsCl ( 2 0 ) .
S e l e c t i o n of s p e c i f i c RNA s p e c i e s by immobilized DNA, and gel e l e c t r o p h o r e s i s
were e s s e n t i a l l y as d e s c r i b e d by Smits et a l . (2 6, 27) e x c e p t t h a t DNA was
immobilized on n i t r o c e l l u l o s e i n s t e a d of DBM paper
discs.
In v i t r o t r a n s c r i p t i o n s t u d i e s were performed u s i n g t h e r e c o n s t i t u t e d
system d e s c r i b e d by Edens e t a l .
E.coli
(6).
The p r o c e d u r e s for r e s t r i c t i o n fragment i s o l a t i o n ,
5 ' or 3 ' l a b e l i n g , S 1 -
n u c l e a s e mapping, and c l o n i n g t e c h n i q u e s were as d e s c r i b e d by M a n i a t i s e t
al.
(20).
103
Enzymes and biochemicals
All enzymes were obtained from Boehringer Mannheim, Bethesda Research
Laboratories, or New England Biolabs and used as recommended by the s u p p l i e r s .
3
2
2
Radioactive precursors ( H-uridine, a^P-UTP, a3 P-dATP, and Ύ3 Ρ-ΑΤΡ) were
purchased from Amersham.
Media were prepared from Difco products and, if required, contained 100pg/ml
ampicillin (Sigma).
All other chemicals used were of a n a l y t i c a l grade.
RESULTS
Identification and characterization of Pf3 s p e c i f i c transcripts
To obtain information about the number and s i z e of Pf3 s p e c i f i c
t r a n s c r i p t s in infected P.aeruginosa PA01[RP1] c e l l s , two
different
hybridization methods were employed. In the f i r s t method ^H-uridine or ' Plabeled RNA i s o l a t e d from infected c e l l s was hybridized to e i t h e r Pf3 s i n g l e stranded (ss) or r e p l i c a t i v e form (RF) DNA immobilized on n i t r o c e l l u l o s e
filters.
Subsequently hybridized RNA was eluted from the f i l t e r s
by heat
denaturation and s i z e f r a c t i o n a t e d on denaturing Polyacrylamide g e l s .
second method use was made of t h e Nothern b l o t t i n g technique.
In the
After
f r a c t i o n a t i o n of t o t a l RNA on e i t h e r methylmercuryhydroxide or formaldehyde
containing agarose gels and t r a n s f e r to n i t r o c e l l u l o s e f i l t e r s ,
the Pf3
s p e c i f i c species were i d e n t i f i e d by hybridization with nick t r a n s l a t e d Pf3 RF
DNA.
Congruent r e s u l t s were obtained; with the aid of both methods two major Pf3
s p e c i f i c t r a n s c r i p t s with an approximate length of 900 and 300 nucleotides
(nt) and several minor RNA t r a n s c r i p t s with lenghts of 3000, 1500, and 650 nt
were detected in Pf3 infected c e l l s (Fig. 2A).
No Pf3 s p e c i f i c RNAs became
v i s i b l e if for hybridization Pf3 v i r a l ssDNA, or v i r a l strand s p e c i f i c
from a Pf3 genomic l i b r a r y in Ml3mp8 were used (not shown).
probes
These r e s u l t s
together with the e s t a b l i s h e d genetic organization of the Pf3 genome (18)
101
A
A 5 6
1 2 3 4
7 8
-860/7
'810
M
mm
Figure 2. Зн-uridine labeled Pf3 s p e c i f i c RNA from infected P.aeruginosa
c e l l s , size fractionated on 2.5? polyacrylamide/7M urea g e l s , and I d e n t i f i e d
by h y b r i d i z a t i o n - s e l e c t i o n .
A. Lane 1, Pf3 s p e c i f i c RNAs selected by hybridization t o Pf3 RF immobilized
on n i t r o c e l l u l o s e ; lane 2, t o t a l RNA from Pf3 infected P.aeruginosa; lane 3,
t o t a l RNA from M13 infected E.coli K37 ( s i z e markers); lane U, t o t a l RNA from
uninfected P.aeruginosa.
B. Lane 1, t o t a l RNA from Ml 3 infected E.coli K37
c e l l s ; lane2, t o t a l RNA from Pf3 infected P.aeruginosa; lanes 3 through 8, Pf3
s p e c i f i c RNAs selected by Pf3 RF (lane 3 ) , and the strand- and r e g i o s p e c i f i c
probes A20 (lane 4), Al 5 (lane 5), Al (lane 6), H24 (lane 7 ) , and TH410 (lane
8).
i n d i c a t e that similar t o the filamentous E.coli phages Ff and IKe (1, 14, 23,
30), only the non-viral strand of Pf3 functions as a template for
transcription.
105
To identify the DNA region from which the two major RNAs were t r a n s c r i b e d ,
hybridization and s e l e c t i o n experiments were performed using defined
r e s t r i c t i o n fragments and r e g i o and s t r a n d - s p e c i f i c probes. I t was found that
both t r a n s c r i p t s were products of the DNA region encoding the MCP, and t h a t
the l a r g e s t RNA in addition contained ssDBP coding sequences (Figs. 1 and 2B).
This observation together with the established d i r e c t i o n of t r a n s c r i p t i o n
suggested that the major Pf3 t r a n s c r i p t s had i d e n t i c a l 3 ' but different
5'
terminal ends.
To verify t h i s hypothesis, SI nuclease mapping experiments were performed on
heteroduplexes formed between a 5 ' end-labeled Pf3 SaußA fragment
517^ t o 233, Fig. 1) labeled at i t s 5'-end with
32
(position
P , and t o t a l RNA from Pf3
infected P.aruglnosa c e l l s . Size f r a c t i o n a t i o n on a sequencing gel revealed
two major protected fragments.
As deduced from a known sequence pattern run
in p a r a l l e l , the smallest had a length of 239 nt (Fig. ЗА).
This located t h e
5' end of one of the two major RNA species at position 5831 of the wt Pf3
genomic sequence (18). The second protected fragment was only a l i t t l e smaller
than the Sau3A fragment (892 n t ) used. A more precise mapping experiment,
performed with a 5 ' end-labeled Hinfl fragment (position 4972 to 5442, Fig. 1)
yielded a protected fragment of 220 nt (Fig. 3B), thus positioning the 5 ' end
of the other RNA species at nucleotide 5226 of the wt Pf3 genomic sequence.
The lengths of the two major mRNAs together with the map positions of t h e i r
r e s p e c t i v e 5 ' ends suggested t h a t t h e i r 3 ' ends were located around p o s i t i o n
300 of the Pf3 genome, _i.e.
downstream of the MCP coding region (18, 19)
(Fig. 1). To map the 3' ends of both Pf3 s p e c i f i c mRNAs more precisely t h e SI
nuclease protection technique was applied t o heteroduplexes formed between
t o t a l RNA from Pf3 infected c e l l s and a 3' end labeled SaußA fragment located
from position 253 t o 546 of the Pf3 genome (Fig. 1 ) .
Surprisingly several
protected fragments were found varying in length from 50 to 60 n t , with a
major fragment of 59 nt (Fig. 4A).
However if a large excess of SI nuclease
was used only the protected fragment of 50 nt length remained (Fig. 4B).
There are several reasons to believe that the 50 nt band of the l a t t e r
experiment and the low mobility bands in the i n i t i a l experiment are the r e s u l t
of overdigestion of the heteroduplex.
Such a phenomenon i s not uncommon
p a r t i c u l a r l y if the terminus of the protected fragment i s rich in A/T bases
(31). Together with s t r u c t u r a l analogy of the DNA region concerned with the
E.coli rho independent t r a n s c r i p t i o n terminators (see below) the 59 nt band
106
A TCGA
SI
В TCGA
SI
•·=
_-
250
m
200
Figure 3. SI nuclease mapping of 5'end termini of Pf3 mRNA using a 5'end
labeled 892 bp SaußA fragment (A) and a 5'end labeled 471 bp Hinfl fragment
(B). The size marker sequence ladder was produced by dideoxy-sequencing of
IKe ssDNA with a 1 4 nt synthetic primer located from position 1695 (3'end) to
1682 (5'end) of the IKe genomic sequence (23)
most l i k e l y represents the primary protected fragment, and indicates t h a t both
major Pf3 s p e c i f i c t r a n s c r i p t s terminate at position 313 of the wt Pf3 genomic
sequence.
Summarizing the r e s u l t s of the hybridization and SI nuclease protection
experiments i t can be s t a t e d t h a t the two major Pf3 t r a n s c r i p t s have t h e i r 5 '
ends at position 5226 and 5831 of the Pf3 genomic sequence, r e s p e c t i v e l y , and
that the t r a n s c r i p t i o n of both mRNAs i s terminated most probably at position
313, giving r i s e t o RNA molecules that are 921 and 316 nt long.
The 3' end of these two Pf3 t r a n s c r i p t s has the i n t r i n s i c property to form a
stable stem and loop s t r u c t u r e of 24 nucleotides which i s followed by a
sequence r e l a t i v e l y r i c h in A/U r e s i d u e s .
Such a sequence is c h a r a c t e r i s t i c
of a rho independent t r a n s c r i p t i o n termination signal in E.coli (24).
Inspection of sequences located immediately upstream of the 5 ' ends of these
mRNAs indicated the presence of an E.coli l i k e promoter (13) at position 5226.
On the contrary, no sequences resembling the E.coli consensus promoter were
found immediately upstream of position 5831 (see f i g . 6 ) . This observation
leaves open the p o s s i b i l i t y that the smaller RNA was not generated by an
independent t r a n s c r i p t i o n i n i t i a t i o n event, but rather was the r e s u l t of
107
A TC GA 1 2
Й TC G A
12
60'
50'
АО'
Figure M. SI nuclease mapping of the 3' terminus of Pf3 mRNA using a 3'end
labeled 294 bp SaußA fragment, and 200 units (A) or 4000 units (B) of SI
nuclease during different incubation times. Lanes 1, 30 min; lanes 2, 15 min.
The sequence ladder was prepared as described in Figure 3·
processing of a larger precursor molecule.
Processing has been found to be an
important mechanism in the generation of functional mRNA species during the
infection cycle of the filamentous Ff phage (2, 26, 27), and t h i s p o s s i b i l i t y
has to be considered for Pf3 accordingly (see the next s e c t i o n ) .
Pf3 specified transcription in E . c o l i .
To find out whether t h e Pseudomonas (Pf3) s p e c i f i c t r a n s c r i p t i o n signals
were also functional
in E . c o l i , we studied the t r a n s c r i p t i o n of the Pf3 genome
or fragments thereof in E.coli both by in v i t r o and _in vivo methods.
In v i t r o t r a n s c r i p t i o n of Pf3 RF DNA with E.coli RNA polymerase r e s u l t e d in
the formation of several RNA species of which, with respect to t h e i r s i z e s ,
the major ones were i n d i s t i n g u i s h a b l e from the major t r a n s c r i p t s found in Pf3
infected P.aeruginosa c e l l s (Fig. 5). These t r a n s c r i p t s were also produced if
Bell l i n e a r i z e d Pf3 RF (cleavage at map position 1150, Fig. 1) was used as a
template.
Transcription of EcoRV l i n e a r i z e d Pf3 RF on the other hand r e s u l t e d
in RNA molecules that were approximately 200 and 800 nt long (Fig. 5 ) .
108
1
2 3
4 5 6
7
V4
i *
Figure 5. In v i t r o t r a n s c r i p t i o n of different Pf3 templates, size
fractionated on 1.5Î agarose gels containing formaldehyde (lanes 1 t o 3) or
methylmercuryhydroxide (lanes 4 to?) as denaturing agents. The templates used
were: Pf3 RF ( l a n e l ) , and Pf3 RF l i n e a r i z e d with Boll (lane 2 ) , EcoRV, or
Hindlll (lane 5). In lane 6 the in v i t r o t r a n s c r i p t i o n reaction was carried
out on a 1460 bp MboII fragment (position 4160-5620). An _in vivo mRNA
preparation and Pf3 Haell r e s t r i c t i o n fragments of 2766, 1722, 1020, and 325
bp were electrophoresed in lanes 4 and 7, r e s p e c t i v e l y , and visualized by
hybridization with 32p labeled Pf3 RF.
The l a t t e r observation can only be explained by premature t r a n s c r i p t i o n
termination at the EcoRV cleavage s i t e (run-off t r a n s c r i p t i o n ) . Since EcoRV
cleaves Pf3 RF at position 171 (18, 19, Fig. 1) the data prove that the two
major i_n v i t r o RNAs are transcribed from the DNA region encoding the ssDBP and
MCP.
Similar conclusions could be derived from t r a n s c r i p t i o n studies
performed on Pf3 RF l i n e a r i z e d with Hindlll (map position 1, Fig. 1), or on an
MboII fragment (map position 4160 to 5620, Figs. 1 and 5 ) .
In each case the
size of the run-off t r a n s c r i p t s indicated that they were i n i t i a t e d at or very
close t o Pf3 map position 5230 and 5830, i . e . at positions where also
109
the 5 ' termini of the major _in vivo Pf3 t r a n s c r i p t s were found. Because the
lengths of the in v i t r o RNAs transcribed from Pf3 RF or from Pf3 RF l i n e a r i z e d
with Bell (outside the ssDBP/MCP coding region) were i d e n t i c a l to those of the
major _ln vivo Pf3 RNAs, the data furthermore i n d i c a t e t h a t the Pf3 s p e c i f i c
t r a n s c r i p t i o n termination signal functioned c o r r e c t l y in the E.coli in v i t r o
t r a n s c r i p t i o n system.
Apparently the major t r a n s c r i p t i o n i n i t i a t i o n and termination signals of the
Pf3 genome are recognized by P.aeruginosa as well as by E.coli RNA polymerase.
To verify whether t h i s conclusion also holds for the in vivo s i t u a t i o n ,
r e s t r i c t i o n fragments harboring e i t h e r a Pf3 promoter or a terminator were
cloned in the promoter probe vectors pK02 and pKM2 (3) and in the
t r a n s c r i p t i o n terminator probe plasmid pKG1900 (21), r e s p e c t i v e l y .
These
vectors contain the E.coli galK gene, the expression of which can be detected
phenotypically in a gal К negative host ( e . g .
E.coli N100) using McConkey agar
plates containing galactose as the sole carbohydrate carbon source. In pK02
and pKM2 the galК gene i s not expressed unless a promoter sequence i s i n s e r t e d
in a proper o r i e n t a t i o n in the polylinker sequence preceding the galK
s t r u c t u r a l gene. On the contrary, c e l l s harboring pKG1900 do express the galК
gene fron the gal-operon promoter, but i n s e r t i o n of a t r a n s c r i p t i o n
termination signal
abolish t h i s
in between the promoter and the s t r u c t u r a l gene will
expression.
The Pf3 DNA r e s t r i c t i o n fragments used t o assay for t r a n s c r i p t i o n i n i t i a t i o n
a c t i v i t y , j^.e.
an Alul fragment (map position 5107 t o 53^5) and an
Rsal/Hindlll fragment (map position 5569 t o 1, see Fig. 1), were purified and
l i g a t e d s e p a r a t e l y into appropriately digested pK02. Subsequent transformation
of E.coli N100 c e l l s yielded only gal К positive colonies for the l a t t e r
r e s t r i c t i o n fragment. Plasmid i s o l a t i o n from the galK expressing colonies
followed by r e s t r i c t i o n enzyme mapping proved t h a t a l l contained the
Rsal/Hindlll fragment.
This r e s u l t thus confirmed the presence of a promoter
in t h i s region of the Pf3 genome, almost c e r t a i n l y coinciding with the
t r a n s c r i p t i o n i n i t i a t i o n s i t e found ijn v i t r o i n E.coli and in vivo in
P.aeruginosa.
In view of the strong in v i t r o promoter a c t i v i t y , located on the 238 bp Alul
fragment, the absence of galK p o s i t i v e transformants from l i g a t i o n of t h i s
fragment in pK02 was somewhat unexpected.
Several of the gal К negative
colonies, however, were shown to harbor pK02 Plasmids containing the 238 bp
Alul fragment, but in a l l cases the o r i e n t a t i o n of the promoter (as
110
identified
by SI nuclease mapping) was directed away from the galК gene.
t h a t t h e l i g a t i o n was succesfull,
This proved
but suggested t h a t only one of the
constructs yielded viable transformants.
I t i s well known however t h a t
overexpression of the galK gene may be l e t h a l t o E.coli ( 3 ) .
Therefore t h e
238 bp Alul fragment was l i g a t e d i n t o plasmid pKM2, which due t o the presence
of the XtR1 terminator between the promoter i n s e r t i o n s i t e and the galK
s t r u c t u r a l gene, i s s p e c i f i c a l l y
adapted for the analysis of strong promoters
( 3 ) . This approach did yield galK p o s i t i v e transformants, and r e s t r i c t i o n
enzyme mapping indicated t h a t indeed the fragment was inserted in such an
o r i e n t a t i o n t h a t promoter a c t i v i t y was directed towards the galK gene.
The f u n c t i o n a l i t y of the Pf3 t r a n s c r i p t i o n termination signal
in E.coli was
t e s t e d in a similar way by i n s e r t i o n of an Alul fragment extending from
position 169 through 419 of the Pf3 genetic map (Fig. 1), i n t o the unique Smal
s i t e of pKG1900.
Transformation of t h e l i g a t i o n mixture t o E.coli N100
yielded both galК positive and negative c o l o n i e s . Plasmid DNA i s o l a t i o n of
several
of these colonies indicated t h a t the galK phenotype was not only
dependent on the presence or absence of an i n s e r t e d fragment, but a l s o on the
o r i e n t a t i o n of the fragment. Only in c e l l s containing Plasmids in which, with
respect t o the d i r e c t i o n of t r a n s c r i p t i o n , the o r i e n t a t i o n of the Pf3
t r a n s c r i p t i o n termination signal was i d e n t i c a l t o t h a t in Pf3, galK expression
was abolished.
From the r e s u l t s obtained i t can be concluded t h a t the two major promoters and
a t r a n s c r i p t i o n terminator of the Pf3 genome are functional s i g n a l s both in
P.aeruginosa and in E . c o l i .
DISCUSSION
The knowledge of t h e nucleotide sequence and genetic organization of the
Pf3 genome (18, 19) has allowed us to use the genome of t h i s phage as a model
system for studying gene expression,
P.aeruginosa.
and in p a r t i c u l a r gene t r a n s c r i p t i o n in
Analysis of the RNAs synthesized in infected P.aeruginosa
cells
revealed the presence of two major Pf3 s p e c i f i c t r a n s c r i p t s with a length of
111
approximately 900 and 300 n t , and several minor ones of 3000, 1500, and 650
nt. The use of strand s p e c i f i c hybridization probes has furthermore revealed
that each of these RNAs i s transcribed from the non-viral strand of Pf3 RF. In
t h i s respect the d i r e c t i o n of t r a n s c r i p t i o n of the Pf3 genome i s in accordance
with that already deduced from i t s genomic sequence (18), and i s i d e n t i c a l to
the mode of t r a n s c r i p t i o n of the well studied E.coll phages Ff and IKe ( 1 , 14,
23, 30).
Studies with respect t o the o r i g i n of the Pf3 s p e c i f i c t r a n s c r i p t s by
hybridization t o regio s p e c i f i c DNA probes remained inconclusive for the minor
RNA species. This i s mainly due to the fact that for the 3000 and 1600 nt
species aspecific hybridization with rRNA could not be excluded or t o the fact
that only very small amounts of these RNA species are present in infected
cells.
However, the 900 nt mRNA was shown to contain the coding regions of
the Pf3 ssDBP and MCP, whereas the 300 nt mRNA originated exclusively from the
MCP coding region.
These two major t r a n s c r i p t s have an i d e n t i c a l 3 ' terminal end which i s located
around map position 313, while t h e i r 5 ' terminal ends were located at position
5226 and 5831 of the Pf3 genomic sequence, r e s p e c t i v e l y , as demonstrated by
high r e s o l u t i o n SI nuclease mapping experiments.
E s s e n t i a l l y the same RNA species were transcribed from the ssDBP/MCP
coding region if Pf3 RF was transcribed in an _in v i t r o system by E.coli RNA
polymerase.
These r e s u l t s , together with the data obtained from studies with
promoter and terminator probe Plasmids demonstrate that the Pf3 t r a n s c r i p t s
are the r e s u l t of independent t r a n s c r i p t i o n i n i t i a t i o n (and termination)
events.
From these r e s u l t s several additional conclusions can be drawn. With respect
to t r a n s c r i p t i o n i n i t i a t i o n i t i s evident that the major promoters of the Pf3
genome are functional both in P.aeruginosa and in E . c o l i .
The promoter
i n i t i a t i n g t r a n s c r i p t i o n at position 5226 of the Pf3 genome may even be
considered a very strong promoter in both s p e c i e s .
This i s i l l u s t r a t e d by the
fact t h a t the mRNA i n i t i a t i n g at t h i s position i s very abundant in
P.aeruginosa, and that in E.coli only attenuation by the XtRI terminator,
which aborts about 90Í of the t r a n s c r i p t s reaching i t ( 3 ) , r e s u l t e d in nontoxic l e v e l s of galactokinase.
Inspection of the nucleotide sequence of the DNA region upstream of the
t r a n s c r i p t i o n i n i t i a t i o n s i t e at position 5226 revealed a s i g n i f i c a n t homology
with the E.coli consensus pronoter (13), whereas no E.coli l i k e promoter
112
"-35"
TTGACA
E.coli
Pf3 DBP
"-10"
TATAAT
caaaaaagtacTTGcaAgttcccgaaaccctgtcTAgAgTtctaggtgcat
5200
Pf3 MCP
+1
A
+1
agcttgttaatgatgtttgtcatgaatgggctgaacgttcagatttgcta
5800
+1
Figure 6. Nucleotide sequences of the Pf3 promoters identified in vivo in
P.aeruginosa and in vivo and in vitro in E.coli, aligned with the E.coli
consensus promoter sequence. Homolous bases are in upper case l e t t e r s .
sequence was found immediately upstream of position 5831 (Fig. 6).
observation thus might explain the relative efficiency
This
(strength) of these Pf3
promoters in E.coli, both in the _in vitro and in vivo system.
Only a few Pseudomonas promoters have been characterized up to now.
most of these promoters are positively regulated by specific
Because
protein factors,
their nucleotide sequences cannot be considered representative for
constitutive Pseudomonas promoters (22).
and
From a direct comparison of P.putida
E.coli RNA polymerases with respect to their interaction with several
E.coli promoters present on plasmid pBR322 no differences
in binding
characteristics were observed (10). Recently i t has also been shown that
P.aeruginosa efficiently
(28).
recognizes the E.coli consensus promoter sequence
Our results demonstrate that also the opposite is true, i_.e.
that
Pseudomonas promoters are recognized by E.coli RNA polymerase.
A similar conclusion can be drawn for the transcription termination signal.
The
Pf3 terminator i s composed of an inverted repeat, able to form a stable
hairpin loop structure in the nascent mRNA, which i s followed
in Τ and A residues
rho
by a region rich
(Figure 7). This structure i s clearly similar to that of
factor independent transcription terminators in E.coli (24). The observed
unidirectionality of the Pf3 terminator in E.coli indicates that not only the
possible secondary structure, but also the nature of the residues following
the
inverted repeat, determine transcription termination
efficiency.
As with the other filamentous bacteriophages isolated so far,
Pf3
infection of i t s natural host P.aeruginosa harboring the broad host range
plasmid RP1 does not k i l l nor lyse the host cell (29).
Instead, infection
results in a bacterium that continuously extrudes progeny phage through the
cell membrane and wall, but is s t i l l
capable of growth (5, 29).
113
τ с
т
С
G
G
G
G
G
G
G
С
Τ
С
С
С
A Τ
Τ A
AT
TCAATTCGTT
280
AG = - 1 0 . 7
j
i,
TCGTTTAGCGGC
310
Figure 7. Sequence of the Pf3 t r a n s c r i p t i o n termination signal. The inverted
repeat s t r u c t u r e i s depicted as a hairpin loop. RNA 3 ' termini detected with
SI nuclease mapping are indicated by arrows. The Gibbs free energy of the
hairpin loop was calculated according t o F r e i e r et a l . ( 9 ) .
Both the continuous production of phage and the s u b t l e
parasitical
r e l a t i o n s h i p with the host require a s t r i c t l y regulated expression of the
coding regions of the filamentous phage genome.
Despite of the absence of
homology between the genomes of Pf3 and the E.coli specific filamentous phages
Ff (18), a d i s t i n c t s i m i l a r i t y emerges with respect t o the expression of the
ssDBP and the MCP coding regions of t h e i r genomes.
The synthesis of the
proteins encoded by the Ff phage genome i s regulated to a significant
by the a v a i l a b i l i t y
extent
of functional messenger RNA ( 1 6 ) . To t h i s end the Ff phage
has developed a t r a n s c r i p t i o n s t r a t e g y in which the r e l a t i v e positions of
t r a n s c r i p t i o n i n i t i a t i o n and termination s i t e s , the frequency of t r a n s c r i p t i o n
i n i t i a t i o n and the e x p l o i t a t i o n of host encoded RNA processing systems (2, 26)
are the main factors determining mRNA a v a i l a b i l i t y .
For the highly
expressed
DNA region encoding the single-stranded DNA binding protein and the major coat
protein t h i s s t r a t e g y r e s u l t s in a nested set of t r a n s c r i p t s with different
5'
ends, but with i d e n t i c a l 3' ends located at a strong rho-independent
t r a n s c r i p t i o n termination signal downstream of the major coat protein gene.
In t h i s respect Pf3 appears to employ a similar s t r a t e g y as the Ff phages in
r e g u l a t i n g the expression of i t s ssDBP and MCP.
Unfortunately, t h i s observation does not shed l i g h t on the evolutionary
r e l a t i o n s h i p between Pf3 and the filamentous E.coli phages. I t could in fact
be in favour of both the divergent and convergent evolution hypotheses
mentioned in a previous paper (18). A d e f i n i t i v e
IH
answer to t h i s question must
a w a i t t h e g e n e t i c a n a l y s i s of o t h e r members of t h i s c l a s s of
bacterial
viruses.
ACKNOWLEDGMENTS
We a r e g r a t e f u l
t o D r s . McKenney and de Boer f o r t h e g i f t
and Plasmids pK02 and pKM2, r e s p e c t i v e l y .
of plasmid pKGI900
We t h a n k P e t e r - P a u l B i e r m a n s ,
Benen, Marja Timmermans, Guy Honnée and E r i c C l a a s f o r t h e i r
different
a s p e c t s of t h i s s t u d y .
contributions
Dr. L e t t i e Lubsen i s acknowledged
c r i t i c a l r e a d i n g of t h e m a n u s c r i p t and h e l p f u l
Jac.
to
for
advise.
LITERATURE CITED
1.
Beck, E . , R. Sommer, E.A. Auerswald, C. Kurz, В. Z i n k , G. O s t e r b u r g , H.
S c h a l l e r , К. Sugimoto, H. S u g i s a k i , T. Okamoto, and M. Takanami. 1978.
N u c l e o t i d e s e q u e n c e of b a c t e r i o p h a g e fd DNA.
N u c l e i c Acids Res. 1 2 :
1Й 95-¿4 503.
2.
Blumer, K . J . ,
and D.A. S t e e g e .
1984. mRNA p r o c e s s i n g i n E s c h e r i c h i a
c o l i : an a c t i v i t y encoded by t h e h o s t p r o c e s s e s b a c t e r i o p h a g e fi mRNAs.
N u c l e i c Acids Res. 1_2: 1 8 4 7 - 1 8 6 1 .
3.
de Boer, H.A. 1984. A v e r s a t i l e plasmid system f o r t h e s t u d y of
prokaryotic transcription signals in Escherichia c o l i .
Gene 3 0 : 2 5 1 -
255.
4.
C l a r k e , P . H . , and M.H. Richmond. 1975. G e n e t i c s and b i o c h e m i s t r y of
Pseudomonas. Wiley,
5.
London.
D e n h a r d t , D . T . , D. D r e s s i e r ,
and D.S. Ray, ( e d . ) . 1978. The s i n g l e -
s t r a n d e d DNA p h a g e s . Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g H a r b o r ,
NY.
115
6.
Edens, L., R.N.H. Konings, and J.G.G. Schoenmakers. 1976. Mapping of
promoter s i t e s on t h e genome of b a c t e r i o p h a g e M13.
Eur. J. Biochem.
70: 577-587.
7.
Eggink, G., P.H. van L e l y v e l d , A. Arnberg, N. Arfman, C. W i t t e v e e n , and
B. W i t h o l t . 1987. S t r u c t u r e of the Pseudomonas p u t i d a alkBAC o p e r o n .
J . B i o l . Chem. 262, 6400-6406.
8.
F r a n k l i n , F . C . H . , M. B a g d a s a r i a n , M.M. B a g d a s a r i a n , and K.N. Timmis.
1981. A m o l e c u l a r and f u n c t i o n a l
a n a l y s i s of t h e TOL plasmid pWWO from
Pseudomonas p u t i d a and c l o n i n g of t h e genes f o r t h e e n t i r e r e g u l a t e d
a r o m a t i c r i n g meta c l e a v a g e pathways.
P r o c . N a t l . Acad. S c i . USA 7 8 :
7458-7462.
9.
Freier,
S.M., R. K i e r z e k , J.A. J a e g e r , N. Sugimoto, M.H. C a r u t h e r s , T.
Neilson,
and D.H. T u r n e r . 1986. Improved f r e e - e n e r g y parameters
p r e d i c t i o n s of RNA duplex s t a b i l i t y .
for
P r o c . N a t l . Acad. S c i . USA 8 3 :
9373-9377.
10.
Gragerov, A . I . , A.A. Chenchik, V.A. A i v a s a s h v i l l i ,
B e a b e a l a s h v i l l i , and V.G. N i k i f o r o v .
R.Sh.
1984. E . c o l i and P . p u t i d a RNA
polymerases d i s p l a y i d e n t i c a l c o n t a c t s with p r o m o t e r s .
G e n e t . 195:
11.
Mol. Gen.
511-515.
H a a s , D. I 9 8 3 . G e n e t i c a s p e c t s of b i o d é g r a d a t i o n by Pseudomonas.
Experi e n t i a 39: 1199-1213.
12.
Harayama, S . ,
P.R. Lehr bach, and K.N. Timmis. 1984. Transposon
m u t a g e n e s i s of meta cleavage pathway operon genes of t h e T0L plasmid of
P.putida mt-2.
13.
H a r l e y , C . B . , and R.P. Reynolds. 1987. A n a l y s i s of E . c o l i
sequences.
14.
promoter
N u c l e i c Acids Res. 1_5: 2 3 4 3 - 2 3 6 1 .
H i l l , D . F . , and G.B. P e t e r s e n . 1982. N u c l e o t i d e sequence of
b a c t e r i o p h a g e fi
116
J . B a c t e r i o l . 1_60: 2 5 1 - 2 5 5 .
DNA.
J. Virol. 44: 32-46.
15.
Huetter, R., and T. Leisinger
( e d . ) . 1981. Microbial degradation of
xenobiotics and r e c a l c i t r a n t compounds.
16.
Academic Press, London.
LaFarina, M., and P. Model. 1983. T r a n s c r i p t i o n in bacteriophage fi
infected E . c o l i . Messenger populations in the infected c e l l .
Biol. Ш :
17.
J. Mol.
377-393.
Luiten, R.G.M., R.I.L. Eggen, J.G.G. Schoenmakers, and R.N.H. Konings.
1987. Spontaneous deletion mutants of bacteriophage Pf3: Mapping of
s i g n a l s involved in r e p l i c a t i o n and assembly.
18.
DNA 6_: 129-137.
Luiten, R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings,
and L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1
Plasmid s p e c i f i c filamentous phage of Pseudomonas aeruginosa.
J.
Virol. 56: 268-276.
19.
Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The
major coat protein gene of the filamentous Pseudomonas aeruginosa phage
Pf3: Absence of an N-terminal leader signal sequence. NucleicAcids Res.
n_: 8073-8085.
20.
Maniatis, T., E.F. F r i t s c h , and J. Sambrook. 1982. Molecular cloning. A
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor.
21.
McKenney, K., H. Shimatake, D. Court, U. Schmeissner, С Brady, and M.
Rosenberg. 1981. A system to study promoter and terminator s i g n a l s
recognized by Escherichia c o l i RNA polymerase, i n : J.G. C h i r i k j i a n , and
T.S. Papas ( e d . ) . Gene amplification and a n a l y s i s . Structural Analysis
of Nucleic Acids, vol. 2. Elsevier,
22.
New York. рр383-^15.
Mermod, N.. P.R. Lehrbach, W. Reineke, and K.N. Timmis. 1984.
Transcription of t h e TOL plasmid t o l u a t e catabolic pathway operon of
Pseudomonas putida i s determined by a pair of coordinately and
p o s i t i v e l y regulated overlapping promoters.
23.
EMBO J. 3: 2461-2466.
Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings.
1985. Nucleotide sequence and genetic organization of the genome of the
N-specific filamentous bacteriophage IKe.
J. Mol. Biol. 181 : 27-39.
117
24.
P l a t t , T. 1986. Transcription termination and the regulation of gene
expression.
25.
Ann. Rev. Biochem. 55: 339-372.
Rivera, M.J., M.A. Smits, W. Quint, J.G.G. Schoenmakers, and R.N.H.
Konings. 1978. Expression of bacteriophage M13 DNA in vivo.
Localization of the t r a n s c r i p t i o n i n i t i a t i o n and termination signal of
the mRNA coding for the major capsid p r o t e i n .
Nucleic Acids Res. 5:
2895-2912.
26.
Smits, M.A., J. Jansen, R.N.H. Konings, J.G.G. Schoenmakers. 1984.
I n i t i a t i o n and termination signals for t r a n s c r i p t i o n in bacteriophage
M13.
27.
Nucleic Acids Res. J_2: 4071-4081.
Smits, Μ.Α., J.G.G. Schoenmakers, and R.N.H. Konings. 1980.
Expression
of bacteriophage M13 DNA in vivo. I s o l a t i o n , i d e n t i f i c a t i o n , and
c h a r a c t e r i z a t i o n of phage s p e c i f i c mRNA species.
Eur. J. Biochem. 112:
309-321.
28.
S o l d a t i , L., D.J. Jeenes, and D. Haas. 1987. Effective
gene expression
in Pseudomonas aeruginosa under the control of the Escherichia c o l l
consensus promoter.
29.
FEMS Microbiol. L e t t . 42^ I63-I67.
Stanisich, V.A. 1974. The properties and host range of
bacteriophage of
Pseudomonas aeruginosa.
male-specific
J . Gen. Microbiol. 84_: 332-
342.
30.
Van Wezenbeek,
P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers.
1980. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome:
Comparison with phage fd.
31.
Gene 1_1_: 129-148.
Weaver, R.F., and C. Weismann. 1979. Mapping of RNA by a modification
of the Berk-Sharp procedure: the 5 ' termini of 15S 8-globin mRNA
precursor and mature 10S ß-globin mRNA have i d e n t i c a l map
Nucleic Acids Res. 7:
118
1175-1193.
coordinates.
SUMMARY
Pf3 i s a filamentous bacteriophage s p e c i f i c for Pseudomonas aeruginosa 0
harboring a conjugative
plasmid of the incompatibility group P-1.
The virion
i s about 700 nm long and has a diameter of about 6 nm, and i s the smallest
filamentous bacteriophage i s o l a t e d thus far.
Similar to a l l other filamentous
b a c t e r i a l v i r u s e s , Pf3 infection r e s u l t s in extrusion of progeny phage i n t o
the c u l t u r e medium without k i l l i n g of the host c e l l .
The virion consists of a
c i r c u l a r single-stranded DNA genome encapsidated in a f l e x i b l e tube formed by
a large number of major coat protein subunits and several copies of at l e a s t
one other (minor) coat p r o t e i n .
To gain i n s i g h t i n t o the evolutionary r e l a t i o n s h i p of Pf3 with the other
characterized filamentous bacteriophages, in p a r t i c u l a r with the Escherichia
coli specific phages Ff and IKe, a molecular genetic study of the genome of
Pf3 was undertaken. An additional aim of t h i s project was to study gene
expression and DNA r e p l i c a t i o n in Pseudomonas, and t o map the s i g n a l s involved
in these
processes.
Chapter 1 deals with the c h a r a c t e r i z a t i o n of the Pf3 major coat protein
gene and i t s encoded protein product. I t appeared t h a t , contrary t o the major
coat proteins of the bacteriophages Ff, IKe, If 1, and Pf1, the Pf3 major coat
protein i s not synthesized via a precursor protein containing a leader peptide
at i t s N-terminal end.
This leader peptide i s supposed to be responsible
for
c o t r a n s l a t i o n a l i n s e r t i o n of the coat protein in the cytoplasmic membrane, and
i s removed during or s h o r t l y after t h i s process.
The absence of a leader
peptide in the primary t r a n s l a t i o n product of the Pf3 major coat protein gene
thus might suggest t h a t t h i s protein i s not a membrane p r o t e i n . However, the
s t r i k i n g s i m i l a r i t y in the d i s t r i b u t i o n of hydrophobic amino acids in the Pf3
major coat protein and the mature major coat proteins of the other phages, and
the fact that filamentous phage morphogenesis and extrusion are processes
that
are closely associated with the host cell membrane prompted us to conclude
that the Pf3 major coat protein must be a membrane p r o t e i n . Because of the
length of the Pf3 major coat protein (ИЧ amino acids) i n s e r t i o n of t h i s
protein in the membrane must occur
post-translationally.
121
In chapter 2 the complete nucleotide sequence of the single-stranded
genome of Pf3. as determined independently by two research groups, i s
presented.
The circular Pf3 genome consists of 5833 nucleotides. Two genes
have been i d e n t i f i e d : the major coat protein gene described in chapter 1, and
a gene that codes for a single-stranded DNA-binding p r o t e i n .
Neither these
genes nor any other part of the Pf3 DNA sequence displays significant homology
with the genomic sequences of the phages Ff or IKe. The overall genome
organization of Pf3i i . e . the two genes mentioned and the order and size of
seven other open reading frames, shows a s t r i k i n g s i m i l a r i t y t o the genetic
organization of the phages Ff and IKe. This s i m i l a r i t y , however, i s too small
to permit a prediction with respect to the functions of the proteins encoded
by the Pf3 open reading frames.
The discovery and characterization of spontaneous deletion mutants
(miniphages) of Pf3 i s the subject of chapter 3. Miniphages contain a c i r c u l a r
single-stranded DNA molecule that i s up to 80Í smaller than the wt Pf3 genome,
r e s u l t i n g in equally shortened viral filaments. Three different miniphages
have been studied in d e t a i l . The nucleotide sequence of t h e i r genomes revealed
that they evolved via deletion of a large segment of the wt Pf3 genome,
probably via a similar mechanism involving short direct r e p e a t s . In the wt Pf3
genome these direct repeats flank on both sides the DNA fragment present in
the miniphage genome, whereas
in the miniphage DNA only a single copy of t h i s repeat was present, thereby
joining the ends of the preserved DNA fragment. One miniphage genome contained
a tandemly duplicated sequence and from i t s s t r u c t u r e i t could be concluded
that the deletion had preceded the duplication event.
The duplicated fragment
also appeared to be flanked by short direct r e p e a t s , one copy of which
remained at the link between the duplicated segments, suggesting that the
deletions and duplications had occurred via a similar process, most probably
via a "slipped mispairing" mechanism.
Downstream slipping of the 3'end of the
growing DNA strand thus would r e s u l t in a deletion of DNA sequences, whereas
slipping upstream would r e s u l t in a (tandem) duplication.
This mechanism i s
p a r t i c u l a r l y appealing because the single-stranded DNA intermediates in the
r e p l i c a t i o n cycle of filamentous bacteriophage genomes might f a c i l i t a t e the
growing DNA strand to complementary sequences on the template DNA. This
process may apply to a l l DNA molecules r e p l i c a t i n g via single-stranded DNA
intermediates, e.g.
122
Bacillus and Streptomyces Plasmids, and thus may be one
of the major factors determining the observed s t r u c t u r a l i n s t a b i l i t y of these
Plasmids.
The genomes of a l l three miniphages have one segment of wt Pf3 DNA in common.
From the fact t h a t in the presence of wt helper phage, a l l three Pf3
miniphages are r e p l i c a t e d e f f i c i e n t l y , and are assembled into (defective)
single-stranded DNA containing filamentous p a r t i c l e s i t can be concluded that
the DNA region shared by a l l three miniphage genomes contains the Pf3
morphogenetlc signal and the r e p l i c a t i o n o r i g i n s for the synthesis of both the
v i r a l and the complementary s t r a n d .
A more detailed characterization of the origin of viral strand synthesis
i s described in chapter H.
By using in v i t r o deletion mapping techniques, the
region containing a functional origin of v i r a l strand r e p l i c a t i o n could be
reduced to 139 b a s e p a i r s .
Similar t o the v i r a l strand origins of the phages
Ff and IKe, the Pf3 origin of v i r a l strand r e p l i c a t i o n encodes r e p l i c a t i o n
i n i t i a t i o n as well as termination functions.
Although the nucleotide sequence
of the Pf3 v i r a l strand r e p l i c a t i o n origin i s not homologous at a l l with that
of the phages Ff or IKe, a feature shared by a l l these origins i s the presence
of inverted repeat sequences. This s t r u c t u r a l element is thought to function
as a recognition and attachment signal for DNA r e p l i c a t i o n p r o t e i n s .
From the
fact that the functional analyses of the deletion mutants could be performed
in E.coli i t follows that Pf3 i s able to r e p l i c a t e in t h i s host as well.
In chapter 5 studies with respect to the mechanism of expression of part
of the Pf3 genome _in vivo in infected P. aeruginosa and both _ln vivo and in
v i t r o in E.coll are described.
Within the domain encoding the single-stranded
DNA binding protein and major coat protein
two Pf3 s p e c i f i c messenger RNAs have been mapped.
Transcription of one of the
mRNAs i s i n i t i a t e d 301 basepairs upstream of the single-stranded DNA-binding
protein gene, whereas synthesis of the other mRNA i s i n i t i a t e d 122 basepairs
upstream of the major coat protein gene.
terminated at an i d e n t i c a l position, i . e .
major coat protein gene.
The synthesis of both mRNAs i s
60 basepairs downstream of the
Despite the fact that only one Pf3 promoter showed
homology with the E.coli consensus promoter sequence, both t r a n s c r i p t i o n
i n i t i a t i o n s i t e s were shown to be recognized in an _in vivo and an _in v i t r o
E.coli t r a n s c r i p t i o n system.
Also the Pf3 t r a n s c r i p t i o n termination signal
was recognized e f f i c i e n t l y in these heterologous systems. These r e s u l t s
demonstrate that differences in t r a n s c r i p t i o n of genes shuttled from
123
Pseudomonas t o E.coli or vice versa, are not the r e s u l t of differences in
promoter sequences or t r a n s c r i p t i o n factors l i k e RNA polymerase, but more
probably r e f l e c t differences in gene regulatory mechanisms exploited by these
two h o s t s .
Summarizing i t can be s t a t e d that not many evolutionary p a r a l l e l s have
been detected between the filamentous bacteriophage Pf3 and the evolutionary
r e l a t e d phages Ff and IKe. Although there i s some s i m i l a r i t y in genetic
organization, a direct comparison of e i t h e r t h e i r nucleotide sequences or the
amino acid sequences of t h e i r encoded proteins did not give clues as to the
evolutionary r e l a t i o n s h i p between Pf3 and the E.coll specific phages.
Therefore the hypothesis that filamentous bacteriophages have originated and
evolved fron the same ancestor i s not supported by the experimental data
presented.
I t might therefore well be that Pf3 has evolved from another ancestor than the
phages Ff or IKe. In t h i s connection i t i s appealing t o r e c a l l the s t r u c t u r a l
and functional s i m i l a r i t i e s between filamentous bacteriophages, conjugative
Plasmids, and t h e i r encoded p i l i .
The fact that conjugative plasmids not only
carry the genetic information for the different constituents of the p i l u s , but
also for the proteins and DNA signals involved in the r e p l i c a t i o n and t r a n s f e r
of single-stranded DNA to the acceptor c e l l , has firmly been established.
Reversing the hypothesis of Brinton that conjugative plasmids are a
specialized c e l l associated form of bacteriophage, leads to a new hypothesis
that t h a t different
(subclasses of) filamentous viruses have evolved from
different conjugative plasmids.
Future research of conjugative plasmids and filamentous bacteriophages may
shed l i g h t on the v a l i d i t y of these hypotheses.
124
SAMENVATTING
Pf3 i s een bakterieel virus (bakteriofaag of faag) welke Pseudomonas
aeruginosa bakterien i n f e k t e e r t . Samen met een aantal gelijkvormige
bakteriofagen behoort Pf3 t o t de klasse van filamenteuze fagen ( I n o v i r i d a e ) ,
d.w.z. virussen met een draadvormig u i t e r l i j k . Het Pf3 v i r u s d e e l t j e i s een
f l e x i b e l e buis met een diameter van 6 nm en een lengte van ongeveer 700 nm. De
buis bestaat voornamelijk uit een groot aantal identieke eiwitmolekulen, de
zogenaamde (hoofd-)manteleiwitten, die een c i r c u l a i r enkelstrengs DNA
molekuul, het v i r a l e genoom of chromosoom, omsluiten. Waarschijnlijk bevat het
virusdeeltje nog enkele molekulen van een aantal andere eiwitten, maar s l e c h t s
één hiervan i s t o t nog toe ondubbelzinnig aangetoond.
Om diverse redenen i s Pf3 het onderwerp van de in d i t
proefschrift
beschreven molekulair genetische studie geworden. Allereerst was er de vraag
of Pf3, een P.aeruginosa v i r u s , evolutionair verwant was aan de goed
bestudeerde Escherichia c o l i fagen Ff (M13, fi en fd) en IKe. Deze l a a t s t e
virussen zijn eveneens filamenteus van vorm, en hebben eenzelfde levenscyclus
als Pf3: opmerkelijk aan deze levenscyclus i s dat de bakteriecel als gevolg
van de i n f e k t i e n i e t wordt gedood.
De door een filamenteuze faag
geinfekteerde bakterie b l i j f t groeien en delen, zij het minder snel dan een
niet geinfekteerde c e l . Intakte virusdeeltjes komen binnen de cel niet voor.
De reden hiervan i s dat de assemblage van nakomeling virussen plaatsvindt aan
de celmembraan. G e l i j k t i j d i g met deze assemblage wordt het faagdeeltje door de
celmembraan en -wand heen de cel uit getransporteerd. Deze voor a l l e
filamenteuze overeenkomstige levenscyclus suggereert dat al deze virussen aan
elkaar verwant z i j n , en mogelijk afstammen van een gemeenschappelijke
voorouder. De beste manier om deze verwantschap t e bestuderen i s door de
basenvolgorde van de r e s p e k t i e v e l i j k e v i r a l e genomen met elkaar t e
vergelijken. Vooral op d i t nivo, of via funktionele of sekwentie
overeenkomsten in de door deze genomen gekodeerde eiwitten, kan een eventuele
evolutionaire r e l a t i e goed worden vastgesteld. Een aldus opgezette
vergelijkende studie tussen de bakteriofagen Ff en IKe heeft aangetoond dat
deze twee virussen inderdaad evolutionair verwant z i j n . Uit onderzoek van Pf3
127
zou nu kunnen blijken of ook een filamenteus v i r u s , specifiek voor een geheel
andere soort b a k t e r i e , t o t dezelfde genetische familie behoort.
Een tweede belangrijke reden voor de keuze van Pf3 als onderzoeksobjekt
was het f e i t dat Pf3 a l s gastheer P.aeruginosa heeft.
Het afgelopen decennium
zijn bakterien uit het geslacht Pseudomonas s t e r k in de belangstelling komen
t e s t a a n . Reden hiervoor i s vooral het f e i t dat deze groep bakterien in s t a a t
i s vele door de mens in de natuur gebrachte chemicaliën, zoals bijvoorbeeld
tolueen en naftaleen, af te breken. Onderzoek heeft aangetoond dat de genen
welke voor de bij de afbraak van voornoemde chemicaliën betrokken enzymen
köderen, n i e t zonder meer in E.coli tot expressie kunnen worden gebracht. Deze
gegevens suggereren dat de mechanismen van genexpressie in E.coll en
Pseudomonas sterk van elkaar v e r s c h i l l e n . Onderzoek naar de genexpressie van
Pf3 kan nu u i t s l u i t s e l geven over de aard van dit v e r s c h i l : zijn er
fundamentele verschillen tussen de expressiesignalen, en dus ook tussen de
enzymen die voor de expressie verantwoordelijk zijn (b.v. RNA polymerase), of
i s het verschil in expressie terug t e voeren t o t verschillen in genregulatiemechanismen?
In de afzonderlijke hoofdstukken zijn de r e s u l t a t e n beschreven van
s t u d i e s , die bovengenoemde vragen pogen te beantwoorden.
In hoofdstuk 1 wordt de k a r a k t e r i s e r i n g beschreven van het gen dat voor
het b e l a n g r i j k s t e mantel eiwit van Pf3 kodeert.
Tevens wordt ingegaan op
enkele eigenschappen van het door d i t gen gekodeerde e i w i t .
Het primaire
t r a n s l a t i e p r o d u k t van het manteleiwitgen i s ΊΊ aminozuren lang en volkomen
identiek met het eiwit dat in het Pf3 v i r u s d e e l t j e voorkomt. De struktuur van
dit gen, en dus ook van het primaire t r a n s l a t i e p r o d u k t , wijkt daarmee
duidelijk af van de struktuur van de overeenkomstige genen van een v i e r t a l
andere filamenteuze bakteriofagen, t e weten Ff, IKe, I f 1 , en Pf 1.
Het
manteleiwitgen van deze fagen kodeert voor een zogenaamd precursor e i w i t .
In
deze precursor wordt het " r i j p e " manteleiwit, i . e . het eiwit zoals dat in het
v i r u s d e e l t j e wordt aangetroffen, voorafgegaan door een twintig t o t d e r t i g
aminozuren lange signaalsekwentie. Dit signaalpeptide i s ervoor
verantwoordelijk dat het manteleiwit tijdens (of na) de synthese in de
celmembraan terechtkomt. Na membraaninsertie van het precursore!wit wordt het
signaalpeptide a f g e s p l i t s t . Het f e i t dat het Pf3 manteleiwitgen niet voor een
dergelijk signaalpeptide kodeert zou kunnen betekenen dat het manteleiwit niet
in de membraan geinserteerd wordt. Echter, de duidelijke overeenkomsten in de
128
verdeling van
hydrofobe aminozuur residuen in het Pf3 manteleiwit en de r i j p e
mantel eiwitten van de andere genoemde filamenteuze bakteri ofagen, én het f e i t
dat de assemblage en extrusie van filamenteuze fagen nauw geassocieerd zijn
met de bakteriele celmembraan, wijzen er s t e r k op dat het Pf3 manteleiwit na
synthese toch in de membraan wordt geinserteerd. De i n s e r t i e in de membraan
kan, omdat het eiwit slechts 44 aminozuren lang i s , echter pas plaatsvinden
nadat het komplete eiwit van het ribosoom i s vrijgekomen (postt r a n s l a t i o n e e l ) , d i t in t e g e n s t e l l i n g t o t de membraaninsertie van de
manteleiwitten van de andere filamenteuze fagen, die waarschijnlijk al tijdens
de synthese via het signaal peptide aan de membraan worden verankerd (cotranslationeel).
In hoofdstuk 2 wordt de volledige nukleotidesekwentie van het genoom van
Pf3 beschreven, zoals deze door twee onderzoeksgroepen onafhankelijk van
elkaar i s bepaald. Het c i r c u l a i r e Pf3 genoom bestaat u i t 5833 nukleotiden.
Twee genen van dit genoctn zijn ondubbelzinnig g e ï d e n t i f i c e e r d , t e weten het
manteleiwitgen (beschreven in hoofdstuk 1), en een gen dat kodeert voor een
enkelstrengs DNA bindend eiwit. Deze genen, noch enig ander gen van het Pf3
genoom vertonen een s i g n i f i k a n t e homologie met de genomische DNA sekwenties
van de bakteriofagen Ff en IKe. De ligging van deze twee genen ten opzichte
van elkaar, en de volgorde en grootte van zeven andere open leesramen l i j k e n
echter wel s t e r k op de genorganisatie van Ff en IKe. Deze overeenkomst i s
echter t e beperkt om op basis hiervan funkties t e kunnen postuleren voor de
door de open leesramen gekodeerde Pf3 eiwitten.
In hoofdstuk 3 worden de ontdekking en k a r a k t e r i s e r i n g van spontane
deletiemutanten van Pf3 (minifagen) beschreven. Deze minifagen bevatten een
c i r c u l a i r enkelstrengs DNA molekuul dat t o t 80% kleiner i s dan het wildtype
Pf3 genoom. Het assembleren van een dergelijk klein DNA molekuul t o t een
"faag" heeft t o t gevolg dat het virusdeeltje evenredig korter wordt, vandaar
de naam minifaag. De genomen van drie verschillende minifagen zijn
gedetailleerd onderzocht: u i t nukleotidesekwentie-analyses i s gebleken dat de
minifaag DNA's zijn ontstaan via d e l e t i e s ( v e r l i e s ) van grote DNA fragmenten
u i t het wildtype Pf3 genoom. Het f e i t dat het verloren gegane DNA segment, en
dus ook het u i t e i n d e l i j k e minifaag genoom, oorspronkelijk aan beide zijden
geflankeerd werd door korte identieke sekwenties, suggereert dat de
verschillende minifaag-genomen volgens eenzelfde mechanisme zijn ontstaan.
Deze korte sekwentie werd in het minifaag-genoom slechts éénmaal teruggevonden
op de plaats waar de uiteinden van het behouden DNA fragment gefuseerd
zijn.
129
Eén minifaag-genoom bevatte bovendien een tandem gedupliceerd DNA fragment, en
u i t de sekwentie-analyse kon worden afgeleid dat de duplikatie na het
deletieproces moet zijn opgetreden. Het f e i t dat ook d i t fragment
oorspronkelijk door identieke sekwenties werd geflankeerd, maar dat deze
sekwentie s l e c h t s éénmaal werd teruggevonden op de l a s van de twee DNA
kopieën, doet vermoeden dat d e l e t i e en duplikatie volgens eenzelfde mechanisme
zijn verlopen. Het mechanisme dat mogelijk aan deze processen ten grondslag
l i g t i s "slipped mispairing", d.w.z. een verschuiven (slippen) van het 3 '
uiteinde van de groeiende DNA streng naar komplementaire sekwenties op de DNA
m a t r i j s . Een dergelijke verschuiving zou bijvoorbeeld kunnen optreden tijdens
de omzetting van de (enkelstrengs) v i r a l e DNA streng in de dubbelstrengs
r e p l i k a t i e v e vorm.
Het "slipped mispairing" mechanisme i s mogelijk ook
verantwoordelijk voor de waargenomen s t r u k t u r e l e i n s t a b i l i t e i t van vele
Bacillus en Streptomyces Plasmiden, waarvan onlangs i s aangetoond dat ze via
enkelstrengs i n t erme di airen r e p l i c e r e n .
Omdat Pf3 minifagen het vermogen tot expressie van eiwitten verloren hebben,
zijn ze zowel voor hun r e p l i k a t i e als voor hun assemblage afhankelijk van een
wildtype (helper) Pf3 faag-genoom in dezelfde gastheercel.
Het f e i t echter
dat minifaag DNA's e f f i c i e n t worden gerepliceerd en vervolgens geassembleerd
t o t , weliswaar verkorte, v i r u s d e e l t j e s toont aan dat het DNA segment, dat de
drie minifaag-genomen gemeenschappelijk hebben, a l l e cis-werkende r e p l i k a t i e
( v i r a l e en
komplementaire streng o r i g i n s ) , en assemblage signalen bevat.
In hoofdstuk k zijn s t u d i e s met als doel een nadere l o k a l i s e r i n g van de
origin van v i r a l e streng synthese beschreven. Uitgaande van één minifaaggenoom kon door middel van _in v i t r o deletievorming het gebied dat een
funktionele o r i g i n voor de v i r a l e streng synthese bevat t o t 139 baseparen
worden gereduceerd. Deze origin bleek, evenals de origins van de E.coli fagen
Ff en IKe, de signalen, welke verantwoordelijk z i j n voor zowel de i n i t i a t i e
als terminerlng van de v i r a l e streng synthese, te bevatten.
Hoewel er geen
enkele aanwijzing werd gevonden voor nukleotidesekwentie homologie tussen de
v i r a l e streng origins van Pf3, Ff en IKe, werd er wel enige s t r u k t u r e l e
overeenkomst tussen deze origins gevonden in de vorm van de aanwezigheid van
inverted r e p e a t s . Een dergelijk struktuurelement wordt verondersteld t e
fungeren a l s herkennings- en aanhechtingsplaats van r e p l i k a t i e - e i w i t ( t e n ) .
Uit het f e i t dat de funktionele analyse van de deletiemutanten in E.coli kon
worden uitgevoerd volgt bovendien dat Pf3 in s t a a t i s om ook in deze gastheer
te repliceren.
130
In hoofdstuk 5 wordt de expressie van een gedeelte van het Pf3 genoom in
vivo in P.aeruginosa en in vivo en in v i t r o in E.coli beschreven.
Het gebied
dat zowel voor het Pf3 enkelstrengs DNA bindend eiwit als het hoofdmanteleiwit
kodeert, wordt middels twee boodschapper RNA's (mRNA's) t o t expressie
gebracht. De i n i t i a t i e p l a a t s e n voor deze mRNA's zijn 301 baseparen vóór het
gen voor het enkelstrengs DNA bindend e i w i t , r e s p e k t i e v e l i j k 122 baseparen
vóór het mantel eiwitgen gelegen.
De synthese van deze mRNA's wordt op
eenzelfde p o s i t i e , t e weten 60 baseparen na het manteleiwitgen, getermineerd.
Ondanks het f e i t dat de nukleotide-sekwentie van slechts één van de twee
t r a n s k r i p t i e - i n i t i a t i e p l a a t s e n homologie met de consensus sekwentie van E.coli
promoters vertoonde, bleek E.coli RNA polymerase, zowel in vivo a l s _in v i t r o ,
toch beide plaatsen a l s promoter t e kunnen herkennen. Ook het Pf3
t r a n s k r i p t i e - t e r m i n e r i n g s signaal bleek in E.coli als zodanig t e worden
herkend. De r e s u l t a t e n tonen aan dat de verschillen in genexpressie tussen
E.coli en P.aeruginosa niet het gevolg zijn van verschillen in
s e k w e n t i e s p e c i f i c i t e i t van RNA polymerase, maar eerder gezocht moet worden in
verschillen in genregulatie mechanismen.
Samenvattend kan gesteld worden dat er weinig evolutionaire overeenkomsten
zijn gevonden tussen de filamenteuze bakteriofaag Pf3 en de onderling verwante
fagen Ff en IKe. Hoewel de genetische o r g a n i s a t i e s van deze organismen een
zekere gelijkenis vertonen, geven direkte vergelijkingen van hun
nukleotidesekwenties en van de daarvan afgeleide aminozuursekwenties geen
enkele aanwijzing voor een evolutionaire verwantschap tussen Pf3 en de E.coli
specifieke fagen Ff en IKe.
De hypothese dat filamenteuze bakteriofagen uit een gemeenschappelijke
voorouder zijn geëvolueerd wordt door de in d i t proefschrift
neergelegde
experimentele gegevens dus niet ondersteund.
Het b l i j f t daarom zeer wel mogelijk dat Pf3 vanuit een andere voorouder dan de
fagen Ff en IKe i s ontstaan. In dit verband i s het interessant t e wijzen op de
s t r u k t u r e l e en funktionele overeenkomsten tussen filamenteuze fagen en de
p i l i , welke door konjugatieve Plasmiden worden gekodeerd. Konjugatieve
Plasmiden bevatten n i e t alleen de genetische informatie voor de
struktuurel ementen van de p i l u s , maar ook voor de eiwitten welke bij de
synthese en overdracht van enkelstrengs Plasmide DNA naar de akseptor cel zijn
betrokken.
131
Omkering van de hypothese van Brinton, dat konjugatieve Plasmiden een
bijzondere celgebonden vorm van (filamenteuze) bakteriofagen z i j n , l e i d t t o t
de nieuwe hypothese dat verschillende (klassen van) filamenteuze fagen
ontstaan zijn uit verschillende konjugatieve Plasmiden.
Toekomstig onderzoek van konjugatieve Plasmiden en filamenteuze
bakteriofagen
kan de j u i s t h e i d van (één van deze) hypotheses mogelijk aantonen.
132
CURRICULUM VITAE
De schrijver
Kerkrade.
van d i t proefschrift werd op 3 december 1954 geboren i n
Na het behalen van het diploma gymnasium β aan het gymnasium
"Rolduc" in 1973i begon h i j in datzelfde J a a r met de s t u d i e Biologie aan de
Katholieke U n i v e r s i t e i t t e Nijmegen.
examen Biologie B4 afgelegd.
In september 1977 werd het kandidaats­
Gedurende de doktoraalfase werden de hoofdvakken
Organische Chemie (Prof. d r . B. Zwanenburg) en Molekulaire Biologie (Prof. d r .
J.G.G. Schoenmakers), en het bijvak Biochemie (Prof. dr. H. Bloemendal)
bewerkt.
De s t u d i e werd afgesloten met het behalen van de doktoraal-examens
Biologie (september 1981), en Chemie (oktober 1981).
Van 1 oktober 1981 t o t en met 30 a p r i l 1986 was hij a l s
wetenschappelijk
medewerker verbonden aan de Katholieke U n i v e r s i t e i t Nijmegen, gedurende welke
periode hij aan het Laboratorium voor Molekulaire Biologie het in d i t
proefschrift
beschreven onderzoek heeft v e r r i c h t .
Sedert 1 mei 1986 i s h i j a l s molekulair bioloog werkzaam op de afdeling
Bakteriele Genetika van Gist-brocades n.v. t e Delft.
133
STELLINGEN
1.
Michel en Ehrlich zijn er ondanks uiterst gekompliceerde beschrijvingen
toch in geslaagd om een beeld te schetsen van de faktoren die voor
Plasmide instabiliteit verantwoordelijk zijn.
B. Michel, and S.D. Ehrlich. 1986.
Proc. Natl. Acad. Sci. USA
З, 3386-3390
EMBO J. 5, 3691-3696
2.
Hashed en Oberer benadrukken weliswaar de belangrijke rol die de pllus
blj Infektie van filamenteuze fagen vervult, maar wijzen parallelen in
het assemblage mechanisme van pilus en faag ten onrechte af als niet
signifikant.
I. Hashed, and E. Oberer. 1986.
Microbiol. Rev. 50, 101-427
3.
del Solar et al. stellen In hun argumentatie ten onrechte dat de
komplementalre streng synthese van ФХІУІ en M13 op dezelfde wijze wordt
geïnitieerd, en dat deze voor beide fagen niet In polA cellen kan
plaatsvinden.
G.H. del Solar, A.Puyet, and M. Espinosa. 1987.
Nucí. Acids Res. 1_5, 5561-5580
1.
De ontdekking van lineaire reuze-plasmiden in een aantal Streptomyceten
doet de grens tussen Plasmide en chromosoom in dit bakteriele genus
vervagen.
M. Kinashi, M. Shlmaji, and A. Sakai. 1987.
Nature 328, И5Ч-Ч56
5.
Homologie tussen oellulase sekwenties en het aktleve centrum van
lysozym wordt meer ondersteund door een verondersteld overeenkomstig
katalyse-mechanisme dan door een onbevooroordeelde komputeranalyse.
M.C. Paice, M. Desrochers, D. Rho, L. Jurasek,
С
Roy, C.F. Rollln, E. deMiguel,
and M. Yaguchi. 1984.
Blo/Technology 2, 535-539
T.T. Teeri, P. Lehtovaara, S. Kauppinen,
I. Salovuori, and J. Knowles. 1987.
Gene 5J_, ^3-52
6.
In tegenstelling tot Escherichia coll is positieve regulatie van de
genexpressie bij Pseudomonas eerder regel dan uitzondering.
7.
De genetische stabiliteit van een mlkroörganisme lijkt omgekeerd
evenredig te zijn met zijn Industrieel belang.
8.
Dat met Veronica "de televisie eindelijk volwassen is geworden" blijkt
niet uit de door deze omroeporganisatie uitgezonden programma's.
9.
Gelet op het gemak waarmee momenteel transgene planten en dieren kunnen
worden gekonstrueerd lijkt het aannemelijk dat de "biotechnologie"
spoedig weer terug is op de boerderij.
10.
Een consensus/concensus over de schrijfwijze van dit woord kan
gemakkelijk bereikt worden door er een woordenboek op na te slaan.