Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
FILAMENTOUS BACTERIOPHAGE Pf3 A MOLECULAR QENETIC STUOY. чииа LUITEN THE FILAMENTOUS BACTERIOPHAGE PF3 A MOLECULAR GENETIC STUDY THE FILAMENTOUS BACTERIOPHAGE PF3 A MOLECULAR GENETIC STUDY PROEFSCHRIFT t e r verkrijging van de graad van doctor in de Wiskunde en Natuurwetenschappen aan de Katholieke U n i v e r s i t e i t t e Nijmegen, op gezag van de Rector Magnificus Prof.dr. B.M.F, van l e r s e l volgens b e s l u i t van het College van Decanen in het openbaar t e verdedigen op woensdag 16 december 1987 des namiddags t e 1.30 uur precies door RUDOLF GIJSBERTUS MARIE LUITEN geboren t e K e r k r a d e T?^ drukkerij vveemen bv haps Promotor: Co-Promotor: Prof.Dr. J.G.G. Schoenmakers Prof.Dr. R.N.H. Konings DANKWOORD Graag wil ik iedereen van harte bedanken die op enigerlei wijze een bijdrage heeft geleverd aan de totstandkoming van d i t p r o e f s c h r i f t . In het bijzonder wil ik de studenten/ s t a g i a i r e s noemen die in het kader van hun s t u d i e "gedwongen" waren aan d i t onderzoek mee t e werken: Peter-Paul Biermans, Ton Beniers, Rik Eggen, Jac. Benen, Marja Timmermans, Eric Claas en Guy Honnée. J u l l i e hulp was welkom en nodig. Mijn dank s t r e k t zich n a t u u r l i j k ook u i t t o t al die mensen van binnen of van buiten de afdeling Molekulaire Biologie, die mij met raad en daad hebben bijgestaan. Tevens dank ik Gerard Dekker voor de verzorging van de fotografie en Ger Austen voor zijn hulp bij het leren omgaan met verschillende aspekten van komputersystemen. I would l i k e to express my g r a t i t u d e t o Diana H i l l , who generously invited me to the MRC Laboratory (Cambridge), and taught me the l a t e s t techniques in shotgun cloning and sequencing of l a r g e DNA molecules. Tenslotte, overal en a l t i j d a l s l a a t s t e genoemd, wil ik mijn ouders en n a t u u r l i j k Yvonne bedanken, voor hun steun en hulp, maar vooral voor hun geduld, dat zo vaak op de proef i s gesteld. CONTENTS General Introduction 9 Chapter 1 The Major Coat P r o t e i n of t h e F i l a m e n t o u s Pseudomonas a e r u g i n o s a Phage P f 3 : Absence of an N-Terminal Leader S i g n a l Sequence 21 Chapter 2 N u c l e o t i d e Sequence of t h e Genome of P f 3 , an IncP-1 Plasmid S p e c i f i c F i l a m e n t o u s Phage of Pseudomonas a e r u g i n o s a 39 Chapter 3 Spontaneous D e l e t i o n Mutants of B a c t e r i o p h a g e P f 3 : Mapping of S i g n a l s I n v o l v e d i n R e p l i c a t i o n and Assembly 61 Chapter it I n V i t r o D e l e t i o n Mapping of t h e V i r a l S t r a n d R e p l i c a t i o n O r i g i n of the Pseudomonas B a c t e r i o p h a g e Pf3 81 Chapter 5 Transcription Initiation and Termination Signals on the Genome of the Pseudomonas aeruginosa phage Pf3 99 Summary 11 9 Samenvatting 125 Curriculum v i t a e 133 GENERAL INTRODUCTION Pf3 is a filamentous bacterial virus specifically infecting Pseudomonas aeruginosa (43). The virion is about 700 nm long and 6 nm wide, and consists of a circular covalently closed single-stranded DNA (ssDNA) molecule encapsulated in a long slender protein coat which is composed of at least two different subunits. The smallest subunit is present in the virion in about 2500 copies, whereas of the largest only a few copies are present (36, 45). These properties place Pf3 in the genus Inovirus, to which also belong the Escherichia coli phages Ff (M13, f1, and fd), IKe, Ifl and 12-2, the Pseudomonas aeruginosa specific phage Pf1, the Xanthomonas oryzae phage Xf, and some other less well characterized bacteriophages (6, 11, 12, 13, I1*, 2U, 31). Pf3 has P.aeruginosa (strain 0) harboring a broad host range plasmid of the incompatibility group P-1 (IncP-1, e.g. RP1) as its natural host (43). The RP1 encoded pili are essential for infection: the tips of the pili serve as an attachment site for the phage. The viral DNA is introduced into the host cell most probably via a pilus retraction mechanism, similar to that of the F-pilus (23). In line with the broad host range character of IncP-1 plasmids Escherichia coli containing these IncP-1 plasmids are susceptible to infection by Pf3 as well. The infection process is however very inefficient as illustrated by the fact that progeny Pf3 virions are only released in very small amounts (6, 42). Similar to the other members of the genus Inovirus, infection by Pf3 does not cause cell death; instead progeny virus is assembled at the cell membrane and continuously extruded through the cell wall. Therefore the filamentous virus must consider the appropriate balance of host and phage metabolism. After an initial rapid increase in phage DNA and protein, the infected cells settle into a phage producing steady state that can persist indefinitely (14, 31). This unique property of the Inoviridae has attracted much attention, particularly with respect to the elucidation of both the structural and the genetic prerequisites for this parasitical life-cycle. Until a few years ago most if not all studies involved the F plasmid specific filamentous E.coli phages M13, f1, and fd (Ff). Nucleotide sequence analyses have demonstrated 11 that these viruses are so closely related that they can be considered to be variants of the same bacteriophage (4, 20, 46). Recently the life-cycle, molecular biology and genetics of the Ff phages have been extensively reviewed (2, 17, 38, 10, HT, 19). For this reason these aspects will be dealt with only briefly. Structural and genetic properties are discussed in more detail in the chapters to follow, when comparing Pf3 with Ff. There were and are several interesting aspects which led us to choose bacteriophage Pf3 as an object for extensive molecular genetic analyses. First of all, from an evolutionary point of view, it was Intriguing to answer the question whether the observed evolutionary relationship between the filamentous E.coll phages Ff and IKe, an N plasmid specific E.coli phage (6, 38), could be extended also to Pf3, which has another bacterial genus as its natural host. The structural and genetic data available for the phages Ff and IKe strongly suggest that these viruses have evolved from a common ancestor: the differences in their pilus (plasmid) specificity seem to be the result of divergence and reshuffling of nucleotide sequences in the capsid protein genes that are responsible for adsorption of the phage to the pilus tip (37, 38). The question whether such a relation also exists for the other filamentous phages can be answered by studying the structural and genetic organizations of their genomes. If the genomes are evolutionary related, then a comparison of these genomes might reveal strongly conserved DNA or protein sequences, thereby pinpointing regions with possible functional significance. On the other hand such a comparison might indicate where divergence of nucleotide or amino acid sequences has led to acquisition of new biological properties. It might furthermore be of interest to examine the structural similarities between filamentous bacteriophages (29, 32, 33) and their cognate pili. Brinton already hypothesized that conjugative plasmids might be a specialized form of (filamentous) phage, the pilus being the remnant of the virion particle which still functions as mediator of DMA transfer, although it does not contain DNA (7). For at least the phages Ff and Pf1, the apparent morphological similarity between pilus and phage has been shown to be more than superficial. In both cases the symmetry of the major protein constituents of the pilus, i.e. the pilin molecules, around the pilus axis is identical to the axial symmmetry of the major capsid proteins in the bacteriophage filament (16, 28, 30). This symmetry matching may be one of the 12 factors that determine pilus specificity. In addition there are remarkable parallels between the fate of pil in molecules and the major coat protein subunits during pilus retraction and phage infection as well as during pilus assembly and phage morphogenesis. Particularly the fact that the major coat proteins of an infecting bacteriophage are stored in the inner cell membrane, and subsequently are reused for the assembly of progeny phage is strikingly similar to the fate of pilin molecules during pilus retraction and assembly (1, 23, 42). These morphological and functional similarities suggest that a comparative study of the underlying genetics of filamentous bacteriophages and pilus encoding DNA segments (usually conjugative Plasmids) might well reveal an evolutionary relationship between these genetic elements. Alternatively, the filamentous bacteriophages only may appear to make efficient use of an existing mechanism both for infection and phage assembly. Returning to the problem of defining the evolutionary relationship between different filamentous bacteriophages, Pf3 is an attractive candidate, not only because its natural host is P.aeruginosa, but also because it is able to infect, though inefficiently, E.coli (6, 42). The latter property might facilitate the comparison of structural or genetic data of Pf3 with those of the well studied Escherichia coli specific bacteriophages Ff and IKe. Another interesting characteristic of Pf3 is the unique structure of the virion (5, 36, 39), and the conformational properties of its components (44, 45). Biophysical studies have indicated that the ssDNA molecule inside the coat envelope has an inside-out conformation (inverted DNA structure or I-form DNA) with the bases directed outward and the phosphate groups of the backbone pointing towards the central axis (8, 9, 34, 45). This conformation is opposite to that observed for the Ff phages, in which the ssDNA molecule is collapsed upon itself in an antiparallel and right handed, but non basepaired, helix-like structure stabilized by stacking interactions of the internally localized bases (8, 9, 34, 45). To explain these findings, a very different interaction of the coat protein molecules and the ssDNA genome within the respective filamentous phage particles is required. Particularly the interaction of aromatic and charged amino acid residues with the bases and phosphate groups, respectively, of the ssDNA molecule in ensuring the structural integrity of the virion particle must be completely different when comparing Pf3 and Ff (8, 9, 22, 34, 4*1, ¿15, 47). An additional peculiarity of 13 the major coat protein of Pf3 is that it undergoes reversible and irreversible transitions from α-helix to ß-sheet upon heating i_n vitro, a phenomenon also observed for Xf but not for the Ff phages, IKe, or Pfl ( M ) . Because similar conformational transitions do occur in vivo during assembly of Ff phages, the Pf3 virion might prove to be a useful in vitro model system to study the role of structural transitions in coat protein molecules during filamentous phage morphogenesis. Still another aspect which prompted us to study bacteriophage Pf3 was its host range. The fact that Pf3 is specific for cells harboring a broad host range IncP-1 plasmid and primarily infects P.aeruginosa might enable us to use Pf3 as a model system for studying gene expression in Pseudomonas. Particularly during the last decade Pseudomonas has attracted much attention in view of its ability to metabolize a broad variety of xenobiotic compounds (10, 19, 21). These compounds, usually man made organic chemicals which previously did not occur in nature, have been and are being released in the environment in huge amounts, particularly in industrialized countries. The mineralization of these compounds is very slow, but microorganisms have been found that are able to perform this task rather efficiently. Especially among Pseudomonads, strains have been isolated that are capable of degrading various classes of xenobiotics. Most of the enzymes involved in the catabolic pathways are encoded by large transmissible plasmids thus allowing a rapid spread of these capabilities in the contaminated environment. For example plasmids encoding the degradation of n-alkanes (15), substituted or even chlorinated toluenes and xylenes (26, 27), naphtalenes (25), and salicylates (48) have been characterized. Analysis of the expression of genes encoding some enzymes of these degradative pathways by molecular cloning in E.coli has suggested that either the signals involved in gene expression or their regulation in Pseudomonas differs considerably from E.coli (3, 15, 18, 35, 41). In this context genetic analysis of Pseudomonas bacteriophage Pf3 might shed light on the nature of sequences signalling gene expression in Pseudomonas. In addition analysis of the Pf3 genome could lead to the construction of vector DNA molecules able to replicate autonomously within Pseudomonas and possibly also within E.coli. 14 The different chapters of this thesis describe aspects of the molecular biology of the filamentous bacteriophage Pf3 relevant to one or more of the questions raised above. Chapter 1 deals with the localization and primary structure of the gene encoding the Pf3 major coat protein. The structure of this gene and that of its encoded protein product is then compared with that of the corresponding genes and proteins of other filamentous bacteriophages. In chapter 2 the complete nucleotide sequence of the Pf3 genome is given and a genetic organization is postulated on the basis of two defined genes and several observed open reading frames. Differences and similarities with the genomes of the E.coli specific Inovirldae are discussed. Chapter 3 describes the isolation and molecular analysis of spontaneous deletion mutants (miniphages) of Pf3 and the implications of their structure for the location of signals involved in DNA replication and virus assembly. In addition a recombination mechanism is proposed to explain the generation of the respective miniphage genomes. In this hypothesis the rolling circle mechanism of DNA replication, in particular the single stranded DNA intermediate, plays an important if not essential role. In chapter Ί a more detailed study is presented regarding the location and functional properties of the origin of Pf3 viral strand replication. Again the observed properties are compared with those of the equivalent signal of the well studied E.coli specific filamentous phages. The last chapter deals with the expression of the Pf3 genome, more particularly with the analysis of transcription initiation and termination functions in vivo in P.aeruginosa and both in vitro and in vivo in E.coli. LITERATURE CITED Armstrong, J., J. Hewitt, and R. Perham. 1983. Chemical modification of the coat protein in bacteriophage fd and orientation of the virion during assembly and disassembly. EMBO J. 2, 1641-1646. Baas, P.D. 1985. DNA replication of single-stranded Escherichia coli DNA phages. Biochim. Biophys. Acta 825: 111-139. Bagdasarian, M., and K.N. Timmis. 1982. Host: vector systems for gene cloning in Pseudomonas. Curr. Top. Microbiol. Immunol. 96^: 47-67. Beck, E., R. Sommer, E. A. Auerswald, С. Kurz, В. Zink, G. Osterburg, H. Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 22: 4495-4503. Berkowitz, S.A., and L.A. Day. 1980. Turbidity measurements in an analytical ultracentrifuge. Determinations of mass per length for filamentous viruses fd, Xf, and Pf3. Biochemistry _1_9, 2969-2702. Bradley, D.E. 1981. In: Molecular biology, pathogenicity, and ecology of bacterial Plasmids. S.B. Levy, R.C. Clowes, and E.L. Koenig (ed.), Plenum Press, New York. p. 217-226. Brinton, C. 1971. The properties of sex pili, the viral nature of 'conjugal' genetic transfer systems, and some possible approaches to the control of bacterial drug resistance. Crit. Rev. Microbiol. J_, 105-160. Casadevall, Α., and L.A. Day. 1982. DNA packing in the filamentous viruses fd, Xf, Pf 1 , and Pf3. Nucleic Acids Res. 1_0, 2467-2481. Casadevall, Α., and L.A. Day. 1983. Silver and mercury probing of deoxyribonucleic acid structures in the filamentous viruses fd, Ifl, IKe, Xf, Pf1, and Pf3. Biochemistry 22, 4831-4842. Clarke, P.H., and M.H. Richmond. 1975. Genetics and biochemistry of Pseudomonas. Wiley, London. Coetzee, J.N., D.E. Bradley, R.W. Hedges, V.M. Hughes, M.M. McConnell, L. DuT Toit, and M. Tweehuysen. 1986. Bacteriophages Folac h, SR, SF: Phages which adsorb to pili encoded by plasmids of the S-complex. J. Gen. Microbiol. 232, 2907-2917. Coetzee, J.N., D.E. Bradley, R.W. Hedges, M. Tweehuysen, and L. Du Toit. 1987. Phage tf-1 : A filamentous bacteriophage specific for bacteria harboring the IncT plasmid pIN25. J. Gen. Microbiol. 133. 953-960. Dai, H., S. Tsay, T. Kuo, Y. Lin, and W. Wu. 1987. Neolysogenization of Xanthomonas campestris pv. citri infected with filamentous phage Cfl6. Virology 156, 313-320. 14. Denhardt, D.T., D. Dressler, and D.S. Ray (ed.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 15. Egglnk, G., P.H. van Lelyveld, A. Arnberg, N. Arfman, C. Witteveen, and B. Witholt. 1987. Structure of the Pseudomonas putida alkBAC operon. J. Biol. Chem. 262, 6400-6406. 16. Folkhard, W., D.A. Marvin, Т.Н. Watts, and W. Paranchych. 1981. Structure of polar pill from Pseudomonas aeruginosa strains К and 0. J. Mol. Biol. J_49, 79-93. 17. Fulford, W., M. Rüssel, and P. Model. 1986. Aspects of growth and regulation of the filamentous phages. Progress in Nucleic Acid Research and Molecular Biology 33^, 141-168. 18. Haas, D. 1983. Genetic aspects of biodégradation by Pseudomonas. Experientia 39: 1199-1213. 19. Harayama, S., and R.H. Don. 1985. Catabolic Plasmids: their analysis and utilization in the manipulation of bacterial metabolic activities. Genetic Engineering 8, 283-307. 20. Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of bacteriophage fi DNA. J. Virol. 44: 32-46. 21. Huetter, R., and T. Leisinger (ed.). 1981. Microbial degradation of xenobiotics and recalcitrant compounds. Academic Press, London. 22. Hunter, G.J., D.H. Rowitch, and R.N. Perham. 1987. Interactions bewteen DNA and coat protein in the structure and assembly of filamentous bacteriophage fd. Nature 327, 252-254. 23. Jacobson, A. 1972. Role of F pili in the penetration of bacteriophage fi. J. Virol. 20, 835-843. 24. Kuo, T., Y. Lin, С. Huang, S. Chang, H. Dai, and T. Feng. 1987. The lysogenic cycle of the filamentous bacteriophage Cflt from Xanthomonas campestris pv. citri. Virology 156, 305-31?. 25. Lindberg, F., В. Lund, L. Johansson, and S. Normark. 1987. Localization of the receptor-binding protein adhesin at the tip of the bacterial pilus. Nature 328, 84-87. 26. Lehrbach, P.R., I. McGregor, J.M. Ward, and P. Broad. 1983. Molecular relationships between Pseudomonas IncP-9 degradative plasmid T0L, NAH, and SAL. Plasmid W, 164-174. 27. Lehrbach, P.R., J.Zeyer, W. Reineke, H.-J. Knackmuss, and K.N. Timmis. 1984. Enzyme recruitment in vitro: use of cloned genes to extend the range of haloaromatics degraded by Pseudomonas sp. strain ВІЗ. J. Bacteriol. 158, 1025-1032. 17 28. Makowski, L., D.L.D. Caspar, and D.A. Marvin. 1980. Filamentous bacteriophage Pfl structure determined at 7ft resolution by refinement of models for the α-helical subunit. J. Mol. Biol. U O : 149-182. 29. Makowski, L., and D.L.D. Caspar. 1981. The symmetries of filamentous phage particles. J. Mol. Biol. 1jt5: 611-617. 30. Marvin, D.A., and W. Folkhard. 1986. Structure of F pili: Reassessment of the symmetry. J. Mol. Biol. Ij^, 299-300. 31. Marvin, D., and B. Hohn. 1969. Filamentous bacterial viruses. Bacteriol. Rev. 33, 172-209. 32. Marvin, D. Α., W. J. Pigram, R. L. Wiseman, E. J. Wachtel. 1974. Filamentous bacterial viruses 12: Molecular architecture of the class I (fd, Ifl, IKe) virion. J. Mol. Biol. 88: 581-600. 33- Marvin, D.A., R.L. Wiseman, E.J. Wachtel. 1974. Filamentous bacterial viruses 11: Molecular architecture of the class II (Pfl, Xf) virion. J. Mol. Biol. 82: 121-138. 34. Marzee, С. J., and L. A. Day. 1983. DNA and protein lattice-lattice interactions in the filamentous bacteriophages. Biophys. J. 4£: 171180. 35. Mermod, N., P.R. Lehrbach, W. Reineke, and K.N. Timmis. 1984. Transcription of the TOL plasmid toluate catabolic pathway operon of Pseudomonas putida is determined by a pair of coordinately and positively regulated overlapping promoters. EMBO J. 3'· 2461-2466. 36. Newman, J., L.A. Day, G.W. Pollack, and D. Eden. 1982. Hydrodynamic determination of molecular weight. Dimensions and structural parameters of Pf3 virus. Biochemistry 2j_: 3352-3358 37. Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings. 1985. Nucleotide sequence and genetic organization of the genome of the N-specific filamentous bacteriophage IKe. J. Mol. Biol. 181 : 27-39. 38. Peeters, B.P.H. 1985- The genome of the filamentous bacteriophage IKe. Ph.D. Thesis, University of Nijmegen, The Netherlands. 39. Peterson, C , G. Dalack, L.A. Day, and W.T. Winter. 1982. Structure of the filamentous bacteriophage Pf3 by X-ray fiber diffraction. J. Mol. Biol. 1_62: 877-881 . 40. Rashed, I., and E. Oberer. 1986. Ff coliphages: Structural and functional relationships. Microbiol. Rev. 50, 401-427. 41. Sakaguchi, K. 1982. Vectors for gene cloning in Pseudomonas and their application. Curr. Top. Microbiol. Immunol. 96^: 31-45. 42. Smilowitz, H. 1974. Bacteriophage fi infection: Fate of the parental major coat protein. J. Virol. J_3, 94-99. 18 43· Stanisich, V.A. 197*1. The properties and host range of male-specific bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 8jJ_: 3323^2. UU. Thomas Jr., G.J., and L.A. Day. 1981. Conformational transitions in Pf3 and their implications for the structure and assembly of filamentous bacterial viruses. Proc. Natl. Acad. Sci. USA 78, 2962-2966. 45. Thomas Jr, G.J., B. Prescott, and L.A. Day. 1983. Structure similarity, difference, and variability in the filamentous viruses fd, If1, IKe, Pfl and Xf. J. Mol. Biol. ^65: 321-356. H6. Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers. 1980. Nucleotide sequence of the filamentous bacteriophage M13 genome: Comparison with phage fd. Gene П_: 129-118. 47. Webster, R. E., and J. Lopez. 1984. In "Virus Structure and Assembly", S. Casjens, (ed.). Jones and Bartlett Publishers, Inc. Boston, Mass. 48. Yen, K.-M., and I.e. Gunsalus. 1982. Plasmid gene organization: Naphtalene/salicylate oxidation. Proc. Natl. Acad. Sci. USA 79_, 874878. 49. Zinder, N.D., and K. Horiuchi. 1985. Multiregulatory element of filamentous bacteriophages. Microbiol. Rev. 4£: 101-106. 19 CHAPTER 1 The Major Coat Protein Gene of the Filamentous Pseudomonas aeruginosa Phage Pf3: Absence of an N-Terminal Leader Signal Sequence Ruud G.M. Luiten, John G.G. Schoenmakers, and Ruud N.H. Konings Nucleic Acids Research 11, 8073-8085 (1983) ABSTRACT From in vitro protein synthesis studies and nucleotide sequence analysis it has been deduced that, unlike the major coat proteins of the hitherto studied filamentous bacterial viruses Ff (M13, fd, and fi), IKe, and Pf1, the major coat protein of the filamentous Pseudomonas aeruginosa virus Pf3 is not synthesized as a precursor containing a leader signal polypeptide at its Nterminal end. From the elucidated nucleotide sequence of the Pf3 major coat protein gene it follows that the coat protein is 44 amino acids residues long (mol.wt. 4625). No sequence homology was observed with the major coat protein genes of either the Ff group or IKe but, similar to these phages, З'-ward of the Pf3 coat protein gene a DNA sequence is located which has many characteristics in common with rho-Independent transcription termination signals. INTRODUCTION Filamentous b a c t e r i a l viruses are simple models for studying processes of molecular assembly. The viruses consist of a closed loop of single-stranded DNA (6000-7500 nucleotides) encapsulated in a sheath of several thousand i d e n t i c a l major coat protein s u b u n i t s . These molecules are of low molecular weight c o n s i s t i n g of about 50 amino acid residues (for a review, see ref. 5). The ends of the v i r a l filament are distinguished by the presence of a few copies each of one or more minor coat proteins (6, 14, 28, 29, 38). Two s t r u c t u r a l c l a s s e s have been defined on the basis of X-ray fiber diffraction patterns of the virions (15, 17, 23). Class I includes the F- s p e c i f i c filamentous b a c t e r i a l viruses Ff, the N-specific virus IKe, and the I-specific virus I f 1 . They a l l have Escherichia coli as t h e i r h o s t . Class II includes the viruses Pfl and Pf3, which infect Pseudomonas aeruginosa s t r a i n s К and 0, r e s p e c t i v e l y , and Xf, oryzae. which infects the plant bacterium Xanthomonas Pf3 only i n f e c t s c e l l s which harbour the IncP-1 s p e c i f i c broad host- range Plasmid RP1 (31). 23 The Ff viruses M13, fd, and fi have been shown to be closely related (1, 7, 36). The DNA of these viruses reveal a mutual homology of about 97?, clearly indicating that they are derived by mutation from a common ancestor. Although the nucleotide sequence of the IKe genome shows a great divergence from that of the Ff group (overall homology 45%) (22), our data nevertheless indicate unambiguously that also IKe and the Ff viruses have evolved from a common ancestor (21). Whether the class II viruses, with their different host requirements, DNA compositions and probably also different phage assembly processes, are also descendants from this common ancestor is still very speculative. With these considerations in mind we have initiated a study towards the structural and genetic organization of the Pf3 genome. A different genetic organization might underlie a different process of phage assembly at the host cell membrane. The Ff viruses have a large number of their major coat protein subunits inserted into the membrane. These molecules subsequently displace the DNA-binding proteins from their intracellular complex with DNA, during assembly and transport of the virus out of the cell. The major coat proteins of the Ff virus group are all synthesized in the infected cell in a precursor form (11, 37). Concomitant with deposition into the inner cell membrane a leader peptide of 23 N-terminal amino acid residues is cleaved off (4, 37). A similar but not identical precursor-membrane protein relationship has recently been found for the other E.coll viruses IKe (22) and Ifl (D.Hill i G.B. Petersen, personal communication) and the P.aeruginosa virus Pfl as well (unpublished data), suggesting that all filamentous viruses are similar in this fundamental aspect. In this study we present the nucleotide sequence of the major coat protein gene of Pf3 and its adjacent signals for transcription and translation. Our results demonstrate that the major coat protein of Pf3, though of low molecular weight (44 amino acid residues), is not synthesized in a precursor form, indicating that deposition of this protein into the host cell membrane is determined by structural parameters different from that of the other filamentous viruses 24 MATERIALS AND METHODS Materials Т^ DNA l i g a s e and the r e s t r i c t i o n endonucleases used were obtained from Bethesda Research Laboratories. E.coli DNA polymerase I (large fragment) was from Boehringer AG. All enzymes were used under the conditions specified by the suppl-ier. 2',3'-dideoxyribonucleoside t r i p h o s p h a t e s were purchased from 32 PL-Biochemicals. a- P-dATP (¡iiO Ci/mmol, 3 5 s _ s u l p h a t e (955 ci/mmol), and the •"S and ^H-iabelled amino acids at the highest s p e c i f i c a c t i v i t y a v a i l a b l e were obtained from Amersham. PEG-6000 was from BDH. All other chemicals were of a n a l y t i c a l grade. Bacteria and bacteriophages Bacteriophage Pf3 and its host P.aeruginosa PA01, harbouring the broad hostrange plasmid RP1, were kindly provided by Dr. D.E. Bradley, St. Johns, New Foundland. The phages M13 and IKe and their respective host bacteria were from our own collection. Pf3 phage growth and isolation of replicative form DNA P.aeruginosa PA01 cells were grown in R-medium (19) until early log phase and infected with Pf3 bacteriophages at a multiplicity of infection of 10. After incubation for 6 hours at 370C, cells were harvested by centrifugatlon and the Pf3 phage particles were concentrated from the supernatant by the addition of PEG-6000 and NaCl to final concentrations of 5% and 0.5 M, respectively. Phages were further purified by CsCl density gradient centrifugatlon in 5 mM sodium borate, pH 9.0 (20). Pf3 replicative form DNA (RF) was isolated from infected cells essentially as described by Humphreys et al. (8) and subsequently purified by two successive CsCl density gradient centrifugations. In vivo labelling of Pf3 bacteriophages To obtain 35s-iabelled Pf3 coat proteins a fresh plaque was resuspended in 10 ml of M9-medium containing MgClg instead of MgSO^ (12). When the culture entered the early log phase 1 mCi of -"S-sulphate was added and the incubation was continued overnight at 370C. Subsequently, the labelled Pf3 viruses were isolated and purified as described above. 25 In vitro protein synthesis and analysis of the products The procedures for the preparation of t h e DNA-dependent c e l l - f r e e protein synthesizing system for E.coli and the techniques for SDS-polyacrylamide gel electrophoresis and fluorography have been described previously (10). Molecular cloning and DNA sequencing techniques R e s t r i c t i o n enzyme cleavage maps were constructed as described (35). previously Cloning of i s o l a t e d r e s t r i c t i o n fragments in the phage vectors M13mp8 and Ml3mp9 (18) was by standard methods. Sequencing of the DNA i n s e r t s was carried out according t o the dideoxy chain-termination method developed by Sanger et a l . (27) using an 18 bases long single-stranded universal primer. Nucleic acid sequences were analyzed using the computer programs written by Staden (30). Protein hydrophobicity was calculated according t o Kyte and D o o l i t t l e (13). A 1 2 MW tkO) 46 - 52 - 4І 26 В _ . 1 Figure 1. (A) Electrophoretio analysis of the polypeptides present in Pf3 (lane 1) and Ml 3 (lane 2) v i r i o n s followed by s t a i n i n g of the gel with Coomassie B r i l l i a n t Blue. (B) Fluorograph of 3 5 s - i a b e l l e d polypeptides present in Pf3 v i r i o n s . RESULTS To gain information about the protein composition of the Pf3 virion filament, virions were propagated in P.aeruginosa c e l l s in the presence or absence of ^^s-sulphate. The capsid proteins were isolated from the purified virions and subsequently s i z e - f r a c t i o n a t e d on SDS-polyacrylamide g e l s . The proteins were visualized on the gel by s t a i n i n g with Coomassie B r i l l i a n t Blue or with the aid of fluorographic techniques. As shown in Fig. 1, congruent r e s u l t s were obtained. In both cases i t was found that the Pf3 virion i s composed of two different polypeptide chains. The major component has a molecular weight of about ^,500, whereas the minor protein component has an apparent molecular weight of ¡16,000. In accordance with the nomenclature of other filamentous phages, the major and the minor component have further been denoted as gene VIII and gene I l l - p r o t e i n , r e s p e c t i v e l y . In contrast to Ff viruses (6, 14, 28, 29, 38), no evidence was obtained so far from our e l e c t r o p h o r e t i c analysis for the presence of other minor coat proteins in Pf3 virions. Previously we have demonstrated that the major coat protein of M13 i s synthesized both jjn v i t r o as well as in vivo as a precursor molecule with an extra leader or signal sequence of 23 amino acid residues at i t s aminoterminal end (36, 37). Similar observations have been made for fd and fi ( 1 , 4, 7, 37) and quite recently also for phage IKe (22) and Pfl (R.Konings, unpublished d a t a ) . To find out whether t h i s i s also t r u e for Pf3, or more generally whether t h i s i s a general property of filamentous viruses, we have investigated the major coat protein synthesis in more d e t a i l . For t h i s purpose, protein synthesis studies were carried out in a coupled t r a n s c r i p t i o n - t r a n s l a t i o n system of E.coli which was programmed by the r e p l i c a t i v e form I DNA of Pf3. As shown in Fig. 2, the genome of the P.aeruginosa phage Pf3 i s expressed e f f i c i e n t l y in the E.coli cell-free system. At l e a s t eleven polypeptides, ranging in s i z e from 4,500 to about 50,000, are formed, of which the smaller polypeptides are the most predominant. A similar p a t t e r n , in which p a r t i c u l a r l y the products of genes V and VIII are most abundantly present, has also been obtained during our studies on the _in v i t r o synthesis of the proteins encoded by the r e p l i c a t i v e form DNAs of Ml 3 and IKe (9, 11, 22) (cf. Fig. 2 ) . 27 MW 1 2 3 IkD) 4 "*· 48- 12.6U7- 7.5- -I Figure 2. Fluorograph of ^S-methionine labelled polypeptides synthesized in a DNAdependent _in v i t r o protein synthesizing system of E.coli in the absence of exogenous DNA (lane 1) or the presence of the r e p l i c a t i v e form DNAs of the phages Ml 3 (lane 2] and Pf3 (lane 3) r e s p e c t i v e l y . In lane U ^S-labelleá Pf3 major coat protein was run in p a r a l l e l . The 9 kD protein encoded by Pf3 RF comigrates on the SDS-polyacrylamide gel with one of the major Pf3 encoded polypeptides synthesized in the infected c e l l , t h a t p r e f e r e n t i a l l y binds to single-stranded but not to double-stranded DNA (data not shown). The ^.5 kD protein comigrates exactly with the major coat protein present in Pf3 v i r i o n s . To obtain evidence whether the l a t t e r two polypeptides are i d e n t i c a l , and thus whether they are products of the same gene, we have studied Pf3 RF directed _in v i t r o protein synthesis in the presence of the ^Η-labelled amino acids t y r o s i n e , p r o l i n e , and c y s t e i n e , which we knew from our amino acid a n a l y s i s data to be absent in the Pf3 coat p r o t e i n . As shown in Fig. 3, under these l a b e l l i n g conditions the in v i t r o synthesis of the ^.5 kD polypeptide can no longer be demonstrated. From these data and the observation t h a t both proteins have i d e n t i c a l e l e c t r o p h o r e t i c m o b i l i t i e s we have concluded t h a t the major coat protein and the 4.5 kD protein are products of the same gene and t h a t , in c o n t r a s t to the major coat proteins of the other filamentous phages, the major coat protein of the Pf3 v i r i o n i s not synthesized as a precursor molecule. The l a t t e r conclusion i s strengthened by our following observation. I t i s well known that the _in v i t r o protein synthesizing system i s not capable of processing primary t r a n s l a t i o n products unless signal peptidase i s l i b e r a t e d from residual membrane fragments by the addition of non-ionic detergent (^, 11). Pre-addition of such compounds to the system, however, did not a l t e r the e l e c t r o p h o r e t i c mobility of the _in v i t r o synthesized 4.5 kD protein (data not shown). 28 MW в 12 3 4 (kD) 48 _ 12 6 - - 97 - - 7,5 - Figure 3. (A) Fluorograph of the polypeptides synthesized _in vitro in the absence (lane 1 and 3) or presence of replicative form DNA of phage Pf3 (lanes 2 and 4 ) . The polypeptides were labelled with -"s-methionine (lanes 1 and 2) and 35s- C ysteine (lanes 3 and 4) respectively. (B) Fluorograph of the polypeptides synthesized i_n vitro in the absence (lane 1 and 5) and presence of Pf3 RF (lanes 2, 3* a n d ^)· The polypeptides were labelled with ^н-ргоііпе (lanes 1 and 2 ) , "S-methionine (lane 3)1 and ^Htyrosine (lanes 5 and 6) respectively. The arrows refer to the position of migration of Pf3 major coat protein (cf. Fig. 2 ) . To obtain information in which respect the structural and biochemical characteristics of the Pf3 major coat protein differ from those of the major coat proteins of the class I filamentous viruses, we have elucidated the amino acid sequence of the Pf3 major coat protein by nucleotide sequence analysis of its corresponding gene. To this end restriction enzyme cleavage maps of Pf3 RF were established (Fig. 4 ) . Subsequently, the gene coding for the major coat protein was localized with the aid of restriction fragment directed _ln vitro protein synthesis studies (10, 11). The major coat protein gene was found to be located on the smallest fragment obtained after cleavage of fragment Thal-B with Hindlll (Fig. 4 ) . This fragment, which is about 410 basepairs long, was then subcloned in the phage vectors M13mp8 and M13mp9 which had been digested with both Hindlll and Smal. The nucleotide sequence was established by the dideoxy chain-termination sequencing technique (27) using an 18 bases long universal primer. The deduced nucleotide sequence of the Pf3 major coat protein gene is presented in Fig. 5. 29 ,ο«"*™-—- Figure 4. Restriction enzyme cleavage maps of Pf3 replicative form DNA. The region coding for the major coat protein and the direction of transcription are indicated. One map unit corresponds to 5833 basepairs. Inspection of this sequence revealed that there is only one open reading frame present. This sequence starts with the ATG codon at position 120 and is 132 nucleotides long (termination codon TAA at position 252). It has the potential to code for a polypeptide which is ^ amino acids long and in which the amino acids residues tyrosine, proline, cysteine, glutamic acid, and asparagine are absent. The size and deduced amino acid sequence of this protein are in excellent agreement with the molecular weight and the amino acid composition established for the Pf3 major coat protein and with the data from our in vitro protein synthesis studies. We therefore conclude that this open reading frame represents the nucleotide sequence of the major coat protein gene. Reading in phase from the ATG start codon at position 120 in the 5' direction the first nonsense codon (TAA) is already found at position 96 which, in turn, excludes the possibility that the major coat protein is synthesized with an amino-terminal signal sequence of 15-30 residues as found for the major coat proteins of other filamentous phages. Another, though very unlikely, candidate for translational initiation would be the GTG codon two triplets upstream of the ATG codon. If so, the major coat protein synthesized in vitro would clearly have been discriminated from that present in intact Pf3 virions on the SDS-polyacrylamide gel systems used. Moreover, applying the "perceptron" algorithm derived matrix as published by Stormo et al. (32) to distinguish translational initiation sites, unambiguously indicated that the ATG codon is the only candidate for translational initiation. 30 aagcttgccggaaggttcaggcttgcaaattggcgggatgttatt • · · · · ι gctactttccgccaccgcttggggtattcaacaaatagcccgtttacttttaaatcgtt · 50 · · · · · 100 SD Met Gin Ser Val Ile Thr Asp Val Thr Gly Gin gatgaggtgtctttt ATG CAA TCC GTG ATT ACT GAT GTG АСА GGC CAA • · · · m 150 Leu Thr Ala Val Gin Ala Asp Ile Thr Thr Ile Gly Gly Ala Ile CTG АСА GCG GTG CAA GCT GAT АТС ACT ACC ATT GGT GGT GCT ATT • · • » Ile Val Leu Ala Ala Val Val Leu Gly Ile Arg Trp Ile Lys Ala ATT GTT CTG GCC GCT GTT GTG CTG GGT ATT CGC TGG АТС AAA GCG • • · · « 200 Gin Phe Phe *** CAA TTC TTT TGA tccgtccttgggcttttggcctcaatcgttataagggggcttc • 250 · · · · ggctcccttattcgtttagcggctaaaatttttcaattcacggggcttttatggagatt • · · • · · 300 Э50 atggaatgggtctacattatttatttgggttttgtcttgcccttttttctttttccgcg · · · · · •»00 · Figure 5. Nucleotide sequence of the 410 basepairs long Thal-B/HindlII fragment encoding the Pf3 major coat protein. Numbering starts at the first nucleotide of the Hindlll cleavage site (cf. Fig. 4 ) . DISCUSSION The coat of the filamentous Pseudomonas aeruginosa phage Pf3 appears to be composed of at least two polypeptides of which the major one has a molecular weight of 4,600, while that of the minor component is 46,000. In this respect Pf3 resembles the other known filamentous phages which have their DNA encapsulated in a sheath of several thousand identical coat proteins (ranging in size from 44 to 53 amino acids) and which ends in a few copies of a high molecular weight protein. In Ff viruses this minor coat protein (gene III protein, mol.wt. 44,750) mediates productive infection of the virus to its bacterial host (16, 24, 26, 39) by adsorption to the F-pilus. We assume that the 46 kD protein present in Pf3 virions exerts a similar function by 31 mediating adsorption of the virus to the IncP-1 encoded pili of P.aeruginosa PA01 cells. For the major coat proteins of the filamentous phages studied so far it has been demonstrated that they are transmembrane proteins, and that they are proteolytic cleavage products of precursor molecules, so called pre-coat, containing a hydrophobic amino-termiηal leader peptide. This signal peptide is cleaved off by the signal peptidase concomitant with the deposition of the mature coat protein in the inner cell membrane (U, 26). The data presented in this study demonstrate, however, that such a deposition mechanism is not valid for the major coat protein of Pf3. In contrast to the F and N-specific filamentous E.coli phages, the primary translation product of the major coat protein gene of the P.aeruginosa phage Pf3 is not proteolytically cleaved but assembled as such in the mature virion. To find out in how far the basic protein structure of the Pf3 major coat protein differs from that of the class I viruses, the nucleotide sequence of the coat protein gene was established. The amino acid sequence predicted from the DNA sequence confirmed that the Pf3 major coat protein is only НЧ amino acid residues long and that its real molecular weight is ^625. Moreover, the amino acid sequence found was completely consistent with the data incorporated in a recent report (З1*) describing the differences and similarities among filamentous phages. When the nucleotide sequence of the Pf3 major coat protein and its border regions is compared with the corresponding gene VIII of the other filamentous phages, i.e. the Ff phages and IKe, it is evident that they are completely different. Within the coding sequence of the Ml 3 and IKe genes several long stretches of mutual homology were noted, which is consistent with our conclusion that these DNA genomes, though diverged considerably, are derived from a common ancestor (21, 22). No regions of homology were found, however, between either one of the E.coli phages and Pf3, suggesting that Pf3 virus is derived from an independent ancestral virus. Interesting structural homology is noted 3' ward of the major coat protein gene. Immediately distal to gene VIII of the filamentous phages a transcription termination signal is located, consisting of a G-C rich region, which has the potential to form a stable stem-loop structure, followed by a string of Τ residues (22, 25, 33). A nucleotide sequence with similar secondary structure characteristics (Fig. 6) is found at position 285 through 314 of the Pf3 DNA sequence. Since in Pf3 infected cells several phage specific RNA transcripts are formed, which have terminated at this site 32 τ с T G CG G С G Τ G С G С (A) G С AT AT TA AT TCGTT TCGTTTA 280 310 TT T T CG CG TA CG (В) GС GС AT AT AT ATACAAT T T 1530 T T T T 1560 Figure 6. S t r u c t u r a l s i m i l a r i t y of the DNA region located 3 ' ward of the Pf3 major coat protein gene (A) and the rho-independent t r a n s c r i p t i o n termination signal of M13 (B). (unpublished data) we infer t h a t t h i s DNA sequence represents a P.aeruginosa specific t r a n s c r i p t i o n termination s i g n a l . For the F-specific filamentous viruses i t has been demonstrated t h a t within the major coat protein a " s t o p - t r a n s f e r " sequence i s present which, after p a r t i a l v e c t o r i a l discharge of the nascent polypeptide through the inner c e l l membrane, i s responsible for anchoring of t h i s coat protein molecule in the membrane. This s t o p - t r a n s f e r signal consists of a region of approximately 18 hydrophobic amino acids followed at i t s carboxy-terminal end by several charged residues (2, 3 ) . Inspection of the Pf3 coat protein sequence i n d i c a t e s t h a t also in t h i s molecule a region with similar c h a r a c t e r i s t i c s and probably i d e n t i c a l function i s present (Fig. 7 ) . Which region of the Pf3 coat protein i s responsible for i t s v e c t o r i a l discharge through the c e l l membrane i s by no means c l e a r . I t might well be t h a t the s i g n a l s for i n s e r t i o n and s t o p - t r a n s f e r overlap each other. If t r u e , the amino-termini of the mature coat proteins of viruses Ff and Pf3 almost c e r t a i n l y have a different o r i e n t a t i o n with respect t o the cytoplasmic side of the inner cell membrane. This in turn will have significant consequences for the morphogenetic reactions occurring during the t r a n s i t i o n of the Pf3 major coat protein from the membrane-bound to the DNAbound s t a t e . With respect to the mechanism of i n s e r t i o n of the major caot protein of Pf3 i n t o the c e l l u l a r membrane a final remark should be made. Protein synthesis s t u d i e s have indicated t h a t approximately 'JO amino acids of the carboxy-terminal end of the nascent polypeptide chain are contained within the ribosome. This, together with our observation t h a t the primary t r a n s l a t i o n 33 • ¡te • Л •• \ "i Ч "' "Ч i \ \ 7 ^-^V' ^' / • / • ' ι ' ' VÍ79 r . i, A M13 1Λ--Λ1 ^ "Vy РІЭ ; \и ".A \tl Amino ¿cid sequence number Figure 7. Hydropathic index profiles of the major coat proteins of IKe, M13, and Pf3. The proteolytic cleavage sites in the primary translation products of gene VIII of IKe and M13, leading to the mature coat proteins, are indicated (arrow). The sequences have been aligned by their C-termini to emphasize the similar distribution of hydrophobicity in the proteins. product of the major coat protein gene of Pf3 is only UH amino acids long and that it does not contain a signal peptide, suggests that, in contrast to the major coat protein of the Ff phage, the major coat protein of Pf3 is not inserted into the membrane co-translationally but instead posttranslationally. ACKNOWLEDGEMENTS We thank Gerard Veeneman and Dr. J. van Boom, University Leiden, for the synthesis and supply of the universal primer used in this study, and Dr. Wilfried de Jong, University Nijmegen, for his help in the determination of the amino acid compositions. This investigation was carried out in part under the auspices of the Netherlands Foundation for Chemical Research (SON) and with financial aid from the Netherlands Organization for the Advancement of Pure Research (ZWO). 34 LITERATURE CITED Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H. Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12: 4495-4503. Boeke, J.D., P. Model. 1982. A prokaryotic membrane anchor sequence: carboxyl terminus of bacteriophage fi genelll protein retains it in the membrane. Proc. Natl. Acad. Sci. USA 79: 5200-5204. Boeke, J.D., P. Model, and N.D. Zinder. 1982. Effects of bacteriophage fi genelll protein on the host cell membrane. Mol. Gen. Genet. 186: 185-192. Chang, C.N., P. Model, and G. Blobel. 1979. Membrane biogenesis: cotranslational integration of the bacteriophage fi coat protein into an Escherichia coli membrane fraction. Proc. Natl. Acad. Sci. USA 76: 1251-1255. Denhardt, D.T., D. Dressier, and D.S. Ray, (eds.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Grant, R.A., T.C. Lin, W. Königsberg, and R.E. Webster. 1981. Structure of the filamentous bacteriophage f 1. J. Biol. Chem. 256: 539-546. Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of bacteriophage fi DNA. J. Virol. 44: 32-46. Humphreys, C O . , G.A. Willshaw, and E.S. Anderson. 1975. A simple method for the preparation of large quantities of pure plasmid DNA. Biochim. Biophys. Acta 383: 457-463. Konings, R.N.H. 1973. Synthesis of phage Ml 3 specific proteins in a DNA dependent cell free system. FEBS Letters 35: 155-160. Konings, R.N.H. 1980. In Methods in Enzymology, L. Grossman, and K. Moldave (ed.) 65: 795-811. Konings, R.N.H., T.J.M. Hulsebos, and C.A. Van den Hondel. 1975. Identification and characterization of the in vitro synthesized gene products of bacteriophage МІЗ. J. Virol. 1_5: 570-584. Konings, R.N.H., R. Ward, B. Francke, and P.H. HofSchneider. 1970. Gene order of RNA bacteriophage Ml 2. Nature 226: 604-607. Kyte, J., and R.F. Doolittle. 1982. A simple method for displaying the hydrophobic character of a protein. J. Mol. Biol. 157: 105-132. 35 IH. L i n , T . C . , R.E. Webster, and W. Königsberg. 1980. I s o l a t i o n and c h a r a c t e r i z a t i o n of t h e С and D p r o t e i n s coded by gene IX and gene VI i n t h e f i l a m e n t o u s b a c t e r i o p h a g e fi and f d . J . B i o l . Chem. 255: 10331-10337. 15. Makowski, L., D.L.D. C a s p a r , and D.A. Marvin. 1980. F i l a m e n t o u s b a c t e r i o p h a g e Pfl s t r u c t u r e d e t e r m i n e d a t 7A r e s o l u t i o n by r e f i n e m e n t : of models f o r t h e α - h e l i c a l s u b u n i t . J . Mol. B i o l . 1J1£ І І Э - І в г . 16. Marco, R., S.M. J a z w i n s k i , and A. Kornberg. 1 9 7 1 . B i n d i n g , e c l i p s e , p e n e t r a t i o n of t h e f i l a m e n t o u s b a c t e r i o p h a g e M13 i n i n t a c t and disrupted c e l l s . Virology 6 2 : 209-233. 17. Marvin, D.A., R.L. Wiseman, E . J . W a c h t e l . :91^. F i l a m e n t o u s b a c t e r i a l v i r u s e s 1 1 : M o l e c u l a r a r c h i t e c t u r e of t h e c l a s s I I ( P f l , Xf) v i r i o n . J . Mol. B i o l . 82: 121-138. 18. Messing, J . , and J . V i e i r a . 1982. A new p a i r of Ml 3 v e c t o r s f o r s e l e c t i n g e i t h e r DNA s t r a n d of double d i g e s t r e s t r i c t i o n f r a g m e n t s . Gene 1 9 : 269-276. 19. M i l l e r , J . H . 1972. Experiments i n m o l e c u l a r g e n e t i c s . Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g Harbor, NY. 20. Newman, J . , L.A. Day, G.W. P o l l a c k , and D. Eden. 1982. Hydrodynamic d e t e r m i n a t i o n of m o l e c u l a r w e i g h t . Dimensions and s t r u c t u r a l p a r a m e t e r s of Pf3 v i r u s . B i o c h e m i s t r y 21_: 3357-3358 21. P e e t e r s , B . P . H . , R.N.H. Konings, and J . G . G . Schoenmakers. 1983. C h a r a c t e r i z a t i o n of t h e DNA b i n d i n g p r o t e i n encoded by t h e N - s p e c i f i c f i l a m e n t o u s E s c h e r i c h i a c o l l b a c t e r i o p h a g e IKe. J . Mol. B i o l . 169: 197-215. 22. P e e t e r s , B . P . H . , R.M. P e t e r s , J . G . G . Schoenmakers, and R.N.H. Konings. 1985. N u c l e o t i d e sequence and g e n e t i c o r g a n i z a t i o n of the genome of the N - s p e c i f i c f i l a m e n t o u s b a c t e r i o p h a g e IKe. J . Mol. B i o l . 1_8l: 27-39. 23. P e t e r s o n , C , G. Dalack, L.A. Day, and W.T. W i n t e r . 1982. S t r u c t u r e of t h e f i l a m e n t o u s b a c t e r i o p h a g e Pf3 by X-ray f i b e r d i f f r a c t i o n . J . Mol. B i o l . 262= 8 7 7 - 8 8 1 . 24. P r a t t , D . , H. T z a g o l o f f , and J . Beaudoin. 1969. C o n d i t i o n a l l e t h a l m u t a n t s of t h e small f i l a m e n t o u s c o l i phage МІЗ. I I . Two genes for coat proteins. Virology 3£: 4 2 - 5 3 . 25. R i v e r a , M . J . , M.A. S m i t s , W. Q u i n t , J . G . G . Schoenmakers, and R.N.H. Konings. 1978. E x p r e s s i o n of b a c t e r i o p h a g e Ml 3 DNA i n v i v o . L o c a l i z a t i o n of t h e t r a n s c r i p t i o n i n i t i a t i o n and t e r m i n a t i o n s i g n a l of t h e mRNA coding f o r t h e major capsid p r o t e i n . N u c l e i c Acids Res. 5: 2895-2912. 26. R ü s s e l , M., and P. Model. 1981. A m u t a t i o n downstream from t h e s i g n a l p e p t i d a s e c l e a v a g e s i t e a f f e c t s c l e a v a g e but not membrane i n s e r t i o n of phage coat p r o t e i n . P r o c . N a t l . Acad. S c i . USA 7 8 : 1717-1721. 36 and 27. Sanger, F., S. Nicklen, and A.R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7^_: 54635467. 28. Simons, G.F.M., R.N.H. Konings, and J.G.G. Schoenmakers. 1979. Identification of two new capsid proteins in bacteriophage M13. Letters 106: 8-12. FEBS 29. Simons, G.F.M., R.N.H. Konings, and J.G.G. Schoenmakers. 1981. Genes VI, VII, and IX of phage M13 code for minor capsid proteins of the virion. Proc. Natl. Acad. Sci. USA 78: 1194-4298. 30. Staden, R. 1980. A new computer method for the storage and manipulation of DNA gel reading data. Nucleic Acids Res. 8: 3673-3694. 31. Stanisich, V.A. 1974. The properties and host range of male-specific bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 84^: 332342. 32. Stormo, G.D., T.D. Schneider, L.M. Gold, and A. Ehrenfeucht. 1983. Use of the "perceptron" algorithm to distinguish translational initiation sites in E. coll. Nucleic Acids Res. 10: 2997-3011. 33. Sugi moto. К., H. Sugimoto, T. Okamoto, and M. Takanami. 1977. Studies on bacteriophage fd DNA. IV. The sequence of the messenger RNA for the major coat protein gene. J. Mol. Biol. 110: 487-507. 34. Thomas Jr, G.J., B. Prescott, and L.A. Day. 1983. Structure similarity, difference, and variability in the filamentous viruses fd, If1, IKe, Pfl and Xf. J. Mol. Biol. 1_65: 321-356. 35. Van den Hondel, C.A., L. Pennings, and J.G.G. Schoenmakers. 1976. Restriction enzyme cleavage maps of MI3. Existence of an intergenic region on the M13 genome. Eur. J. Biochem. 68^: 55-70. 36. Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers. 1980. Nucleotide sequence of the filamentous bacteriophage M13 genome: Comparison with phage fd. Gene J_1_: 129-148. 37. Webster, R.E., and J.S. Cashman. 1978. In : The single-stranded DNA phages. D.T. Denhardt, D. Dressier, and D. S. Ray, (ed.). Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. pp 557-569. 38. Webster, R.E., R.A. Grant, and L.W. Hamilton. 1981. Orientation of the DNA in the filamentous bacteriophage f1. J. Mol. Biol. 1_52: 357-374. 39. Woolford, J.L., H.M. Steinmann, and R.E. Webster. 1977. Adsorption proteins of bacteriophage fi : solubilization in desoxycholate and localization in the fi virion. Biochemistry 16: 2694-2700. 37 CHAPTER 2 Nucleotide Sequence of the Genome of Pf3, an IncP-1 Plasmid Specific Filamentous Phage of Pseudomonas aeruginosa Ruud G. M. Luiten, Debra Gluck Putterman , John G. G. Schoenmakers, Ruud N. H. Konings, and Loren A. Day The Public Health Research Institute of The City of New York, New York, New York 100162 Journal of Virology 5^, 268-276 (1985) ABSTRACT The circular, ssDNA genome of the Pf3 bacteriophage has been sequenced in its entirety by each of two methods, the M13/dideoxy chain termination method and the chemical degradation method. It consists of 5833 nucleotides. With respect to both the DNA and the protein sequences, there is virtually no homology between Pf3 and the phages Ff (M13. f1, and fd) and IKe. However.similarities between these phages were noted with respect to their overall genome organizations. The gene for the ssDNA-binding protein is followed by the gene for the major coat protein, and then by a transcription termination signal. Open reading frames for seven other proteins were predicted, and their sizes and order show a fair correspondence to the sizes and order of the genes of the Ff phages and IKe. In addition, several regions have the potential of forming stem and loop structures similar to those in the intergenic region of the Ff phage genome, but in Pf3 some are within open reading frames. Evolutionary relationships between Pf3 and the Ff phages and IKe are thus apparent through the correspondence of overall gene order rather than through primary sequence homologies. INTRODUCTION Pf3 i s one of the many filamentous viruses having gram-negative b a c t e r i a as hosts (27). The v i r i o n has a length of about 700 nm and a diameter of about 6 nm (15, 17), and s p e c i f i c a l l y i n f e c t s Pseudomonas aeruginosa 0 harbouring IncP-1 Plasmids (e.g. RP1). Like infection by a l l known filamentous v i r u s e s , Pf3 i n f e c t i o n r e s u l t s in extrusion of progeny v i r i o n s into the medium without cell lysis. The virion c o n s i s t s of a covalently closed single-stranded DNA (ssDNA) molecule collapsed upon i t s e l f and held by a protein sheath made of about 2500 molecules of a small major coat protein of only ЦЦ amino acids (6, 18, 19). For the well studied IncF (M13, f 1, fd) and IncN (IKe) plasmid 41 specific filamentous Escherichia coll phages (for reviews see refs. 3, 16, and 30), the ssDNA genome encodes 10 proteins, 1 of which is a site-specific endonuclease involved in DNA replication, another of which is a ssDNA-binding protein, and 5 of which are components of the virion. The remaining three proteins are involved in DNA replication, phage assembly, and virus-host interaction, but in ways that are not yet well defined. There are both strong similarities as well as striking differences among the various filamentous viruses, and several unique features of Pf3 make it important in comparative studies. For example, X-ray diffraction patterns of Pf3 (17) have shown that the helix of protein subumts in its sheath has the same symmetry as the subunit helices of both Pf1, a phage of P. aeruginosa (strain K) and Xf, a phage of Xanthomonas oryzae (7, 9). This symmetry is quite distinct from that characteristic of the E. coll phages Ff (M13, f1, and fd), IKe and Ifl (7, 10). Although Pf3 is in the same protein symmetry class as Pfl and Xf, it has been proposed that its DNA stucture is inverted, with phosphates in and bases out, yet quite different from an inverted or insideout DNA structure (I-form DNA) proposed for Pfl (11,19). The uniqueness of Pf3 is shown particularly well in that the major coat protein gene does not encode a signal peptide (6, 18, 19). This was unexpected since it is known that Ff-phage assembly is a membrane associated process, involving the exchange of ssDNA-binding protein molecules for major coat protein molecules that are embedded in the inner cell membrane. Comparative studies of the filamentous bacteriophages logically require investigations into the sequence organization of the phage genomes. The genomes of M13, fd, f1, and IKe have all been sequenced (1, 5, 16, 30). The many unique attributes of Pf3 make it a prime choice for detailed sequence analysis. In this paper we present the sequence of the Pf3 genome from the results of two independent studies by two independent methods, namely the Sanger dideoxy method (21) based on shotgun cloning in Ml 3 phage, which was performed in the Nijmegen laboratory, and the Maxam and Gilbert chemical degradation method (12) applied to restriction fragments cloned in a grampositive plasmid vector system, which was performed in New York. Both studies yielded a sequence of 5833 nucleotides, but true differences were found at 5 positions. 42 MATERIALS AND METHODS Bacteria and Bacteriophage. Pf3 bacteriophage and its host P. aeruginosa (PA01) bearing the broad host range plasmid RP1 (27) were obtained independently by both laboratories from D.E. Bradley (Memorial University Medical School, St. Johns, New Foundland, Canada). Phage Pf3 was propagated and purified from single-plaque isolates (6, 15). In each laboratory Pf3 replicative form (RF) DNA was isolated from infected cells, albeit with somewhat more difficulty than for other filamentous phage systems, and cloned in the respective vector systems (6, 20) for use in the sequencing studies. Sequencing by the dideoxy chain termination method Preparation of recombinant DNA was performed by standard molecular biological techniques (8). The single-stranded bacteriophage vectors Ml3mp8 and Ml3mp9 and their host E. coli JM103 have been described previously (13). The dideoxynucleoside triphosphate chain-termination method was used essentially as previously described (21). A synthetic deoxy-oligonucleotide primer, 5'-dGTAAAACGACGGCCAGTG-3', a sequence that is complementary to the region directly preceding the multiple restriction sites in M13mp8 and M13mp9 was kindly provided by Dr J. van Boom (Leiden University, Leiden, The Netherlands). The nucleotide sequence data were stored and handled with the aid of computer programs developed by Staden and others (25). Sequencing by the Maxam and Gilbert technique. The method of Maxam and Gilbert (12) was used, with one modification used by several laboratories: limited DNA cleavage at guanines and adenines was accomplished by incubation of labeled DNA in 67? (wt/wt) formic acid at 20oC for 5 minutes, with subsequent reaction steps identical to those described by Maxam and Gilbert for limited DNA cleavage at pyrimidines. sequence analysis was from two recombinant plasmids. The DNA used for One contained the largest EcoRI fragment (3.8 kb), and the other contained the two smaller EcoRI fragments (1.2 kb, 0.8 kb) of Pf3 DNA inserted into the cloning vector рВ021Ч as described previously (20). из RESULTS Strategies used for the M13/Sanger technique. In collaboration with Diana Hill (University of Otago, Dunedin, New Zealand), a genomic library of Pf3 was constructed by shotgun cloning of blunt-ended DNA fragments into the unique Smal-site of the vectors МІЗтр and МІЗтрЭ. The DNA fragments were obtained by sonication of Pf3 RF DNA, followed by repair with ΊΗ DNA-polymerase and size fractionation on agarose gels (2). At a later stage additional clones were obtained by restriction endonuclease digestion of Pf3 RF DNA and ligation of the fragments into appropriately cut acceptor DNA from the MlЗтр and Ml3mp9 vectors. Data obtained by nucleotide sequence analysis of all clones were entered into the computer by using the DBUTIL program (24), which is specifically designed for the construction of data bases from accumulating data in a shotgun sequencing project. At the end of the sequencing project 85% of the genome was sequenced on both strands from at least two, but usually more than four separate clones. Although the nucleotide sequence of the remaining 1 5% was derived from data from one strand only, the positions of all but 60 nucleotides were derived from at least two separate clones. A compression at position 4885 and 4886 could be resolved after comparison with the sequence established in the New York laboratory. Strategies used for the Maxam and Gilbert technique. To provide a convenient source of pure DNA for sequencing, the three fragments produced by EcoRI cleavage of Pf3 RF DNA were inserted into pBD2l4, a plasmid vector of B. subtilis (20). Sequencing reactions were carried out on three EcoRI fragments with the DNA from two clones, one containing the largest EcoRI fragment (3.8 kb) nd the other containing the two smaller fragments (1.2 kb, 0.8 kb). End labeling was followed by either secondary cleavage and fragment separation, or by strand-separation on denaturing gels. Many of the restriction sites used were known from mapping data (18, 20), but others were deduced from the sequence data as they were collected. Sequence data were obtained for both strands over about 75% of the genome, and the single strand data for the remainder were, in most cases, drawn from two or more independent sequencing efforts. Figure 1 summarizes the strategy used and the extent of the data obtained. ЦЦ -s Hl- 1—.1 M J—ІФ =c=i^Mfe-^H * 5Θ13/Ι О о ι—t (+) -Lb-I 'Г Mí" •SE ΟΙ ι—f- 1 1 -S S IX Ω I 43~ Φ4 ^шимг иι -U-l- l· 2065 .1 4 r - ^ M WfT •£=& 3298 о υ Lü ж) , > I t-)| 4073 i 1 "" Is — г"1I ~ ~ — t tlt LO if— CO -H ! σ -5 о LL i—J =* ι 52S Figure 1. Strategy for sequence analysis of the three EcoRI fragments of Pf3 by the Maxam and Gilbert sequencing technique. In each sequence, left to right above the center line is 5' to 3' on the (+) strand, and right to left below the center line is 5' to 3' on the (-) strand. Filled-in circles indicate labeling sites. Lines and arrows indicate lengths of sequenced fragments and the direction of sequencing. Before the project was completely finished, it was learned that the Nijmegen study was complete and results from the two laboratories were compared. Differences were found at at ^3 positions, more than half of which were in a 300 bp region where only preliminary single-strand Maxam/Gilbert data were available. Completion of the sequencing in this region, as well as rereading of gels in other regions yielded a final sequence that differed from the Nijmegen sequence at 20 positions. As mentioned above, two of these were attributable to compression that affected the dideoxy results. Thirteen other differences were C/T ambiguities in regions where only single-strand data were available from the Maxam/Gilbert sequencing study; the sequence established in 45 Nijmegen provided the correct bases at these positions. The 5 remaining differences, discussed below, were confirmed by each laboratory as true differences. Complete sequence obtained by the two methods (with differences at five positions) The entire sequence of Pf3 DNA is presented in Figure 2, including the derived amino acid sequences of the polypeptides encoded by the assigned and proposed genes. Differences in the results obtained by the two laboratories occur at positions: 1618, 3679, 4380, 4696, and 5308. Three of the five differences cause amino acid substitutions in unidentified open reading frames. At position 1618, a G yields a Leu residue, whereas a Τ yields a Phe residue; at position 4696, a Τ produces a Tyr codon, whereas а С produces a His codon; and at position 5308, a Τ gives Val, whereas а С here gives Ala. The C/T difference at position 3679 is a silent change: a Pro codon is predicted in either case. However, Τ but not С at this position would be part of an Mael recognition site. Τ at position 4696, but not C, would be part of an Rsal recognition site. Cloning of fragments obtained by Rsal cleavage demonstrated the presence of this Rsal site in the Nijmegen strain of Pf3. The A/G difference at position 4380 occurs in a non-coding region. The base composition of Pf3 DNA (19.9% A, 21.3% C, 24.0? G, and 34.8? T) deviates significantly from that of its host P. aeruginosa (G+C content: 60Í). It is noteworthy that like the DNAs of the other filamentous phages (Ff and IKe), the total base composition of Pf3 DNA has a high fraction of T. Figure 2. Nucleotide sequence of Pf3 DNA. Numbering begins at the unique Hindlll recognition site. Amino acid sequences for assigned genes (p78 and p44) and orfs for seven proposed genes are shown. Stop codons are indicated by asterisks. Differences between the New York and the Nijmegen strains are at positions 1618, 3679, 4380, 4696, and 5308, with nucleotides and derived amino acids for the New York strain given in parentheses. 46 S L P t G S C L Q I G C H L L L L S A T A W G I Q Q I A B L L L N B · · ! I AAGCTTGCCCGAAGGTTCAGGCTTGCAAATTGCCGGGATGTTATTGCTACTTTCCGCCACCGCTTCCGGTATTCAACAAATAGCCCGTTTACTTTTAAATCGTTGATGACGTGTCTTTTA too I pU K g S V I T D V T G Q L T A Y Q A D I T T I G G A I I Ï L A A V V b G I R Ï I K Tl.CAATCLGTCATTAC7GATGTGACAGGCCAACTGACAGCGGTCCAACCÏGATATCACTACCATTGGTGCTGCTATTATTGTTCTGGCCGCTCTTCÎGCTGGGTATTCCCTGGATCAAAG ' ' 200 ' [ Α β F Γ · J CCCAATTCTTTTGATCCGTLCTTGGGCTTTTCCCCTeAATCGTTATAAGGGGGCTTCGGCTCCCTTATTCCTTTAGCGGCTAAAATTTTTCAATTCACCGGGCTTTTATGGAGATTATGC зов I [и G L H ï L Ρ G F C L A L F S P S A I A A G P V S T t V A A G T T T Ï R Y T H T AATGGGTCTACATTATTTATTTGCGTTTTCTCTTGCCCTTTTTTCTTTTTCCGCGATAGCTGCTGGGCCTGTTTCTACAGAGGTTGCTCCTCGTACTACTACCTATAGAGTCACCAATAC 400 ' J T V B T P P N V T L S P V B D I T P Ï V E K I P N K G L A Q A A Q C R L I V A Q AACCGTTCGAACTCCTCCTAATGTrACGTTGTCTCCTGTTCGTCACATTACCCCTTATGTTGAAAAGATCCCCAATAAAGGTTTGOCACAAGCTGCCCAGGGTCGTTTGATTGTrCCTCA 500 ' · 600 B A A S V P V T G F F N V S G A V V K S G A K S F L B S A G H A S G I G L G L A ACGTGCGCCTTCTGTTCCTGTTAtTGGCTTTTTTAATGTTTCTCCCGCTGTTGTTAAATCTGGTGCTAAGTCCTTTCTTCGCTCTGCTGCAACGMCATCGGGTATAGCTTTGGGTTTGGC 700 A L L E A A D V V F D E E G E I V K P L P G C G S P V L H P B P V I L M E Y T V GGCTCTTTTAGAAGCTGCTCATTGGGTTTrCGATGAACAAGGTGAAATAGTTAAGCCCTTACCTGGTCGTGGCAGTCC^GTTCTTATGCCTCGGCCTG-CATTCTCAATGAATACACTGT 600 T C S A C Q V a l S K E Y E F D P B S V F G V Y S Y N G N P V V V S A V E D V C TACTGGTTCTGCTGCGCAGTGGAGTATTTCTAAACAATATGAGCCTGATCCCACCTCAGTTCCTCGATGGTATTCTTATAATGGCAATCCTGTTTGGGTTTCCCCTGTTCAAGATGTTCG 900 · ' F T W B Ï W Y F A D V L H D G Q G B P K Ï L V A Ï S B S G P l I E Y W e D V G G Y ATTTACTTC:CGCTACTGaTAmTGCTGACGTTTrAATGGATGGCCACGGCCGTCCTAATTA7CT"3TTGCCTATTCTGATTCTGGCCCTAA^GA3TATTC3CAGGATGTTGGGGGCTA orf^83 S L D S L P T E P E P Y P L T D A E L E A G I D I 5 Ï Ï E P D ? D D W R 1 I I , F P Ï ТТ(.ТиТТОАТТСТСТТСССАСТОАА!;СТОАА'ГГТііТСССТТТСАСТСАТ0СТОААСГГ0АС0.СС2"АфТ0АТ:А0ТАТТАпСАА:СТгДТССТ0АТЗА7Т0ОСаСААТТТСТТТССТТА 1100 1 200 I E P D S F T X E T P I P S L D I . 5 P V V S S S T N I f 4 ' , < : X ' T V T E T T T S TATTGAGCCGGATAGTTTCACTATAGAAACTCCTATTCCGTCmGGACCTrCGCCTGTTGTrTCCAGrrCGACAAATAATCAGACTGGTAAAGTTAC^GTTACTCAAACCACTACCTC l'OO Y D F E V S D N H S S g P S I S Y I I E T T T b . H V Ï Y D G D L V S S E T N T T V TGTTGATTTÎGAGGTTTCTCATAACAATTCTTCTCAACCTAGTATTAGCGTTAATGAAACTAC'ACCGAGAATGTTrATGTAÎA'ICTGACTTACTATCrrCTGAAACCAATAC'AC-GT HOO T N P P S S G T S T P P S S G S G S D F Q - P S F C S l i A T A V C D W F D W T g TACTAATCCTCCGTCC7CTGGlACTTCAACGCCCCCATCriCTGGTTCCCG'-rCTGATTTCCA57TGCC-ACCTTTTG7-'CC-GGGCAACTGCTGTCTGTGAT"GG'n'?GATTGGACACA 1500 Ë P I D E E P D L S G I I ' D I D D M P j E R T K D I S F C S K S C P A P I A L C i τ φ , AGAACCAATTGA7GAAGAACC7GAτ7TAAGTCCCATCAT7TCAGA7A77^A GA "Tt,(T)GAACG"ACCAAAGA"A™''TCC7τ7CGCTCAAΛG7CC7G^CCTGCG:C"A7CGCATτGGA7A· 1600 E F b D M S V D L S r E V ' L E L A G I . Y F N V H A S A Y V L A A T I Î L G V TGAAT7-C77GATATG7C7G77GATCTTICCTTTGAATCG7T77G7CAG 7τCC7CGAA7CA"A"Ά7T7TA,"CGτ7A·1'GGCAT'^TGC7TATG7CC7GGC^CC^A7ATAACC'"^GCGCG7 WOO « 1800 V R a (H A B b - A L V Ï A b S . F V L K L F 7 V L G Y l . I F Τ Y V G С Τ A l V J C^'7LG' , ' J ut7A l ,A 'AL"7G--'.7TJTCATTl,^TlA-GCA7T(.T CAU T " w i rTTAAAACTj-TTACTCTG«, l'i-G" ,~7CGTA77T"CAC'TAÎbTTI<GA77»ACAGLTT7 ^~K ι S b t - N Α ^ ι , ν " ι « . ~ AA orf93 - - 3 P K i . T G L i , S t . L D l » A ' A "ΑΑι.ι.ΑΑ~ι,»τΤ-ι^'·.ΰ^Τ'Ί.Ι Τ іЛА"А"Ті.І" 1 аАТАТ7і.Т > . ^ - Γ Α " ^ ! , " » 7 G ι V ' E A b S . . J , *ч.АА.і." ''AT"A' r ":"G,... 1 ""\.7i, A b L * ТГГССАА Г^ 47 FIG. 2—Conliniied | Ν Ί R S I I A L U L S Ρ Α Ι Υ Ρ Ρ A Ρ A S D R Ι Τ Y R A S I N S A K A P V G V L T · ! OTüCeTCAATCAATTCTCCTAAAGCCTTTGTGCGAGTCCTGACATCATCCCTTCAATTATTGCTTTUATGTTCTCrrTTGCTCTTSTGCCTTTTSCTTTTCCATCrGATCCACTTACGCT I · 2100 . . . . . . K H H E I D I R V A I P L V A D r C G R S V Y L G P S X q C V V S L D P D D V P ТАААСАТСАТОАОАТТОАТАТТСОТОТТССТАТТССТТТООТТОСТОАСТТТТОТООІСОаТСТВТТОТТСТТООСССАТСТАТТСАООСТОІСвТАТСТТТАОАТТТТСАТОАТОТТСС 2200 . . . . . . . . C S Q A P D L L L E S N H L L S S N Y G D V L V I T A H O g V L N S E R K A D D TTUCTCTCAAGCGTTTCATCTTTTGCTTGAGTCTAATCATTTGCTTTCTTCTATCGTCCGTGATGTTCTTGTTATCACTCCTATCGATCAGCTTTTAAATTCTGAACGTAAACCGGATGA 2300 . . . . . . . . . 2 4 0 I R T P B R C b P « . A K D I E R R V I I Î I V K A S A S B Y V S I P I C E S P K S ТТТОАСААСТТГССвССОТСАТСТТТТТААТОССААСОАТАТТОААСОСССТОТТАТСААСАТТСТТСАТОСТТСООСТТСТОАООТТОТТТСАСТОТТІАААОААТССТТСАТСТСТСІ 2500 C A P G H S M T V D E R T N S V P A A L P S S P P P A L E S V i g A X D V P V 0 L R TGATGCTCCAGGTATGTCCATGACTGTTGATGAACGGACTAACAGTGTTTTTGCTGCATTGCCTTCTTCGTTCTTCCCTGCTCTTGAGTCTGTGATTCAGGCTATTGATGTTCCGGTTCG 2600 orf/»30 Q V A I E A N V V E A S V D V S K R L G L U V C G A L S L C H V S A V T A C D L TOAGGITGCTATrGAAGCGAAIGTGGÏTGAGGCÎTCCGTGGACTGGTCTAACCGCCTICGÎCTTAATTCGGGTOGTGCGTTATCCenGCTAATTWTCTeCTGTTACTGCTGGTGATTT 2700 . . . . . . S V A A G S S I G P G P L S N T L S L D G L P T A I I E R E G Î C R V V S R P T L ОТСТСТТОСТССТССТТСТТСТАТСОСАТТТСЗТТТТТТиАОТААТАСССТТТСССТТОАТООТСТТГГТАСТССТАТООАОААТОААООСААТОСвСОТОТССТТТСАСОТССТАСС'ГР 2500 . . . . . . . . L T L D H Q S A S V L R G T E L P r Q Q S A C D C A T S V A P K H A A L S L E V GCTGACACTGGATCGCCAATCGGCTTCTGTCCTTCGTGGTACTGAATTGCCTTATCAOCAATCTGCGGGTGATGGTGCTACCACTGTTGCTTTTAAGGATGCCGCCTTCTCCCPrGAGGT 2900 . . . . . . . . . i o o o 9 K P Y I S P D N S I Y I E Y L V S R D S P B P S N A I D G Y P P I B T R R L Y T ТААОССООТТАТСТСТССТОАТААТТСААТТОТТАТТСААСТОСТТОТТТСТСОТОАСТСТССТААТТТТТСАААТССТАТТОАТООТОТТССОССТАТТОАТАСАААССОССТГСТААС 3100 T r R V P H O Q T V V L G G V I S T I I I Q e C S S R Y S G I S R I P G I G R b P TACTATTCGTGTTCCTCATOGTCAAACTGTTGTCCTGGGTGGTGTTTATTCAACTATCAATCACCAAGGTTCTTCCCGTGTTTCTGOTATTTCACGAATCCCAGGTATTGGCCGTTTGTT 3200 . . . . K K K E H V T E ' Q Ï E L L I P L T P R I L G L E Y E P E K Q S l . V P D E S P P L CAAAAAGAAAGAACACGTTACTGAACAATATGAATTGCTCATATTTCTTACACCTACAATTCTTGCCCTTGAAGTAGAACCTGAAAAACAATCTTTCCTTTTTGATGAATCGTTTTTCCT 3300 . . . . . . G D L Ρ · ΓΗ Ι Τ L Ι Τ A V Ρ G S TGCTCATCTrTTTTAGCGGCTAAAATTTCTTCTATGTTÏTATGTAGTACGCÎACAACATACTACATACTACAAATCTAGOGTGGTGTGATGATTACGTTGATAACAGCGGTCCCGCGTTC J ' · 3400 . . . . C K T L Y A I G L I E A A L S E C R F V F T R I S G L V K D K r S Ï P H L L S D CGGTAAAACTCTTTACGCTATACGTTTGATTGAGGCTGCCCTTTCCCAAGGGCGGCCAGTTTTCACAAACATAAGTGCCTICGTTAAGCATAAATTCTCTAATCCTCACCrrTTGTCTGA 3500 . . . . . . . . . 3 6 0 0 A P D D W R B T P E G S L Y Y Ï D E A Q Q A H L Y Ρ(Ρ) S R A Q R G P V T D E R L T TGCGCCTGATGATTGCCGGGACACTCCAGAGGGATCGTTGGTGGTTTATGACCAGGCCCAGCAAGCGCACTTGTACCCÎTJTAGCAATGCCCAGCGTGGGCCGGTCACGGACGAGCGCCTAAC 3700 orf301 A M E T H R U T G H D L Y P I T e A P T P Y H H H I B K l Y C L H I H L Ï R S I Î GGCAATCCAAACGCACCGCCATACCCCTCATGATCTCGTTTTCATTACCCACGCTCCCACGTTTGTGCATCATCACATTCGTAAGCTGCTTGGGCTCCATATCCATCiTÌATCGTTCGCG 3ΘΟ0 . . . . C L g A A S K I E V S l l Y C D S P N D R K E Q a R A D r V L V X r P K E H P A F TGCCCTCCAAGCCGCTTrTAAGTACGAATGiAGCCATGTTTCTGArrCACCTAACCACCGGAAGGAACAACAAAGCGCTCATTICGTTCTATGGAAGTTCCCCAAAGAACATTTTCCTTT 3900 . . . . . . 48 FIG. 2—Continued r T S A V I I H T H K F K K F K K I C Y L L V r V V I . G L G A V C F N L Y K N S G ' TTACACCACTGCCGTTATCCACACGCACAAATTCAAGATGCCTAAGAAGATAGGTGTTCTGTTGGTTTTTCTTGTTCTCGGTCTGGGTGCTGTCCCTTTTAATCTTTATAACAATTCACC 4000 . . . . . . . . L A S N A E A T A S V A E A T P S P L A L H G V I C F S S L A A P T a V S A A A P GCTGGCTrCGATGGCAGACCCTACCCCTTCTGTGGCAGAGGCTACCCdTCTCCCTTCeCGTTAAACGGCGTTAAACCtTCTTCCTTCGCTGCTCCCTATCACTGGTCTGCTGCGGCTCC 4100 ' ' · · ' ' . . . • 4 г о о A V P V S C C V A I B S T H B C Q C P D A S C V Y L A I E H A A C L S V I S S P TGCTGTCCCTGTGTCCGGTTGTGTTGCTAACCGTTCAACGAACCGTTGCCAATGCTTTeATGCTTCTGGTGTCGTCCTGGCGATTGAACACGCGGCCTGCCTTTCTGTTATTAGTTCGCC 1 . ' ' ' ' ' ' 4500 L P B Q L L S T S K · ! GCTTCCTCGTCAGCTTTTCAGTACCACCAACTCATTCCCGAAAGCGAGCAAAAGCCGGAA(C)CGGCTTGCCGCCGCTTGCCCCTCCCTCTTCATTAGTACTCACATATCCGTACCCTCCCCA •· | · · ' 4400 . . . . i N B C L K S r R H C r T L G T N C T E P G A K R F R C D R S T AATCCCCATCCTTGGATCAGGTCATTTATGCGTTGTTTAAAATCCTTTCGTCATCCrrmCCCTTGGAACCAACTGCTATCAACCTCCGGCTAAACGCCCTCCGGGTGATAGGTCTACT 4500 . . . . . . V G G V S H C S T S R K I A P L R S I D E A K L T G H A L A L T L T V R D C P D GTTGGTGGTTGGTCGCATGGTTCAACCAGTCGGAACATTGCTTTTTTGCGTTCCATTGATGAAGCAAAATTGACTGGTCATGCCTTGGCCTTGACGCTCACTGTTCGGGATTGTCCGGAT 4600 . . . . . . . . Τ S D D V Y(H) X V R B A P E H R L R R l G L I R M H ï y l E W Q H R G V P I I L H C ACTTCCGATGATTGGTtCjACAAGGTACGCCGTGCTTTTGAAATGCGTTTGCGCCGTCTTGGCTTGAICCGCATGCATTGGGTTATTGAGTGGCAACGTCGAGGGGTTCCGCACCTTCACTGC 4700 . . . . . . . . . 4 8 0 0 A A P P D D T A P A L L P A V I U R S W C D L V S D Ï H A S P L S Q r V L P I T GCTGCrrmTTCATCACACTGCGCCTGCCTTGCTCCCTGCTG'TTATTATGCGTTCCTCGTGCGACTTGGTTTCTCACTATAATGCTTCGCCTCTTTCCCAGTACGTTTTGCCTATTACT 4900 orf278 D A I G V F Q T V S X H ' A A R G V N H Y g R S P E N I P P Q V Q K X T G R H V G GACGCGATTGCrrGGTTTCAGTACGTCTGAAAGCATGCTGCGCCCCCTGTCAATCACTACCACCGTTCGCCCGAAAACATACCGCCGCAGTGGCACAAAAAAACCGGCCGCATCTCCCGT 5000 . . . . K Y G B W P V V E K A E I P I 1 G D A T F Ï 9 L R R I V K R W R P A D A R A S G S AAGGTCGGTGAGTGGCCGGTGGTGGAAAAGGCTGAAATTTTCATGGGTGACCCTACGTTCTATCAGCTTCGCCGTATCGTTAAGCCCTGGCGTTTTGCTGATGCTCCGCCTTCCGCTTCC 5100 . . . . . . I H R i a S A K K r L Q V P E T L S R V L G A S E W K P E N E L L S I L Y P L K ATCCATCGCATTCGATCTGCAAAAAAGTACTTGCAAGTTCCCGAAACCCTGTCTAGAGTTCTAGGTGCATCTGAATGGATGCCAGAAAATGAACTTTTGTCGATACTTTATTTTTTGAAA . ' 5200 . . . . . . . . S q G I E F L [* l V(A) H H I C H P P R F H C Q L X L I . C L L I I A K A V S Y F N V G TCTCAAGGCTATGAATTI.TTATGATTGT(C)TCACAATATCTCTCATCCGCCTCGCCCICACTGTCAGCTCAAGCTCTTATCCTTGCTCAA7CCCAAACCT3TGTCTTACTTTATGCTCG3CA 530o¡ I . . . . . . . . . 540O ort 7' T D D K I E A E Y Ï Y P A D E S V A V A R P G Q P V X A Ï H T I Q S V C P H CTGACGATAAAATCGAAGCTGACGTTTGGGTTTTTGCTGATGAATCCGTTGCTGTTGCTCGCCCAGGTCACCCTGTAAAGGCTTACCATACCATTCAATCTGTTTGCTTCCATTGACGTG 5500 ι i K I I I Q I T F T D S Y R Q G T S A K G N P Ï T F g E G P L H L E D K P F P L CATTTTATÜAACATTCAAATTACCTTTACCGATTCCGTCCGCCAGGCTACTTCCGCTAAACGGAATCCTTACACGrtCCAAGAACGGTTCTTGCATTTGGAAGATAAGCCCTTTCCTCTC 5600 p78 Q C Q P F V E S V I P A C S i q V P T R I N V N H G R P E L A P D F K A H X R A САОТСССАОГГСТТТОТТСАОТСОСТСАТТССТОСССОТТСТТАТЗАООТОССйТАТСССАТТААСОТОААСААТООССОТССТСААТТСССГГТТОАТТТГАААО^С^ТОААОСгтаса 5700 . . . . . i H i t I V C V O L V N D V C H E W A E R S D L L TAATGA'GTTATTATCTTTÜTGTTCAGCTTGTTAATGATGTTTGTCAIGAATSCJCTGAACGTTCAGATTTGCT 1 I ' ' ' 5800 . orf58 49 DISCUSSION Genetic organization To establish the organization of the genome, we first searched the viral strand for orfs. A schematic representation of all start and stop codons, and consequently of all orfs is given in Figure 3. On the basis of the arguments presented below, we postulate that the nine orfs (orf) shown in Figures 2 and 3 are actual protein coding sequences. It has been established previously that orf78 and orfHH are coding sequences for the genes for the single-stranded DM-binding protein and the major coat protein, respectively (6, 18, 19), and therefore we shall refer to them as p78 and pUk. In addition to the major coat protein there is a protein of about 50 kd present in small amounts in the virion (6, 18, 19). The coding sequence for this protein may be orf483, located 107 nucleotides downstream from рЧЧ. rf3 rf2 rtl 93 •' ι • Ί Ί Ι Ί ' Ί Ί Γ , Ί Ι Ι Ι ' Μ ι 5β 483 -"•Ч 1 1 I 71 1 · 4 '1 II· 'Λ λ ^ ' " . Η Ί ' ' " 430 i.' ' i ! ! И 'I Β |ι11 • ' "'Ί'Ι • 58 ιιιι1| 30! ! li 1 'Ίΐ,Μη1 „• i1,1,," __278 I T I π ι um ιι J 1000 ц, L II . Ι , Τ Β Ι Μ 1 . | 2000 I мм. .ІІЛІ.І I 3000 ¡lil, . и | :.|-. :ι ι ini 7B_ ι L ¿.OOO 5000 Figure 3. Orfs in the Pf3 sequence. For each reading frame, the bars above the center line represent stop codons (TAA, TAG, TGA), and the bars below represent ATG start codons. The positions and sizes (in numbers of codons) of the assigned and proposed genes are indicated. Orf93 starts with a GTG, instead of a ATG, that is not indicated (see the text). It should be noted that because the genome is circular and the total number of nucleotides is not evenly divisible by 3, a diagram like this represents a three surface Moebius strip; the reading frame labeled rfl continues into rf2, and rf2 continues into rf3 etc., where nucleotide 5833 joins nucleotide 1. Orf58 merely appears split because of our choice of the physical origin within it. 50 ι 58 The main observation was that after cleavage of Pf3 RFI at the unique Avail site located within orf483, the resulting linear (RFIII) molecule no longer yields, in an i_n vitro transcription-translation system, a product that comigrates with the 50 kD protein component of the virion (D. Putterman, unpublished results). The remaining six large orfs are orf93, orfUSO, orf301, orf278, orf71 , and orf58, which follow in order after orfi)83 in the 5' to 3'direction along the viral strand. OrfSS, which lies between p78 and p44, includes a previously proposed 22 amino acid protein in the same reading frame; an ambiguity in the original sequence data (19) within this region was resolved with the data from the dideoxy method. Orf93 starts with a GTG codon, and all others start with an ATG codon. In addition to these considerations, the arguments which led us to postulate that the seven unassigned orfs represent real genes, are as follows: (i). On the basis of a preferential codon usage among all genes of a small replicón, the FRAMESCAN computer program of Staden and McLachlan (26) correlates the codon usage of all orfs present in a sequence with that of assigned genes. With the codon usage of both the ssDNA-binding protein gene and the major coat protein gene providing the basis set, strong correlations are observed only within the orfs mentioned above. Table 1. Codon usage of the assigned and proposed genes of the Pf3 genome.3' ^cid Codon Acid Codon No Acid Codon No Ser Ser Ser Ser ТСГ TCC TCA TCG 76 31 19 19 Тчг "Ivr TAT TAC ТЛА TAG 37 14(13) 1 Cys Cys Trp TGT TGC TGA TGG 14 10 6 34 CTG 62 8 8 22 Pro Pro Pro Pro CCT CCC CCA CCG 66 8 10 21 His HIS Gin Gin CAT CAC CAA CAG 26 13 (14) 30 31 Arg Arg Arg Arg CGI CGC CGA CGC. 43 20 5 14 lie He He Mel ATT АТС ATA ATG 65 20 14 34 Thr Thr Thr Thr ACT лес АСА ACG 50 26 13 16 \sn Asn Ivs L-ys ΑΛΤ AAC АЛЛ AAG 45 16 30 28 Ser Ser Arg Arg Val Val Val Val GTT GTC G H GTG Ala Ala Ala Ala OCT GCC GCA GCC. 96(97) 21 14 26 Asp Asp Glu Glu GAT GAC САЛ GAG 80 17 63 25 Gly Gly Glv Gly Acid Todon No Phe Phe Leu Leu UT TTC ТТЛ TIG 61 (64) 25 19 62(61) Leu leu Leu Leu LIT a ere СТЛ 113(112) 19 7 28 No -> лет AGC AG\ AGG 16 6 5 4 GGT GGC GGA GGC. 77 24 9 19 Note the highly preferential use of Τ as the third base. Numbers in parentheses are for the New York strain. 51 Table 2. Shine/Dalgarno sequences for the assigned and proposed genes of the Pf3 genome.3 E. coli 16S rRNA P. aeruginosa 16S rRNA 3'-auuccuccacuag-5' 3'-auuccucuc-5' p44 (Major coat protein) Orf483 Orf93 Orf430 OrDOl Orf278 Orf71 p78 (ssDNA-binding protein) Orf58 gaugaggugucuuuuAUG uauggagauuauggaAUG ccugggggugguucG UG ugugggaguccugacAUG uguaggguggugugAUG gaucaggugauuuAUG cucaaggcuaugaauucuuAUG auugaggugcauuuuAUG caugaagcgugcguaAUG a P . a e r u g i n o s a and E. c o l i 16S rRNA sequences a r e from r e f e r e n c e 2 3 . Note both t h e mutual homology among t h e sequences and t h e complementarity t o the 16S rRNA species. The codon usage of a l l these reading frames resembled t h a t of the Ff phages and IKe with respect to the p r e f e r e n t i a l use of Τ (U) as the t h i r d base of the codon (Table 1). (ii). Each of the nine orfs i s preceded by a Shine/Dalgarno sequence (23), as defined by s i g n i f i c a n t homology to the 3 ' terminal nucleotide sequence of both P. aeruginosa and E. c o l i 16S rRNA (Table 2 ) . In a d d i t i o n , the nine orfs ranked high when the Pf3 sequence was searched for probable i n i t i a t i o n s i t e s by programs based on the perceptron algorithm (28, 29). In the absence of a l i b r a r y of characterized sequences from P. aeruginosa, we used matrices published by Stormo et a l . (29) containing i m p l i c i t l y t h r e e consensus sequences for i n i t i a t i o n regions spanning 51, 71, and 101 nucleotides derived from t r a n s l a t i o n a l s t a r t s i t e s of 12^ genes of E. c o l i and Salmonella typhimurium. Considering only s i t e s beginning with ATG or GTG, we found the nine proposed genes among the top 20 or so in each of the rankings based on the t h r e e matrices. Only six or seven other positions received high rankings by a l l t h r e e matrices, with the C-terminal 87 amino acids of orf301 and the C-terminal 287 amino acids of огГЧЗО being especially high. The r e s u l t s give a d d i t i o n a l confidence in the nine genes proposed and suggest the possible existence of a few overlapping genes. ( i i i ) . The s i z e s of the polypeptides produced under the d i r e c t i o n of Pf3 RF DNA in E. col i based coupled t r a n s c r i p t i o n - t r a n s l a t i o n systems in v i t r o roughly support the assignments. 52 Figure 4. Comparison of orfs, genes, and non coding regions for the Pf3 and the Ff (МІЗ) phage genomes. The maps are aligned at the major coat protein genes. As mentioned, the ssDNA-binding protein (p78), the major coat protein ( p W ) , and a presumed minor coat protein component of 50 kD, probably encoded by orf483, have been identified with these systems. In addition, other major polypeptides are synthesized in these in vitro systems, which have the apparent sizes of at least four of the proposed gene products. Since all of these analyses ultimately led to the same results, we conclude that the orfs of the viral strand, as presented in Figure 2, are real coding sequences. On the complementary strand, no reading frames larger than 115 codons are present. Of those found, none has a codon usage resembling that of the two established genes, nor are any of the ATG and GTG codons preceded by a Shine/Dalgarno sequence, as analyzed by the computer programs mentioned. We therefore conclude that only the complementary strand of Pf3 RF DNA functions as a template for transcription. In accordance with this is the observation that Pf3-specific mRNA hybridizes only to Pf3 RF DNA but not to ssDNA isolated from purified virions (R. Luiten, unpublished observation). Exclusive use of the non-viral strand as template for transcription is characteristic of the other filamentous bacteriophages. Intergenic regions It is well established that in the Ff phages and IKe there are two principal intergenic regions (1, k, 5, ΙΊ, 16, 22, 30). One of approximately 60 bases lies just beyond the major coat protein gene in the 5'-3' direction, whereas a larger one of approximately 500 bases (IKe 730) lies between genes 53 IV and II. Both regions are characterized by a high potential for forming base paired stem and loop structures. The Pf3 genome contains three small non coding regions; interestingly, nucleotide sequences present in all of these regions can potentially form stem and loop structures. The first region is a sequence of 107 nucleotides between рЧЧ and огГНбЗ, and within it is an exact inverted repeat of 10 bases that functions as a transcription termination signal (6, 18, 19, and R. Luiten, unpublished data). The second non-coding region is a 72 base sequence between orf430 and orf301 (Figures 4, 5 and 6). Beginning 9 bases from the stop codon of orf430 are 51 bases capable of forming a stem and loop structure. The structure of this inverted repeat is remarkable in that each arm of the stem consists of two direct repeats of a 7 base sequence and a third near repeat having a modification at one position. Four bases downstream begins a sequence of 98 nucleotides (that extends into orf301) capable of forming three stem and loop structures. The two-dimensional basepairing diagrams one can draw for these inverted repeats are quite similar to those one can draw for part of the Ff intergenic region (Figures 5 and 6 ) . Pf3 orf 276 Ff Figure 5. Schematic representation of potential secondary structures in the Ff intergenic region and part of the Pf3 genome from orf430 to orf278. Note the overlap of the stem and loop structures in Pf3 with the coding region of orf 301 . 51 Figure 6. Nucleotide sequence of the potential hairpin loops as depicted in fig. 5. Note the occurrence of direct repeats (indicated by arrows) within these inverted repeats. Within orf301 starting at position 4079 there is another inverted repeat of 50 nucleotides, which is partly composed of a nearly perfect (one mismatch) 20 bases direct repeat. The third non coding region comprises 113 bases between orf301 and orf278. Within this region, again, an inverted repeat is observed, in this case containing two tandem repeats of 8 and 9 bases, respectively. Finally, we have also noticed a nearly perfect inverted repeat extending from position 5237 through position 5283 within orf278. Pf3 seems to be quite efficient m the use of its 5833 nucleotides. Non- coding regions comprise only 5* of the genome (Ff: 8%, IKe: 11?) and constitute five junctions between genes or orfs: the three non-coding regions discussed in the preceding paragraph, totaling 292 bases, and two others of 10 bases each before p78 and p44, representing almost identical ribosome binding sites (Table 2). Four of the postulated genes have start codons that either overlap with the stopcodon of preceding genes (orfSB, orf430, orf71), or fall within the C-terminal coding region of the preceding gene (orf93). Comparison with the filamentous E. coli phages. The nearly identical Ff-phages (МіЗі fi, and fd) have been studied intensively over the past ten years, and recently the sequence has become available for IKe, an IncN specific filamentous E. coll phage. The Ff and IKe phages have an identical genetic organization and show an overall sequence 55 homology of 'JSÏ (16). The genomic sequence of Pf3 however, shows virtually no sequence homology with any of these filamentous E. coli phages. There is, however, similarity with respect to the overall pattern of large and small orfs following the major coat protein gene (рЧИ) in Pf3 as compared to the arrangement of the Ff an IKe genes following gene VIII (Figure Ό . In addition, similarities were detected between the secondary structure diagrams of one of the non-coding regions of Pf3 and the intergenic region of the Ff phages and IKe. Differences in the genetic organization can be observed in the regions immediately upstream and downstream from the genes coding for the ssDNAbinding proteins. In the Ff phages and IKe, the ssDNA-binding protein gene (gene V) and the major coat protein gene (gene VIII) are separated by two small genes (genes VII and IX), encoding minor coat proteins with lengths of 33 and 32 amino acids, respectively. In contrast, the Pf3 sequence has only one orf of 58 amino acids between these two structural protein genes. Gene V of Ff and IKe is preceded by two overlapping genes in the same reading frame, namely gene II ( Ή Ο codons) and gene X (the C-terminal 111 codons of gene II), whereas In Pf3 two separate reading frames, one of 278 codons and then one of 71 codons precede the ssDNA-binding protein gene. As discussed above, a resemblance can be seen between hairpin structures 2 through 5 in the intergenic region of Ff and IKe and the four closely spaced hairpins following orf^SO and overlapping orf301 in Pf3 (Figures 5 and 6). These hairpins in Ff are involved in transcription termination, DNA replication, and phage morphogenesis (4, It, 24, 31). There is as yet no evidence that any of these secondary structures is functionally important for the Pf3 genome. However, the clustering of such structures, and the observation that symmetric DNA sequences usually are involved in DNA-protein interactions, strongly suggest that this region of the Pf3 genome indeed contains such signals. The evolutionary relationship between Pf3 and the other well studied filamentous E. coli viruses pose interesting questions. The lack of sequence homology, but the similarity in overall genome organization, may indicate a divergent evolution from a common ancestor to very distantly related phages. However, we can not at present exclude the possibility of convergent evolution from independent ancestral viruses and/or Plasmids toward morphologically similar phages with a gene order that may be most efficient for the life cycle of this type of virus. 56 ACKNOWLEDGEMENTS We thank Diana Hill, Ger Austen, Carol J. Lusty, and Roy Smith for their assistance with various aspects of this study. Financial support for the work in New York was through Public Health Service grant AI090H9 (L.A.D.). LITERATURE CITED 1. Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H. Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12; Чч95-4503. 2. Deininger, P.L. 1983. Random subcloning of sonicated DNA: Application to shotgun DNA sequence analysis. Anal. Biochem. 129: 216-223. 3. Denhardt, D.T., D. Dressier, and D.S. Ray, (ed.). 1978. The singlestranded DNA phages. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 4. Dotto, G.P., V Enea, and N.D. Zinder. 1981. Functional analysis of bacteriophage fi intergenic region. Virology 114: 463-473. 5. Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of bacteriophage fi DNA. J. Virol. 44: 32-46. 6. Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The major coat protein gene of the filamentous Pseudomonas aeruginosa phage Pf3: Absence of an N-terminal leader signal sequence. Nucleic Acids Res. П_: 8073-8085. 7. Makowski, L., and D.L.D. Caspar. 1981. The symmetries of filamentous phage particles. J. Mol. Biol. 1_45: 611-617. 8. Maniatis, T., E.F. Fritsch, and J. Sambrook. 1982. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 9. Marvin, D.A., R.L. Wiseman, E.J. Wachtel. 1974. Filamentous bacterial viruses 11: Molecular architecture of the class II (Pfl, Xf) virion. '. Mol. Biol. 82: 121-138. 10. Marvin, D.A., W.J. Pigram, R.L. Wiseman, E.J. Wachtel. 1974. Filamentous bacterial viruses 12: Molecular architecture of the class I (fd, Ifl, IKe) virion. J. Mol. Biol. 88: 581-600. 57 11. Marzee, C.J., and L.A. Day. 1983. DNA and protein lattice-lattice interactions in the filamentous bacteriophages. Biophys. J. >j2_·. 171180. 12. Maxam, A.M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 7^: 560-564. 13. Messing, J., and J. Vieira. 1982. A new pair of Ml 3 vectors for selecting either DNA strand of double digest restriction fragments. Gene 1_9: 269-276. 14. Meyer, T.F., K. Geider, C. Kurz, and H. Schaller. 1979. Cleavage site of bacteriophage fd gene II-protein in the origin of viral strand replication. Nature (London) 278: 365-367. 15. Newman, J., L.A. Day, G.W. Dalack, and D. Eden. 1982. Hydrodynamic determination of molecular weight, dimensions, and structural parameters of Pf3 virus. Biochemistry 21_: 3352-3358. 16. Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings. 1985. Nucleotide sequence and genetic organization of the genome of the N-specific filamentous bacteriophage IKe. J. Mol. Biol. JJLlj 2 7-39. 17. Peterson, C , G.W. Dalack, L.A. Day, andW.T. Winter. 1982. Structure of the filamentous bacteriophage Pf3 by X-ray fiber diffraction. J. Mol. Biol. J_62: 877-881. 18. Putterman, D.G. 1983. The filamentous bacteriophage Pf3: an investigation of its genomic sequence. Dissertation, New York University, New York, NY. 19. Putterman, D.G., A. Casadevall, P.D. Boyle, H.-L. Yang, B. Frangione, and L.A. Day. 1984. Major coat protein and single-stranded DNA binding protein of filamentous virus Pf3. Proc. Natl. Acad. Sci. USA 8j_: 699703. 20. Putterman, D.G., T.J. Gryczan, D. Dubnau, and L.A. Day. 1983. Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa into the PBD214 vector of Bacillus subtilis. J. Virol. 47: 221-223. 21. Sanger, F., A.R. Coulson, B.G. Barrel, A.J.H. Smith, and B.A. Roe. 1980. Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 1_43: 161-178. 22. Schaller, H., A. Uhlmann, and К. Geider. 1976. A DNA fragment from the origin of single to double strand DNA replication of bacteriophage fd. Proc. Natl. Acad. Sci. 73: 49-53. 23- Shine, J., and L. Dalgarno. 1975. Determinant of cistron specificity in bacterial ribosomes. Nature (London) 254: 34-38. 24. Smits, Μ.Α., J. Jansen, R.N.H. Konings, J.G.G. Schoenmakers. 1984. Initiation and termination signals for transcription in bacteriophage M13. Nucleic Acids Res. 12: 4071-4081. 58 Staden, R. 1980. A new computer method for the storage and manipulation of DNA gel reading data. Nucleic Acids Res. Θ: 3673-3694. Staden, R., and A.D. McLachlan. 1982. Codon preference and its use in identifying protein coding regions in long DNA sequences. Nucleic Acids Res. 10: 141-156. Stanisich, V.A. 197Ч. The properties and host range of male-specific bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. θ^_: 3323^2. Stormo, G.D., T.D. Schneider, and L.M. Gold. 1983. Characterization of translational initiation sites in E. coll. Nucleic Acids Res. 10: 2971-2996. Stormo, G.D., T.D. Schneider, L.M. Gold, and A. Ehrenfeucht. 1983. Use of the "perceptron" algorithm to distinguish translational initiation sites in E. coli. Nucleic Acids Res. 10: 2997-3011. Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers. 198O. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome: Comparison with phage fd. Gene 1_1_: 129-148. Webster, R.E., and J. Lopez. 1984. In "Virus Structure and Assembly", S. Casiens, (ed.). Jones and Bartlett Publishers, Inc. Boston, Mass. CHAPTER 3 Spontaneous Deletion Mutants of Bacteriophage Pf3: Mapping of Signals Involved in Replication and Assembly. Ruud G.M. Luiten, Rik I.L. Eggen, John G.G. Schoenmakers, and Ruud N.H. Konings. DNA 6, 129-137 (1987) ABSTRACT Defective deletion mutants, !_·£. miniphages, spontaneously a r i s e during s e r i a l propagation of the filamentous bacteriophage Pf3. They contain a circular single-stranded (ss) DNA molecule, which i s up to 80Ï smaller than the wildtype ss genome. Analysis of the genomic s t r u c t u r e of three of these miniphages revealed that they consisted of sequences, t h a t in the wildtype genome are flanked by d i r e c t repeats, which are 5-8 nucleotides long; only one copy of these repeats was found again in the miniphage genome. One miniphage genome contained a tandemly duplicated sequence, and from i t s s t r u c t u r e i t could be concluded that the duplication had occurred after a primary deletion event. In the duplication process, also short direct repeats must have been involved. I t i s concluded that the deletion and duplication events have occurred via an i d e n t i c a l recombination process, probably via the "slipped mispai ring" mechanism. Because, in the presence of helper functions, the three miniphage genomes are replicated and assembled into ssDNA containing v i r u s - l i k e p a r t i c l e s , i t i s concluded that the assembly signal and the r e p l i c a t i o n origins for v i r a l and complementary strand synthesis are located within the region shared by a l l three miniphage genomes, _i.e. nucleotides 4092 through 4678 of the wildtype genome (Luiten, R.G.M., Putterman, D.G., Schoenmakers, J.G.G., Konlngs, R.N.H., and Day, L.A. 1985. J. Virol. 56, 268-276). INTRODUCTION The Pseudomonas aeruginosa specific bacteriophage Pf3 belongs to the c l a s s of filamentous viruses (Inoviridae) (27). These viruses contain a c i r c u l a r , covalently closed, single-stranded (ss) DNA genome encapsulated in a long slender protein coat consisting of about 3000 identical protein subunits and a few copies of other phage encoded p r o t e i n s . 63 Figure 1. Genetic organization of the Pf3 genome. СепеЧЧ and gene78 encode the major coat protein and the ssDNA-binding protein, respectively. The assignment of the other genes/orfs has been discussed previously (17). The length of the filament is virus specific and varies from 700 to 2000 nm (for a review see ref. 5). For adsorption and host cell penetration filamentous phages are dependent on specific, usually conjugative plasmid encoded, pili present at the surface of the host cell. After productive infection, progeny virions are continuously produced by viable and reproducing bacteria, carrying the phage genome in a double-stranded (ds) replicative form. The complete nucleotide sequence and part of the genetic organization of the Pf3 genome have been established (Fig. 1) (16, 17, 25). Despite the fact that the genetic organization of Pf3 is similar to that of the well known Fspecific (Ff: K e . M13, fd, fi) and N-specific (IKe) filamentous Escherichia coli phages, the lack of nucleotide sequence and amino acid sequence homologies forces one to conclude that Pf3 and Ff or IKe are not evolutionary related. Currently we are interested in identifying the cis and trans-acting elements involved in Pf3 DNA replication and virus assembly. For this purpose, we have analyzed the genomic structure of viable, spontaneous deletion mutants, or miniphages, of Pf3. For Ff phages, the structural analysis of spontaneous deletion mutants has been of great help for the localization of the signals involved in DNA replication and phage assembly. The genomes of these miniphages consist of only a minor part (about 25?) of the wt genome, which during propagation is assembled into an equally shortened filamentous particle. Without exception, 64 these miniphage genomes contain the large non codogenic or intergenic region (IR) located between genes IV and I I of the Ff genome (8, 11, 12). Within t h i s region a l l c i s - a c t i n g elements required for complementary and v i r a l strand synthesis (the (-) and ( + ) - o r i g i n , r e s p e c t i v e l y ) , and virus assembly are located (30). Replication and assembly of miniphages i s possible only, if t r a n s - a c t i n g protein functions are provided by a helper v i r u s . We have found t h a t , similar to the Ff phages, Pf3 miniphages accumulate after multiple passages of wt Pf3 phage at high m u l t i p l i c i t i e s of i n f e c t i o n . In t h i s paper the properties and genomic s t r u c t u r e s of three different Pf3 miniphages are described, and a mechanism for the origin and evolution of t h i s type of mutants i s proposed. The significance of the miniphage genomic s t r u c t u r e s for the position of the c i s - a c t i n g elements required for Pf3 DNA r e p l i c a t i o n and virus assembly, will be discussed. MATERIALS AND METHODS B a c t e r i a and phages: Pf3 virus and i t s host P. aeruginosa PA01[RP1], o r i g i n a l l y obtained from D.E. Bradley (St.Johns, New Foundland), were from our own stock. Bacteria were grown in 2xYT medium (20), containing 2 mM CaClj for e f f i c i e n t phage adsorption and propagation. Pf3 virus and miniphage were i s o l a t e d from the c u l t u r e supernatant as described ( 1 6 ) . Sucrose density gradient centrifugation: To purify miniphage, phage suspensions were loaded onto a linear sucrose gradient (5-20$), and centrifuged for 16 hr at 25 krpm (^C) SW28.II rotor. in a Beekman Fractions were collected from the bottom of the tube and monitored with the aid of a LKB Uvicord at 25^ nm. Peak fractions were pooled and recentrifuged under identical conditions in a SW28.I rotor. 65 DNA purification and analysis: ssDNA was isolated from purified virions or miniphages as described (16). dsDNA was isolated from infected cells according to procedures given previously (16, 17). Miniphage dsDNA was separated from wt Pf3 dsDNA by electrophoresis on 1? agarose gels followed by electro-elution of the miniphage DNA band from the ethidiumbromide stained gel (18). Restriction fragments were recovered by electro-elution after separation on 5% Polyacrylamide gels. Southern blotting was performed by standard methods (18). DNA sequences were determined by cloning of restriction fragments in the sequencing vector Ml3mp8 (19). using the dideoxy chain termination method as described (17). Enzymes and biochemicals: All enzymes were obtained from Bethesda Research Laboratories, New England Biolabs, or Boehringer Mannheim, and used as recommended by the supplier. The sources of all other biochemicals and reagents have been given previously (16). RESULTS Detection and cloning of miniphages During our studies on the structure and genetic organization of the genome of the filamentous P.aeruginosa phage Pf3t a dsDNA preparation from infected cells was obtained, in which, as analyzed by agarose gel electrophoresis, besides wt Pf3 dsDNA considerably smaller, circular, covaiently closed dsDNA molecules were present. These small dsDNA molecules were not found in DNA preparations isolated from uninfected P.aeruginosa cells. 66 Pf3 rf ^А^ ss ss'' rf Г 2 3 Д ^BN ss ss rf 5 6 7 ^Ç4 SS 8 ss rf ss 9 10 11 Figure 2. Agarose gel analysis of ssDNA, isolated from three different Pf3 miniphage stocks (A, B, and C), and of dsDNA isolated from cells infected with these stocks. Lane 1, wt Pf3 dsDNA isolated from Pf3 infected P. aeruginosa cells; lane 2, wt Pf3 ssDNA isolated from Pf3 virus particles; lanes 3, 6, and 9, ssDNA isolated from the plaque-purified Pf3 miniphage stocks A, B, and C, respectively; lanes 4, 7, and 10, dsDNA isolated from cells infected with Pf3 miniphage stocks A, B, and C, respectively; lanes 5, 8, and 11, ssDNA isolated from filamentous particles produced by the infected cells of lanes 4, 7, and 10, r e s p e c t i v e l y Historical tracing of the Pf3 phage stock, used for infection, revealed that it was obtained by serial passage of the wt virus at high multiplicity of infection, without intermediate plaque purification. Analysis of this stock by sucrose density gradient centrifugation, followed by the isolation of ssDNA from the pooled peak fractions, revealed that it already contained filamentous particles and ssDNA molecules, which were smaller in size than the wt Pf3 viruses and the wt Pf3 ss genome, respectively. On the basis of these observations we hypothesized that, similar to Ff (11, 12). during the infection cycle of Pf3, deletion mutants of the wt genome were generated. With the aid of helper functions delivered by the wt genome, these deletion mutants are replicated, and subsequently packaged into equally shortened filamentous particles: miniphages. To obtain evidence that this hypothesis was correct, and to acquire information about the structure of the genomes of these miniphages, we have studied the properties and genetic content of a number of the Pf3 deletion mutatin more detail. To this end several miniphages were cloned via plating of serial dilutions of the miniphage containing Pf3 stock on P.aeruginosa [RP1]. After incubation overnight, the bacteria of 24 randomly 67 в 1 2 3 Д Figure 3· P u r i f i c a t i o n of Pf3 miniphage A via centri fugati on through 5-20% sucrose density gradients. A. Absorption p r o f i l e s of the sucrose gradients as monitored at 254 nm. For each peak, the pooled f r a c t i o n s are i n d i c a t e d . I. P r o f i l e of the f i r s t centrifugation s t e p . I I . P r o f i l e obtained after r e c e n t r i f u g a t i o n of the slow sedimenting f r a c t i o n from I . I I I . Profile obtained after r e c e n t r i f u g a t i o n of the f a s t sedimenting f r a c t i o n from I . B. Gelelectrophoretic a n a l y s i s of the ssDNA i s o l a t e d from the pooled sucrose gradient f r a c t i o n s (Fig. ЗА). Lane 1, wildtype Pf3 ssDNA; lane 2, ssDNA i s o l a t e d from the Pf3 phage stock containing miniphage A; lane 3> ssDNA i s o l a t e d from pooled f r a c t i o n s of gradient 3A-II; lane 4, ssDNA i s o l a t e d from pooled f r a c t i o n s of gradient 3A-III. selected plaques (which in fact are zones of retarded b a c t e r i a l growth) were s e p a r a t e l y propagated in 10 ml of 2xYT medium. Analysis on agarose gels of the DNA molecules i s o l a t e d from t h e infected c e l l s and from secreted filamentous p a r t i c l e s revealed t h a t in t h r e e c u l t u r e s a mixed population of miniphage was present, while in t h r e e others a s i n g l e species of miniphage was found. The l a t t e r miniphages were plaque purified once more and the r e s u l t i n g miniphage stocks A, B, and С (see Fig. 2) have subsequently been used for the i s o l a t i o n , on a preparative s c a l e , of miniphage s p e c i f i c ss and ds DNA. 68 Purification of miniphage particles To study the properties of the miniphage particles, the phage stocks were analyzed with respect to particle size, infectivity, and DNA content. Separation of wt and miniphage particles was performed with the aid of sucrose density gradient centrifugation (Fig. ЗА) (8). Subsequently the number of plaque forming units (pfu), present in the original phage stock and in the peak fractions was established. The results indicated that more than 99% of the recovered pfu was associated with the fast sedimenting fraction. Inspection of the ssDNA content of the particles present in each peak fraction revealed the exclusive presence of wt Pf3 ssDNA in the fast sedimenting particles, whereas only miniphage ssDNA could be detected in the slow sedimenting particles (Fig. 3B). The particles of both fractions were indistinguishable from each other or from wt Pf3, with respect to the UV absorption profile and protein composition (16, 25, data not shown). Thus, although significantly smaller, miniphage particles apparently are morphologically and structurally similar to wt Pf3 virions. Structure of miniphage genomes Mapping and sequencing strategy Initial analysis of the miniphage genomes was performed by comparison of restriction fragment patterns of purified miniphage and wt Pf3 dsDNA (cf. Fig. 4). Generally with the exception of only one fragment, all miniphage DNA fragments comigrated with a subset of wt Pf3 fragments. Hybridization of 3 P-labeled miniphage DNA to wt Pf3 restriction fragments, bound to nitrocellulose, revealed first, that the fragments with the same electrophoretic mobility were identical, and second that miniphage DNA was derived from a contiguous region of the wt Pf3 genome. In all cases these techniques enabled us to establish unambiguously from which region of the wt Pf3 genome the miniphage DNAs were derived (see below). To establish the exact extent of the deletion in the wt Pf3 genome, miniphage DNA fragments, which did not comigrate with any of the wt Pf3 DNA fragments, were isolated, cloned in Ml3mp8 and subsequently sequenced. The rationale behind this approach was that this fragment was presumed to have been generated by fusion of the borders of the deletion, thereby creating a unique fusion or 69 1 2 3 Д 5 6 7 8 Figure 1. Restriction enzyme digestion patterns of the dsDNA of wt Pf3 (lanes 1, 4, 7), and of rainiphages A (lanes 2, 3), В (lane 8), and С (lanes 5, 6) digested with Hpall (lanes 1 , 2 ) , Sau3A (lanes 3, 4, 5), and Haelll (lanes 6, 7, 8), respectively. Miniphage DNA fragments that are not identical to wildtype Pf3 DNA fragments (see text) are indicated with asterisks. "circularization" sequence. Following this strategy, the genomic structure of the three different miniphages could be established. The genome of miniphage A As deduced from different restriction enzyme digestions, the genomic structure of miniphage A appeared to be fairly simple: most digests contained a only one fragment, which did not comigrate with a wt Pf3 DNA fragment. One enzyme, i.e. Hpall, produced only fragments that comigrated with and hybridized to the same subset of wt Pf3 fragments (Fig. 4), indicating that both the begin- and endpoint of the deletion was located within or very close to a Hpall recognition site. Sequence determination of the single non-comigrating Sau3A fragment (Fig. 4) revealed that the fusion point was formed by the sequence TCCGG. Interestingly, this sequence was found to be present in the wt Pf3 genome as a direct repeat on both sides of the DNA sequence (nucleotides 3^84 to 4673, 1-е. 1190 bp) preserved in miniphage A DNA. In the genome of miniphage A, one copy of this repeat sequence linked nucleotides 3484 and 4673 of the wt Pf3 genome (Fig. 5, Table 1). In addition the direct repeat included the recognition sequence for Hpall, thus explaining the results of the initial mapping experiments. 70 Figure 5. Schematic presentation of the origin of the genomes of miniphage A, B, and C. The regions of the wt Pf3 genome from which the respective miniphage DNAs are derived, are indicated. Numbers refer to the nucleotides in the wt genome that are fused. —I The genome of miniphage В Miniphage В DNA also proved to be a simple deletion mutant of Pf3: the major part consisted of nucleotide sequences found to be present in the genome of miniphage A. Cloning and sequencing of the single non-comi grating НаеІІІ fragment (Fig. H) revealed that in the genome of miniphage B, the oligonucleotide GGGTTCCG linked nucleotides 3^83 and 4780 (i_.e. 1297 bp) of the wt Pf3 genome. Again the sequence, preserved in the genome of miniphage B, is flanked in the wt Pf3 genome by a direct repeat of the circularization sequence (Fig. 5, Table 1). The genene of miniphage С The genomic structure of the third miniphage turned out to be more complex than that of the miniphages A and B. Southern blot analysis indicated that this DNA consisted of nucleotide sequences, which in the wt Pf3 genome were located between nucleotides 4000 and 5000. The electrophoretic mobility of miniphage С DNA on 1Í agarose gels (Fig. 2) as well as the sum of the lengths of the restriction fragments (Fig. 4) indicated however, that the genome of miniphage С was about 500 bp larger. Furthermore, the restriction endonuclease Bgll, which has only two recognition sites in wt Pf3 DNA, cleaved miniphage С dsDNA into three fragments. These rather peculiar results might be explained in two different ways: either the genome of miniphage С consists for a part of sequences which are not Pf3-specific, or it consists of Pf3 sequences, that are partially present in a multimeric form. To distinguish between these alternatives, the genome of miniphage С was sequenced in its entirety via cloning all Haelll and Sau3A fragments (Fig. 4) in Ml3mp8 (19). The data obtained, unambiguously proved that the genome of miniphage С consisted exclusively of Pf3 specific sequences, and that part of these sequences was present in a tandemly duplicated form. The "core" sequence was shown to be derived from positions 4099 to 5010 of the wt Pf3 genome, which is in accordance with the results of the hybridization experiments. The tandemly duplicated part was 586 bp long, and encompassed positions 4092-4412 and 4746-5010 of the wt Pf3 genome (Fig. 5). Similar to the genomes of the miniphages A and B, the "core" sequence of miniphage С DNA, was flanked in the wt Pf3 genome by a 7 bases direct repeat sequence TGGCAGA. Only one copy of this repeat was found again in the genome of miniphage C, linking nucleotides 4099 and 5010 (Fig. 5, Table 1). Interestingly, the circularization sequence and its flanking regions were 72 found in the DNA segment of the miniphage С genome, that is tandemly duplicated. This observation unambiguously proved that the duplication event must have occurred after formation of the primary fusion between nucleotides 4099 and 5010, leading, as depicted in Fig. 5, to the precursor molecule "pre-MiniC". Inspection of the nucleotide sequence of the pre-MiniC molecule revealed that also the region to be duplicated (nucleotide 47^6 to nucleotide 4406, including the primary fusion between nucleotides 5010 and 4099) was flanked on both sides by a direct repeat of the sequence CTTGAT; only one copy of this sequence was found to be present at the fusion sequence located between the duplicated segments (Fig. 5, Table 1). Table 1. Repetitive sequences in the wildtype genome that border the DNA regions, preserved in the genomes of the miniphages A, B, and С (pre-mini-C). MiniA МІПІВ 3484 4673 I I TCCGG == 1190 bp == TCCGG 3483 4780 I I GGGTTCCG == 1297 bp -= GGGTTCCG 4099 pre-Mini-C MiniC 5010 I I TGGCAGA == 912 bp =- TGGCAGA 4746 5010 4099 4406 I I I I CTTGAT = 272 bp = TGGCAGA = 307 bp = CTTGAT Also included is the sequence that in pre-mini-C borders the DNA region, found to be duplicated in the miniphage С genome. 73 DISCUSSION Because of the lack of nucleotide sequence homology between the genomes of Pf3 and the E.coli specific filamentous bacteriophages Ff and IKe (3, 13, 17, 22, 29) and the unknown requirements of the Pf3 specific DNA replication system, an identification of the cis-acting DNA elements involved in Pf3 DNA replication and phage assembly was a priori not possible. For this reason, other routes needed to be employed to map these functional elements. In this paper the properties and genomic structures of three spontaneous deletion mutants (miniphages) of Pf3 are described. The data indicate that these miniphages are functionally comparable to the Ff miniphages previously described (8, 11, 12). Furthermore, the molecular structure of Pf3 miniphages answers several fundamental questions with respect to the mechanism by which the deletions are generated, and adds new information about sequence duplications that might follow a primary deletion event. In addition the structural data allow a localization of the Pf3 specific cis-acting elements involved in the processes of viral and complementary strand synthesis, and phage assembly. Location of signals involved in Pf3 DNA replication and virus assembly. Within the genomes of the single-stranded DNA bacteriophages two replication origins are located: one origin, the complementary or (-)-strand origin, is required for efficient conversion of ssDNA into dsDNA, while the other, the viral or (+)-strand origin, is essential for initiation of viral strand replication via a rolling circle mechanism (2, 30). The properties of the three different Pf3 miniphages, together with the DNA sequence data of their genomes, unequivocally indicate that both the (-)strand origin and the (+)-strand origin of Pf3 are present on the miniphage genomes. Furthermore, the observation that miniphage ssDNA is efficiently packaged into virus-like filamentous particles indicates that the miniphage genome harbors the DNA sequences required for phage morphogenesis. The functional significance of such a signal for the assembly of the Ff phages and IKe has been well documented (6, 24). 74 В Figure 6. A. Region of the wildtype Pf3 genome, that is shared by all three miniphage DNAs. B. Sequences within the "common region" that have the potential to form stable stem-loop structures (see text). The fact that the above mentioned DNA elements must be present on all three Pf3 miniphage genomes delimits their location within the sequence shared by all miniphage DNAs, i.e. between position 4092 and position 4678 of the wt Pf3 genome (Fig. 6). This sequence includes a non-coding region of the wt Pf3 genome, but does not contain the sequences previously suggested to be involved in these processes (17). Аз depicted in Fig. 6, within this region several sequences of dyad symmetry (palindromes) are present. As is known for the Ff phages, IKe, and other systems (21, 24, 30), DNA-protein interactions often are mediated by palindromic sequences on the target DNA. We therefore suggest that at least some of the palindromes, indicated in Fig. 6, are involved in Pf3 DNA replication and virus assembly. A more detailed analysis of this DNA region with the aid of in vitro deletion mapping techniques, is in progress. Origin and evolution of the miniphage genomes Similar to the Ff phages, Pf3 miniphages arise by spontaneous deletion of a large part of the wt genome. The factors that determine the specificity of these recombination processes are, however, still unclear (9, 14, 26). 75 The genomes of all three miniphages studied, are flanked in the wt Pf3 genome by identical oligonucleotide sequences, varying in length from 5-8 basepairs; only one copy of this repeat sequence was found again at the circularization site that fuses the endpoints of the deletion. Thus without exception, these sequences must have played a fundamental role in the recombination processes, finally resulting in deletions and duplications, for instance by mediating a homologous recombination event. The genomes of miniphage A and В are the result of a "simple" deletion of 80Í and 75% of wt Pf3 DNA, respectively (Fig. 5). Because the genome of miniphage A is completely contained within that of miniphage B, the generation of miniphage A can also be envisioned as a two-step process: i_.e. first a deletion event that results in the genome of miniphage B, followed by a second deletion of another 150 bp. Evidence that a primary deletion mutant can undergo additional modifications, and even can evolve into more complex molecules, is apparent from the structure of the genome of miniphage С of a tandemly duplicated sequence of 586 bp. Part of this genome consists From the fact that the duplicated sequence contains the fusion point between nucleotides 4092 and 5010 of the wt Pf3 genome, it is evident that this sequence arrangement must have been present before the duplication event could occur (Fig. 5). Inspection of the nucleotide sequence of pre-MiniC with respect to the region "to be duplicated" shows that the borders of this region are flanked by a direct repeat of the oligonucleotide CTTGAT. Only one copy of this repeat is present at the fusion point of the tandemly reiterated segments. For the E.coli filamentous phages it is as yet unclear whether short direct repeats are involved in the generation of deletion mutants. Only one 1 circularization sequence of a Ff (f1) miniphage genome has been reported (I )); in the wt genome this sequence, however, does not flank the miniphage DNA region on both sides. In fact, no homology at all can be detected between the DNA regions fused in the deletion process. On the other hand, it is well documented that short repetitive sequences have played an important role in the generation of extensive deletions in the lac operon and other systems (1, 15). In analogy to the significantly larger deletions in the Pf3 genome, these deletions probably occurred by recombination between these directly repeated sequences. In this context it is of interest to note the resemblance of the deletion process with the excision 76 of transposable elements (4, 28). With respect to duplications and multiplications, Edlund and Normark (7) observed extensive (up to 10 kb) tandem duplications of a DNA segment encompassing the E.coll ampC gene, which apparently were caused by recombination of direct repeats of 12-13 bp that flanked this DNA region. With respect to duplications, an identical observation is made in the genomes of at least some Ff (fi) miniphage DNAs. (14, 26). Ravetch et al. (26) have proposed two mechanisms to explain the generation of tandem duplications in Ff miniphage genomes. Without significant alterations, these mechanisms can be adapted to explain the observed duplication in Pf3 miniphage С DNA. A mere straightforward mechanism takes into account the involvement of short direct repeats in both the deletion and the duplication process. Thus the deletion could be the result of an intramolecular homologous recombination event. In addition, when acting upon a completely duplicated pre-mini-C molecule, the same mechanism could be responsible for the deletion of part of one reiterated sequence, resulting in the genome of miniphage C. An even simpler mechanism for the generation of deletions and duplications is the "slipped mispairing" mechanism (1, 10). This mechanism assumes that during replication of one copy of a short direct repeat, the newly synthesized sequence pairs with another repeat on the template strand. The relative position of the second direct repeat determines whether a deletion or a duplication will occur. Thus, in case the newly synthesized repeat sequence slips forward with respect to the direction of DNA synthesis, the region located between the repeats will be deleted. On the other hand, if slipped mispairing occurs towards a sequence which already has been replicated, the region between the repeats will again act as a template for replication, thus resulting in a (tandem) duplication of the DNA region located between the short repetitive sequences. It should be noted that for Pf3, and for the filamentous phages in general, this process of slipped mispairing can occur during dsDNA replication, as well as during complementary strand synthesis. In the latter case slipped mispairing even might be facilitated by the single-stranded nature of the template molecule, thus eliminating the dependence of the recombination process on a recA type protein. In this context it is interesting to note that recA-independent evolution of Ff (fi) mimphages already has been reported by Honuchi ( H ) . 77 LITERATURE CITED Albertini, A.M., M. Hofer, M.P. Calos, and J.H. Miller. 1982. On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions. Cell 2£: 319-328. Baas, P.D. 1985. DNA replication of single-stranded Escherichia coli DNA phages. Biochim. Blophys. Acta 825: 111-139. Beck, E., R. Sommer, E.A. Auerswald, C. Kurz, В. Zink, G. Osterburg, H. Schaller, К. Sugimoto, H. Sugisaki, T. Okamoto, and M. Takanami. 1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 12: ІЙ95-И503. Calos, M.P., and J.H. Miller. 1980. Transposable elements. 579-595. Cell 20: Denhardt, D.T., D. Dressier, and D.S. Ray, ed. 1978. The singlestranded DNA Phages. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Dotto, G.P., and N.D. Zinder. 1983. The morphogenetic signal of bacteriophage f1. Virology IJCb 252-256. Edlund, T., and S. Normark. 1981. Recombination between short DNA homologies causes tandem duplication. Nature (London) 292: 269-271. Enea, V., and N.D. Zinder. 1975. A deletion mutant of bacteriophage fi containing no intact cistrons. Virology 68: 105-114. Enea, V., K. Horiuchi, B.C. Turgeon, and N.D. Zinder. 1977. Physical map of defective interfering particles of bacteriophage f1. J. Mol. Biol. 1_n_: 395-414. Farabaugh, P.J., U. Schmeissner, M. Hofer, and J.H. Miller. 1978. Genetic studies of the lac repressor. VII. On the molecular nature of spontaneous hotspots in the lad gene of Escherichia coli. J. Mol. Biol. 1_26: 847-857. Griffith, J., and A. Kornberg. 1974. Mini M13 bacteriophages: Circular fragments of Ml 3 DNA are replicated and packaged during normal infections. Virology 59: 139-152. Hewitt, J.A. 1975. Miniphage, a class of satellite phage to M13. Gen. Virol. 26: 87-94. J. Hill, D.F., and G.B. Petersen. 1982. Nucleotide sequence of bacteriophage fi DNA. J. Virol. 4£: 32-46. Horiuchi, K. 1983. Co-evolution of a filamentous bacteriophage and its defective interfering particles. J. Mol. Biol. 169: 389-407. 15. Jones, I.M., S.B. Primrose, and S.D. Ehrlich. 1982. Recombination between short direct repeats in a recA host. Mol. Gen. Genet. 188: 486-489. 16. Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 19Θ3. The major coat protein gene of the filamentous Pseudomonas aeruginosa phage Pf3: Absence of an N-terminal leader signal sequence. Nucleic Acids : Res. Γ|_ 8073-8085. 17. Luiten R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings, and L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1 Plasmid specific filamentous phage of Pseudomonas aeruginosa. J. Virol. 56: 268-276. 18. Maniatis, T., E.F. Fritsch, and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 19. Messing, J., and J. Vieira. 1982. A new pair of Ml 3 vectors for selecting either DNA strand of double digest restriction fragments. Gene ]9_·. 269-276. 20. Miller, J.H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 21. Miller J.H., and W.S. Reznikoff, ed. 1978. The Operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 22. Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings. 1985. Nucleotide sequence and genetic organization of the genome of the N-specific filamentous bacteriophage IKe. J. Mol. Biol. 1_81_: 27-39. 23. Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H. Konings. 1986. The genell proteins of the filamentous phages IKe and Ff (M13, fd, and fi) are not functionally interchangeable during viral strand replication. Nucleic Acids Res. 1j4: 5067-5080. 24. Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H. Konings. 1987. Functional comparison of the DNA sequences involved in the replication and packaging of the viral strands of the filamentous phages IKe and Ff (M13, f1, and fd). DNA 6: 139-147. 25. Putterman, D.G., A. Casadevall, P.D. Boyle, H.-L. Yang, B. Frangione, and L.A. Day. 1984. Major coat protein and single-stranded DNA binding protein of filamentous virus Pf3. Proc. Natl. Acad. Sci. USA 8j_: 699703. 26. Ravetch, J.V., K. Horiuchi, and N.D. Zinder. 1979. DNA sequence analysis of the defective interfering particles of bacteriophage f1. J. Mol. Biol. 2^8: 305-318. 27. Stanisich, V.A. 1974. The properties and host range of male-specific bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 8£: 332342. 79 Starlinger, P. 1980. IS elements and transposons. Plasmid 3: 211-259. Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers. 1980. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome: Comparison with phage fd. Gene 1_1_: 129-148. Zinder, N.D., and К. Horiuchi. 1985. Multiregulatory element of filamentous bacteriophages. Microbiol. Rev. 49: 101-106. CHAPTER 4 In Vitro Deletion Mapping of the Viral Strand Replication Origin of the Pseudomonaâ Bacteriophage Pf3. Ruud G.M. Luiten, Marja C.P. Timmermans, John G.G. Schoenmakers, and Ruud N.H. Konings ABSTRACT The origin of viral strand replication of the filamentous bacteriophage Pf3 has been characterized in Escherichia coli by in vitro deletion mapping techniques. The origin region was functionally identified by its ability to convey replicative properties to a recombinant plasmid in a poiA host where Plasmid specified replication was not possible. The origin of Pf3 viral strand replication is contained within a region of 139 basepairs. This DNA sequence covers almost completely one of the intergenic regions, and specifies replication initiation as well as replication termination functions. Although no nucleotide sequence homology is present between the Pf3 origin of viral strand replication and that of the Escherichia coli filamentous phages Ff (M13, f1, and fd) and IKe, their map positions and functional properties are however very similar. INTRODUCTION Pf3 is a member of the filamentous bacteriophages that contain a circular single stranded (ss) DNA genome (Inovlrldae). Its natural host is Pseudomonas aeruginosa harboring the broad host range plasmid RP1 (30). The plasmid encodes specific pili that are required for phage adsorption and penetration. After infection the viral genome is replicated under the instruction of both phage and host encoded proteins (10). Similar to the filamentous viruses that are specific for other bacterial genera, progeny phage is continuously extruded through the cell membrane without lysis or killing of the host cell. Although the filamentous viruses studied thus far strongly resemble each other with respect to their morphology, overall macromolecular composition and life cycle, sequence analyses have however indicated that the nucleotide sequences of their genomes can be completely different. For Pf3 we have found that its genome is not homologous at all to that of the well studied filamentous E.coli phages Ff (M13, fd, f1) or IKe (4, 14, 20, 21, 26, 32). Consequently the genetic organization of the Pf3 genome could not simply be 83 Figure 1. The structure of the Pf3 miniphage A genome and its relation to the wt Pf3 genome. The arrow delineates the region present in all miniphage genomes studied (20). deduced from a comparison of the nucleotide sequences, and thus other strategies needed to be followed in order to localize specific genetic properties of the Pf3 genome. In a previous paper we already have reported a preliminary identification of the DNA region in which the origins of replication (i.e. the viral strand and the complementary strand origin) and the morphogenetic signal of the Pf3 genome are located (19). This region was found to extend from nucleotide position 4092 to 4670 of the wt Pf3 genome (Fig. 1). The studies presented in this paper are focussed on a further characterization the origin of Pf3 viral strand replication. By making use of in vitro deletion mapping techniques, we demonstrate that the region containing the functional viral strand origin is contained within a DNA sequence of 139 basepairs. 84 MATERIALS and METHODS B a c t e r i a , b a c t e r i o p h a g e s , and B a c t e r i o p h a g e Pf3 and i t s Plasmids. h o s t Pseudomonas a e r u g i n o s a 0 [RP1] (30) were from our own s t o c k . The genome of miniphage A i s a s p o n t a n e o u s d e l e t i o n mutant of t h e c i r c u l a r genome, and c o n s i s t s of n u c l e o t i d e s З^в^ t o 4673 of t h e wt Pf3 genome For p r o p a g a t i o n of recombinant pUC9 P l a s m i d s q lacI ZAM15, a r a , A l a c p r o , s t r A , t h i ) (24) E s c h e r i c h i a c o l i JM83 (Ф80 (23) was used as a h o s t . recombinant P l a s m i d s on t h e p r e s e n c e of a f u n c t i o n a l of r e p l i c a t i o n , Pf3 (19). To t e s t Pf3 v i r a l strand origin use was made of E . c o l i N4156 (polA, end, t h y , gyrA) ( 1 3 ) . This s t r a i n does not produce a f u n c t i o n a l DNA p o l y m e r a s e I and t h e r e f o r e i s unable t o s u s t a i n v e c t o r plasmid r e p l i c a t i o n v i a t h e ColEI r e p l i c a t i o n o r i g i n (31)· C o n s t r u c t i o n of Plasmids pMinil through pMini9. The p r o c e d u r e s f o r t h e i s o l a t i o n of plasmid DNA and f o r t h e c o n s t r u c t i o n of recombinant Plasmids were e s s e n t i a l l y as d e s c r i b e d by M a n i a t i s e t a l . (22). Plasmid pMinil was c o n s t r u c t e d v i a i n s e r t i o n of EcoRI c l e a v e d miniphage A replicative form (RF) i n t o t h e unique EcoRI s i t e of plasmid pUC9. pMini2 was o b t a i n e d by r e l i g a t i n g the largest Aval fragment Plasmid of pMinil and t r a n s f o r m a t i o n t o JM83. S t a r t i n g with plasmid pMini2, Plasmids рМіпіЗ t h r o u g h pMini9 were v i a p r o g r e s s i v e d e l e t i o n s of t h e Pf3 i n s e r t . w i t h EcoRI and s u b s e q u e n t l y intervals To t h i s end pMini2 was i n c u b a t e d with e x o n u c l e a s e samples were t a k e n and t h e DNA was p u r i f i e d ethanol p r e c i p i t a t i o n . Subsequently constructed ВаІЗІ. linearized At r e g u l a r time by phenol e x t r a c t i o n and each sample was t r e a t e d w i t h T4 DNA l i g a s e and t r a n s f o r m e d t o E . c o l i JM83. D e l e t i o n s from t h e o t h e r s i d e of t h e Pf3 i n s e r t were c r e a t e d after l i n e a r i z a t i o n w i t h BamHI, u s i n g t h e same p r o c e d u r e . The n u c l e o t i d e sequence of t h e Pf3 i n s e r t s was d e t e r m i n e d by t h e dideoxy t e r m i n a t i o n t e c h n i q u e as a d a p t e d for DNA by Chen and Seeburg t h e sequence a n a l y s i s ( 7 ) . For t h i s purpose t h e u n i v e r s a l s e q u e n c i n g p r i m e r s , and a Pf3 s p e c i f i c double-stranded and synthetic oligonucleotide sequence 5 '-GGGCAGCGTACCG-3', h y b r i d i z i n g 4427 t o 4439 were of chain reverse of t o Pf3 DNA a t n u c l e o t i d e the position used. 85 Transformation. E.coll N4156 was made competent and transformed according to standard procedures (22). Q For (co)transformation experiments, 1x10 competent E.coli N4156 c e l l s were incubated in the presence of 0.1 vg plasmid DNA and, if appropriate, 0.1 ug Pf3 RF. Enzymes and Biochemicals R e s t r i c t i o n enzymes were obtained from Boehringer Mannheim. Tk DNA l i g a s e and exonuclease Bal31 were from Bethesda Research Laboratories. All enzymes were used as recommended by the s u p p l i e r . Ampicillin (Sigma) was used at a concentration of 100 μg/ml. RESULTS The r e p l i c a t i o n of t h e ssDNA genome of filamentous b a c t e r i a l viruses requires the presence of two different r e p l i c a t i o n o r i g i n s . One, the complementary strand o r i g i n , i s required for the conversion of the i n f e c t i n g v i r a l DNA into a double stranded r e p l i c a t i v e form (RF), while the o t h e r , the v i r a l strand o r i g i n , is e s s e n t i a l for asymmetric r e p l i c a t i o n of the v i r a l strand according t o a r o l l i n g c i r c l e mechanism ( 1 , 34). To i n i t i a t e r e p l i c a t i o n at the complementary strand o r i g i n only host encoded functions are r e q u i r e d , whereas for the I n i t i a t i o n of v i r a l strand r e p l i c a t i o n one phage encoded prot ein i s needed. This protein i s a s i t e - s p e c i f i c topoisomerase which, by introducing a nick in the v i r a l strand o r i g i n , c r e a t e s a free end for t h e i n i t i a t i o n of v i r a l strand synthesis 3'-0H ( 1 , 34). The a n a l y s i s of spontaneous deletion mutants (miniphages) has allowed a preliminary mapping of the r e p l i c a t i o n o r i g i n s of the Pf3 genome (19). A further d e l i n e a t i o n of the o r i g i n of r e p l i c a t i o n by in v i t r o deletion mapping r e q u i r e s molecular cloning techniques which a r e , for lack of efficient transformation procedures and s u i t a b l e b a c t e r i a l mutants, not yet possible using Pseudomonas. We t h e r e f o r e sought E.coli as a host. Productive i n f e c t i o n of E.coli by Pf3 has been reported, however the efficiency 86 of t h i s i n f e c t i o n E 110721 Figure 2 . Construction of plasmids pMinil and pMini2. Numbers refer to nucleotide positions of the wt Pf3 genome. Symbols used are as follows: bla: ß-lactamase gene, o r i : ColEI origin of r e p l i c a t i o n , aLacZ: LacZ gene fragment encoding the α-peptide of ß-galactosidase. Restriction enzyme recognition s i t e s are indicated as follows: A, Aval, B, BamHI, E, EcoRI, H, H i n d l l l , Hp, H p a l l , N, Nari, Ρ, P s t I , S, S a l i . i s low, as i l l u s t r a t e d by the fact t h a t after p l a t i n g no individual plaques can be observed (5, unpublished r e s u l t s ) . A different functional assay for Pf3 r e p l i c a t i o n was thus developed : the genome of one Pf3 miniphage (miniphage A) was cloned i n t o a ColEI derived vector plasmid (pUC9) with a s e l e c t a b l e marker (ampicillin r e s i s t a n c e ) and the recombinant DNA molecule pMinil (Fig. 2) was subsequently introduced i n t o a polA E.coli s t r a i n . Since the ColEI plasmid origin of r e p l i c a t i o n i s not a c t i v e in a polA host (8, 31), r e p l i c a t i o n of the recombinant plasmid, and thus the establishment of b a c t e r i a l colonies under s e l e c t i v e pressure, should be dependent upon a functional Pf3 origin of replication. The v a l i d i t y of t h i s system was tested with plasmid pMinil, which contained a l l Pf3 s p e c i f i c r e p l i c a t i o n functions of the parent miniphage A genome (19). Transformation of E.coli N4156 (polA) with pUC9, Pf3 RF, or pMinil separately never r e s u l t e d in the appearance of ampicillin r e s i s t a n t colonies, nor did cotransformation of pUC9 and Pf3 RF. On the other hand, cotransformation of plasmid pMinil and Pf3 RF oroduced a large number of ampicillin r e s i s t a n t colonies (Table 1). By c u l t u r i n g these amp plasmid pMinil could be recovered unmodified, though in r e l a t i v e l y amounts (see also Fig. *i). cells small These r e s u l t s indicated t h a t r e p l i c a t i o n of 87 Figure 3- Construction of Plasmids pMiniS and pMini9. explained in the legend t o Fig. 2. Symbols used are as Plasmid pMinil in a pol A host requires helper functions encoded by wt Pf3 DNA and therefore i s l i k e l y to be i n i t i a t e d at the Pf3 origin present in the insert. To map the Pf3 r e p l i c a t i o n origin more accurately the s i z e of the Pf3 DNA i n s e r t in pMinil was systematically reduced by r e s t r i c t i o n enzyme digestion and ВаІЗІ d e l e t i o n . The r e s u l t i n g constructs were subsequently tested with the cotransformation procedure. By digestion of pMinil with Aval, followed by l i g a t i o n of the l a r g e s t fragment Plasmid pMini2 was obtained (Fig. 3). Simultaneous introduction of pMini2, which only contained nucleotides 4072 through 451*6 of the wt Pf3 genome, with Pf3 RF in E.coll N4156 e f f i c i e n t l y yielded ampicillin r e s i s t a n t colonies, i n d i c a t i n g t h a t no sequences e s s e n t i a l for Pf3 s p e c i f i c r e p l i c a t i o n had been deleted (Table 1). This observation was a n t i c i p a t e d because previous comparison of the nucleotide sequences of several independently i s o l a t e d miniphage genomes had already indicated t h a t most of the sequences deleted in the above experiment, were not required for miniphage DNA r e p l i c a t i o n (19). To determine the l e f t most l i m i t of the Pf3 o r i g i n of r e p l i c a t i o n , the i n s e r t of plasmid pMini2 was progressively deleted from the l e f t by Bal31 digestion (see Materials and Methods). Deletions to approximately position 4310 (in pMini5, Fig. 4) of the wt Pf3 genome had no effect on the yield of ampicillin r e s i s t a n t c o l o n i e s , whereas larger deletions (upto position 4350 in рМіпіб) significantly (Table 1). reduced the transformation efficiency of E.coli poi A c e l l s The r i g h t hand boundary of the o r i g i n was delineated by systematically d e l e t i n g the i n s e r t of pMini5 from the BamHI s i t e , again by ВаІЗІ digestion. 88 Testing several of the r e s u l t i n g Plasmids in the Figure Ч. Ethidiumbromide stained gel (A) and Southern blot analysis using ^ 2 P-labeled Pf3 RF DNA as a probe, of Pf3 RF DNA (lane 1) and several pMini Plasmids as present in E.coli s t r a i n JM83 (lanes 2, Ц, and 6) and in E.coli N4156 c e l l s cotransformed with Pf3 RF (lanes 3, 5, and 7 ) . Lanes 2 and 3, pMini2; lanes 4 and 5, pMini5; lanes 6 and 7, pMini9. cotransformati on assay indicated t h a t deletions ranging from position 4541 t o position 4450 (pMini9, Fig. 4) had no effect on the production of ampicillin r e s i s t a n t E.coli N4156 colonies (Table 1 ) . Nucleotide sequence analysis of the Pf3 i n s e r t of plasmid pMini9, revealed that exactly 139 basepairs (position 4312 t o 4450) of the wt Pf3 genome were s t i l l present. These r e s u l t s , together with the deletion mapping experiments and cotransformation procedure presented in Table 1, c l e a r l y indicated t h a t both the presence of a Pf3 r e p l i c a t i o n o r i g i n on the recombinant plasmid and Pf3 encoded functions are e s s e n t i a l for r e p l i c a t i o n of the plasmid in E.coli polA cells. Having established which region of the Pf3 genome contains the o r i g i n of r e p l i c a t i o n , we now devised ways to analyze the functional p r o p e r t i e s of t h i s origin on the Pf3 DNA i n s e r t i n terms of i n i t i a t i o n and termination of replication. For the Ff phages and IKe i t has been shown t h a t the origin of v i r a l strand r e p l i c a t i o n functions not only in the i n i t i a t i o n of ( u n i d i r e c t i o n a l ) r o l l i n g c i r c l e r e p l i c a t i o n but also i s involved in the termination r e a c t i o n (11, 12, 28). As a consequence of t h i s combination of functions a c i r c u l a r DNA molecule containing two a c t i v e functional o r i g i n s i n 89 Figure 5. Construction of plasmids рМіпіі and pMinilS.T. These plasmids were constructed by i n s e r t i o n of one (pMinilS) or two (рМіпіі .Т) copies of the 267 bp Narl/Hpall of from pMini9, in the unique Acci s i t e of pUCIÖ. Symbols are as in the legend t o Fig. 2. an i d e n t i c a l o r i e n t a t i o n will be unstable, because r e p l i c a t i o n i n i t i a t e d at one o r i g i n will terminate at the second origin and vice versa (12, 17). Replication of such a plasmid through a c t i v a t i o n of the phage derived o r i g i n by the homologous phage encoded r e p l i c a t o r protein will thus resolve t h i s molecule i n t o two molecules each containing only one complete o r i g i n . This phenomenon was used to assay for the i n i t i a t i o n and termination functions of the Pf3 o r i g i n of r e p l i c a t i o n as present on pMini9. A 267 bp fragment of pMini9 which included the complete 139 bp Pf3 i n s e r t was recloned in pUCI 8 such that recombinants containing e i t h e r a s i n g l e i n s e r t (pMinilS) or two tandemly arranged copies of the fragment (pMinilS.T) were obtained (see Fig. 5 ) . The plasmid with the tandem duplication was perfectly s t a b l e as long as r e p l i c a t i o n of the plasmid occurred from the ColEI r e p l i c a t i o n origin of t h e pUC vector. When pMinilS and pMinilS.T were cotransformed with Pf3 RF into E.coli N4156, thus s e l e c t i n g for Pf3 s p e c i f i c r e p l i c a t i o n of the plasmids, they both e f f i c i e n t l y yielded ampicillin r e s i s t a n t colonies. However when plasmid DNA, i s o l a t e d from independently obtained transformants was subjected to r e s t r i c t i o n enzyme mapping and nucleotide sequence a n a l y s i s , plasmids from cotransformation of рМіпіі from each other (Fig. 6 ) . as well as of pMinilS.T proved to be i n d i s c e r n i b l e The plasmid obtained a f t e r cotransformation of pMinilS.T produced ampicillin r e s i s t a n t E.coli N4156 colonies as e f f i c i e n t as the independently constructed pMinilS. These observations indicated t h a t exactly one of two copies of the 267 bp fragment in pMinilS.T had been deleted during Pf3 directed r e p l i c a t i o n . We thus conclude t h a t the region of the Pf3 genome (position 4312 through 4450) present in pMinilS (or pMini9) not only 90 ì 2 3~4 5 6 7 8 9 Figure 6. R e s t r i c t i o n fragment p a t t e r n s o b t a i n e d a f t e r H l n f l d i g e s t i o n of t h e Plasmids pMinilS ( l a n e 1) and pMinilS.T (lane 2 ) . In lanes 3 through 9 the fragment p a t t e r n r e s u l t i n g from H i n f l d i g e s t i o n of t h e Plasmids p r e s e n t i n seven i n d e p e n d e n t l y i s o l a t e d c o l o n i e s of E . c o l i N1)156 c o t r a n s f o r m e d w i t h pMinilS.T and Pf3 RF a r e shown. f u n c t i o n s i n t h e i n i t i a t i o n but a l s o i n t h e t e r m i n a t i o n of replication, s i m i l a r t o t h e o r i g i n of v i r a l s t r a n d r e p l i c a t i o n of t h e phages Ff and IKe. DISCUSSION We have s t u d i e d t h e l o c a t i o n of t h e o r i g i n s of v i r a l s t r a n d r e p l i c a t i o n of t h e b a c t e r i o p h a g e Pf3 genome, and examined i t s f u n c t i o n w i t h r e s p e c t t o t h e r e q u i r e m e n t of Pf3 encoded t r a n s - a c t i n g e l e m e n t s i n t h e r e p l i c a t i o n p r o c e s s by complementation s t u d i e s i n E . c o l i . The use of E . c o l i i n s t e a d of P.aeruginosa as t h e organism f o r s t u d y i n g DNA r e p l i c a t i o n was p r i m a r i l y based on t h e low e f f i c i e n c y of DNA t r a n s f o r m a t i o n . Although some t r a n s f o r m a t i o n p r o c e d u r e s s p e c i f i c Pseudomonas s t r a i n s have been d e s c r i b e d ( 3 ) . no g e n e r a l l y and e f f i c i e n t protocol is available. In a d d i t i o n , s e l e c t i o n of for applicable e.g. Pseudomonas a e r u g i n o s a t r a n s f o r m a n t s by an a n t i b i o t i c r e s i s t a n t phenotype i s difficult because t h i s s p e c i e s e x h i b i t s a very high c e l l u l a r r e s i s t a n c e t o a wide r a n g e of a n t i b i o t i c s ( 6 , 2 5 , 2 6 ) . The c h o i c e of E . c o l i s h o u l d however not be a l i m i t a t i o n w i t h r e s p e c t t o t h e i n t e r p r e t a t i o n of the r e s u l t s d e s c r i b e d , b e c a u s e , as mentioned above, Pf3 has been r e p o r t e d t o infect E.coli ( 5 , 30, u n p u b l i s h e d r e s u l t s ) . productively This was confirmed a g a i n by t h e 91 Table 1. Results of transformation of E.coli N4156 polA with different pMini c o n s t r u c t s separately or in combination with Pf3 RF. Efficiencies of transformation are expressed as t h e number of ampicillin r e s i s t a n t colony forming u n i t s (cfu) from a standard transformation experiment (see Materials and Methods). # ampR cfu Cotransformed Pf3 RF Transformed pi asmid (Pf3 i n s e r t ) РІК200 * pUC9 Pf3 RF pMinil pMini2 pMiniS рМіпіб pMini9 5 2.3 χ 1 0 (3484-4673) (4072-451*6) (4312-45^6) (4350-4 546) (4312-4450) pMinilO (4312-4410) 0 0 0 0 0 0 0 0 1.9 x 0 0 2.1 χ 1.7 x 1.2 χ 20 1.0 χ Ю 5 ., IO; IO; IO4 IO4 3 Plasmid pIK200 contains the complete replicón of the filamentous bacteriophage IKe (27), and was used as a p o s i t i v e control for transformation. i n i t i a l experiments described in t h i s paper, in which a recombinant plasmid, pMinil, containing the complete genome of a Pf3 miniphage (and thus the r e p l i c a t i o n origins of Pf3 ( 1 9 ) ) , was shown t o be r e p l i c a t e d in E.coli if helper functions were provided in trans by a cotransformed wt Pf3 genome. We assume t h a t only the o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n i s required for maintenance of the recombinant plasmid in t h e E.coli host. No d e f i n i t e conclusion can be reached with respect to the o r i g i n of complementary strand s y n t h e s i s , because t h i s origin in our experiments could be provided by pBR322 derived sequences of the vector plasmid, as has been demonstrated by the analysis of r e p l i c a t i o n functions of ФХ174 and of t h e filamentous phages Ff (8, 9, 16, 33). Using a cotransformati on assay we were able t o reduce the DNA region, in which t h e o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n i s located to 139 bp, i . e . p o s i t i o n 4310 through 4450 of the wt Pf3 genome. Additional evidence t h a t t h e recombinant plasmid pMini9 thus obtained i s r e p l i c a t e d under the i n s t r u c t i o n of the Pf3 i n s e r t , p a r a l l e l e d s t u d i e s of the r e p l i c a t i o n o r i g i n s of the filamentous E.coli bacteriophages fi and IKe (11, 12, 17). Detailed analysis of these o r i g i n s of viral strand r e p l i c a t i o n revealed the presence of a r e p l i c a t i o n i n i t i a t i o n as well as a r e p l i c a t i o n termination signal. This combination of functions was i l l u s t r a t e d by the r e s o l u t i o n of a plasmid, 92 containing two origins in the same orientation, into two Plasmids each containing only one functional origin. A similar experiment with a tandemly arranged Pf3 origin fragment from pMini9 resulted in the deletion of exactly one fragment copy, indicating that also the Pf3 viral strand origin encodes a replication initiation and a replication termination function. The results of the deletion experiments indicate that the complete 139 bp fragment, encompassing position 4312 through HH50 of the wt Pf3 genome, is essential for a functional origin of Pf3 viral strand replication. Further support for this conclusion comes from the structure of the genome of miniphage С (19). This genome is characterized by the presence of a tandem duplication generated in vivo. The duplicated fragment comprises sequences up to position 1412 of the wt Pf3 genome, i.e. all but 38 bp of the 139 bp fragment identified in this paper. This sequence arrangement is perfectly stable and thus the duplicated sequence cannot contain a functional replication initiation or termination site. As has been shown for a similar reiteration in Ff miniphage genomes (15, 19) this duplicated sequence in the minphage С genome may even confer a growth advantage to this miniphage. τ τ с с G С ос А С G *G G G С G А ,Α С С G С Τ Τ "С О G С 4 Ar. G С G С 0RF301 С G - 41)00 GС S S P L P R Q L L S T S K » AT TAGTTCGCCGCTTCCTCGTCAGCTTTTGAGTACCAGCAAGTGATTCCCGAA CGCTCTTCATTAGTAGTCACATATCGGTACGCTGCCCAAATCGGCATC 1320 I4H50 Figure 7. Nucleotide sequence of the fragment in which the Pf3 origin of viral strand replication is located. The inverted repeat sequence present in this region is drawn as a stem and loop structure. 93 However, in view of the r e s u l t s presented above i t can be concluded t h a t part of the duplicated segment of miniphage С DNA, a t l e a s t from position ^310 t o 1)1112, i s necessary but obviously not sufficient specific replication. t o i n i t i a t e or terminate Pf3 Apparently the 38 bp following position 4412 are e s s e n t i a l for proper functioning of the r e p l i c a t i o n o r i g i n . This sequence arrangement may be comparable t o the r e p l i c a t i o n "enhancer" sequence observed in Ml 3 (9) but not in IKe (28). Thus the o r i g i n of Pf3 v i r a l strand r e p l i c a t i o n comprises almost completely the t h i r d non coding region of the Pf3 genome (20). A major c h a r a c t e r i s t i c of t h i s non coding region i s the presence of one inverted repeat s t r u c t u r e , which may function as a s i t e for recognition by the Pf3 encoded t r a n s - a c t i n g factor(s). In the genomes of the E.coli specific filamentous bacteriophages Ff and IKe the v i r a l strand o r i g i n i s located in a much larger non coding region (of 507 and 738 n u c l e o t i d e s , r e s p e c t i v e l y ) t h a t in addition contains the s i g n a l s required for complementary strand r e p l i c a t i o n , and for packaging of the v i r a l strand i n t o progeny filamentous phage (4, 14, 26, 32). All s i g n a l s involved in Pf3 DNA r e p l i c a t i o n and phage morphogenesis are located between position 4092 and 4678 of the wt Pf3 genome, as has been concluded from the genomic s t r u c t u r e s of several miniphages (19). This observation and the r e s u l t s presented in t h i s paper leave an i n t e r e s t i n g p o s s i b i l i t y with respect t o the position of the Pf3 complementary strand origin and the morphogenetic s i g n a l . These s i g n a l s may overlap with the o r i g i n of v i r a l strand r e p l i c a t i o n , or otherwise may be located in protein coding regions of the genome. Both positions would be unique among the filamentous bacteriophages studied thus far. Further analysis of the Pf3 genome should allow the positioning of the complementary strand origin and the morphogenetic s i g n a l , and might also reveal requirements for gene expression and DNA r e p l i c a t i o n in P.aeruginosa, and thus be of importance for the development of vector systems in t h i s bacterium. In t h i s context i t should be noted t h a t Pseudomonas species are able to degrade a large number of xenobiotic compounds such as aromatic and a l i p h a t i c hydrocarbons. The a v a i l a b i l i t y of cloning vectors able t o r e p l i c a t e in t h i s genus will speed up the genetic analysis of these properties and open ways to improve or enhance them (2, 3, 29). 94 ACKNOWLEDGEMENTS The a u t h o r s t h a n k Dr. L e t t i e Lubsen f o r c r i t i c a l r e a d i n g of t h e m a n u s c r i p t and helpful suggestions, and Dr. J . van Boom (Department of O r g a n i c C h e m i s t r y , U n i v e r s i t y of L e i d e n ) f o r s y n t h e s i s of t h e Pf3 s e q u e n c i n g primer. REFERENCES 1. Baas, P.D. 1985. DNA r e p l i c a t i o n of s i n g l e - s t r a n d e d E s c h e r i c h i a c o l i DNA phages. 2. Biochim. B i o p h y s . Acta 825: B a g d a s a r i a n , M., M.M. B a g d a s a r i a n , 111-139. S. Coleman, and K.N. Timmis. 1979. In: Plasmids of m e d i c a l , e n v i r o n m e n t a l , and commercial i m p o r t a n c e . K.N. Timmis and A. P u e h l e r ( e d . ) , E l s e v i e r / N o r t h H o l l a n d , Amsterdam, p . 4 1 1 - 422. 3. B a g d a s a r i a n , M., and K.N. Timmis. 1982. H o s t : v e c t o r s y s t e m s for c l o n i n g i n Pseudomonas. 4. C u r r . Top. M i c r o b i o l . Immunol. 9 6 : Beck, E., R. Sommer, E.A. Auerswald, С S c h a l l e r , К. Sugimoto, H. S u g i s a k i , gene 47-67. Kurz, В. Z i n k , G. O s t e r b u r g , H. T. Okamoto, and M. Takanami. 1978. N u c l e o t i d e s e q u e n c e of b a c t e r i o p h a g e fd DNA. N u c l e i c A c i d s Res. 12: 4495-4503. 5. B r a d l e y , D.E. 1 9 8 1 . I n : M o l e c u l a r b i o l o g y , p a t h o g e n i c i t y , and e c o l o g y bacterial P l a s m i d s . S.B. P r e s s , New York. p . 6. Bryan, L.E. 1979. of Levy, R.C. Clowes, and E.L. Koenig ( e d . ) , Plenum 217-226. Resistance t o antimicrobial agents: of t h e problem and t h e b a s i s of r e s i s t a n c e , the general nature i n Pseudomonas a e r u g i n o s a : c l i n i c a l m a n i f e s t a t i o n s of i n f e c t i o n and c u r r e n t t h e r a p y . R.G. Dogget ( e d . ) , Academic P r e s s I n c . , New York. p219-270. 95 7. Chen, E.Y., and P.H. S e e b u r g . 1-985. S u p e r c o i l s e q u e n c i n g : A f a s t s i m p l e method f o r s e q u e n c i n g plasmld DNA. 8. DNA ^ : and 165-170. C l e a r y , J . M . , and D.S. Ray. 1980. R e p l i c a t i o n of t h e plasmid pBR322 under t h e c o n t r o l of a c l o n e d r e p l i c a t i o n o r i g i n from t h e s i n g l e - s t r a n d e d DNA phage M13. 9. Cleary, P r o c . N a t l . Acad. S c i . USA 7 7 : Ч638-46И9. J . M . , and D.S. Ray. 1981. D e l e t i o n a n a l y s i s r e p l i c a t i o n o r i g i n from b a c t e r i o p h a g e M13. 10. J. o f ^ t h e cloned V i r o l . ^10: 197-203. D e n h a r d t , D . T . , D. D r e s s i e r , and D.S. Ray ( e d . ) . 1978. The s i n g l e s t r a n d e d DNA p h a g e s . Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g H a r b o r , NY. 11. D o t t o , O . P . , К. H o r i u c h i , К.S. J a k e s , a n d N . D . origin 162: USA 7 9 : 335-343. phage f i plus-strand synthesis. G e l i e r t , M., К. M i z u u c h i , M.H. O'Dea, T. I t o h , and J . gyrase a c t i v i t y . DNA. a second g e n e t i c c h a r a c t e r i n v o l v e d P r o c . N a t l . Acad. S c i . USA 7 ^ : J. Virol. interfering particles. i n DNA ^772-4776. bacteriophage b a c t e r i o p h a g e and i t s J . Mol. B i o l . J_69: 389-407. P r o c . N a t l . Acad. S c i . USA 7 8 : 6784-6788. Konings, R.N.H., R.G.M. L u i t e n , and B.P.H. P e e t e r s . 1986. Mike, a chimeric filamentous phage designed f o r t h e s e p a r a t e p r o d u c t i o n of DNA s t r a n d of pKUN v e c t o r Plasmids by F 96 1977. Kim, M.H., J . C . H i n e s , and D.S. Ray. 1981. V i a b l e d e l e t i o n s of t h e Ml 3 complementary s t r a n d o r i g i n . 17. Sci. HH_: 32-46. H o r i u c h i , K. 1 9 8 3 . C o - e v o l u t i o n of a f i l a m e n t o u s defective 16. Tomizawa. H i l l , D . F . , and G.B. P e t e r s e n . 1982. N u c l e o t i d e s e q u e n c e of fi 15. P r o c . N a t l . Acad. 7122-7126. Nalidixic acid r e s i s t a n c e : 14. J. D o t t o , G . P . , К. H o r i u c h i , and N.D. Z i n d e r . 1982. I n i t i a t i o n and t e r m i n a t i o n of 13. Replication of b a c t e r i o p h a g e fi : Two s i g n a l s r e q u i r e d f o r i t s f u n c t i o n . Mol. B i o l . 12. Z i n d e r . 1982. + cells. Gene 4 6 : 269-276. either Livermore, D.M., and T.L. P i t t . 1986. Dissociation of surface properties and i n t r i n s i c r e s i s t a n c e t o ß-lactams in Pseudomonas aeruginosa. Microbiol. J. Med. 22: 217-224. Luiten, R.G.M., R.I.L. Eggen, J.G.G. Schoenmakers, and R.N.H. Konings. 1987. Spontaneous deletion mutants of bacteriophage Pf3: Mapping of s i g n a l s involved in r e p l i c a t i o n and assembly. DNA 6: 129-137. Luiten, R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings, and L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1 Plasmid s p e c i f i c filamentous phage of Pseudomonas aeruginosa. J. Virol. 56: 268-276. Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The major coat protein gene of the filamentous Pseudomonas aeruginosa phage Pf3·. Absence of an N-terminal leader signal sequence. Nucleic Acids Res. 11 : 8073-8085. Maniatis, T., E.F. F r i t s c h , and J. Sambrook. 1982. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor. Messing, J.M. 1979. A multipurpose cloning system based on the single stranded DNA bacteriophage M13· Recombinant Technical Bulletin 2: 43-48. Messing, J . , and J. Vieira. 1982. A new pair of Ml 3 vectors for s e l e c t i n g either DNA strand of double digest r e s t r i c t i o n fragments. Gene _1_9: 269- 276. Nlkaido, H., and M. Vaara. 1985. Molecular basis of b a c t e r i a l outer membrane permeability. Microbiol. Rev. 4£: 1-32. Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings. 1985. Nucleotide sequence and genetic organization of the genome of the N-specific filamentous bacteriophage IKe. J. Mol. Biol. 1_81_: 27-39. Peeters, B.P.H., J.G.G. Schoenmakers, and R.N.H.Konings. 1986. The genell proteins of the filamentous phages IKe and Ff (M13, f i , and fd) are not functionally interchangeable during viral strand r e p l i c a t i o n . Nucleic Acids Res. 14: 5067-5080. 97 28. Peeters, B . P . H . , J . G . G . Schoenmakers, and R.N.H. Konings. F u n c t i o n a l comparison of t h e DNA s e q u e n c e s i n v o l v e d 29. s t r a n d s of t h e f i l a m e n t o u s (M13, Π , 139-1 »?. DNA 6 : S a k a g u c h i , K. 1982. application. 30. in the r e p l i c a t i o n and packaging of t h e v i r a l and f d ) . Stanisich, Vectors V.A. phages IKe and Ff 1 for gene c l o n i n g i n Pseudomonas and t h e i r C u r r . Top. M i c r o b i o l . Immunol. 9 6 : -1 ЗІ ·?. 197^. The p r o p e r t i e s and h o s t r a n g e of b a c t e r i o p h a g e of 1987. Pseudomonas a e r u g i n o s a . male-specific J . Gen. M i c r o b i o l . 8 4 : 332- 342. 31. S t a u d e n b a u e r , W.L. 1978. S t r u c t u r e and r e p l i c a t i o n of t h e c o l i c i n El Plasmid. 32. C u r r . Top. M i c r o b i o l . Van Wezenbeek, Immunol. 8 3 : P . M . G . F . , T.J.M. H u l s e b o s , and J . G . G . Schoenmakers. N u c l e o t i d e sequence of t h e f i l a m e n t o u s Comparison with phage f d . 33· Gene U_: bacteriophages. and P . J . complementary s t r a n d DNA s y n t h e s i s N u c l e i c Acids R e s . J_1_: 4957-4975. Z i n d e r , N . D . , and K. H o r i u c h i . 1985. M u l t i r e g u l a t o r y filamentous 98 b a c t e r i o p h a g e M13 genome: Van der Ende, Α., R. T e e r s t r a , H.G.Α.M. van der Avoort, on s i n g l e s t r a n d e d Plasmid DNA. 1980. 129-148. Weisbeek. 1983. I n i t i a t i o n s i g n a l s for 34. 93-157. M i c r o b i o l . Rev. 49: element of 101-106. CHAPTER 5 Transcription Initiation and Termination Signals on the GenGme of the Pseudomonas aeruginosa Phage Pf3 Ruud G.M. Luiten, John G.G. Schoenmakers, and Ruud N.H. Konings ABSTRACT Transcription i n i t i a t i o n and termination signals of Pseudomonas aeruginosa have been studied using the genome of the filamentous bacteriophage Pf3 as a model system. Two t r a n s c r i p t i o n i n i t i a t i o n and one t r a n s c r i p t i o n termination signal have been i d e n t i f i e d , that are located within the DNA region encoding the Pf3 single-stranded DNA binding protein and the major coat p r o t e i n . Despite the fact that the nucleotide sequence of one of the two Pf3 promoters differed s i g n i f i c a n t l y from the Escherichia coli consensus promoter sequence, the t r a n s c r i p t i o n i n i t i a t i o n s i g n a l s were recognized both _in vivo and _in v i t r o by Escherichia c o l i RNA polymerase. The t r a n s c r i p t i o n termination signal identified on the Pf3 genome was shown t o be functional in Escherichia coll as well, These observations i n d i c a t e that the RNA polymerases encoded by Pseudomonas aeruginosa and Escherichia coll recognize i d e n t i c a l c o n s t i t u t i v e promoter sequences and termination s i g n a l s on template DNA. With respect t o the expression of the genes encoding the Pf3 single-stranded DNA binding protein and major coat protein, Pf3 employs a similar t r a n s c r i p t i o n s t r a t e g y as the Escherichia coli s p e c i f i c filamentous phages Ff and IKe, i_.e. i n i t i a t i o n of t r a n s c r i p t i o n at different promoters but termination at the same termination s i t e , thus r e s u l t i n g in a nested set of 3 ' overlapping messenger RNAs. INTRODUCTION During the l a s t few years there has been a growing i n t e r e s t in the use of bacteria belonging t o the genus Pseudomonas for biotechnological purposes. In p a r t i c u l a r the capacity to metabolize a broad variety of xenobiotic compounds such as a l i p h a t i c and aromatic hydrocarbons (4, 15), has drawn much a t t e n t i o n , and consequently has directed research towards the analysis of genes involved in the respective degradative pathways (7, 8, 11, 12, 22). The data from a number of these studies have suggested that t r a n s c r i p t i o n i n i t i a t i o n in 101 ori 279 I ori 71 ~\\ ρ ТВ | ог<Ь9 Ц pU | НпсІШ ИЬоІ 1 огІШ EcoBÏ Sell mio «21. «15 5зиЗД С μ.(Ι $лиЗД 93Ьр ÏSlbp 171 up Alu I D ІЭ9Ьр ЙІЭІ/НІГКШ libit Figure 1. A. Genetic map of the highly expressed region of the Pf3 genome encoding ssDBP (p78) and MCP (рНЧ), and open reading frames (orfs) of unknown function (18, 19). R e s t r i c t i o n s i t e s relevant t o the in v i t r o t r a n s c r i p t i o n s t u d i e s are indicated by arrows. B. Genomic l o c a t i o n of ssDNA probes used for the i d e n t i f i c a t i o n of Pf3 s p e c i f i c mRNAs by hybrid!zat i o n - s e l e c t i o n . С Pf3 r e s t r i c t i o n fragments used for SI nuclease mapping experiments. D. Pf3 r e s t r i c t i o n fragments i n s e r t e d in promoter and terminator probe plasmids. Pseudomonas differed significantly from t h e same process in Escherichia coll (7, 8, 22). Although in a number of systems these differences could be a t t r i b u t e d t o the absence of p o s i t i v e l y r e g u l a t i n g t r a n s c r i p t i o n f a c t o r s (7, 11, 22), the DNA sequence requirements of Pseudomonas RNA polymerase remained uncertain. We have used the genome of bacteriophage Pf3 as a model system to study t r a n s c r i p t i o n s i g n a l s in Pseudomonas. Pf3 i s a filamentous, single stranded (ss) DNA containing virus that infects Pseudomonas aeruginosa harboring the broad host range plasmid RP1 (29). The nucleotide sequence and part of the genetic organization of i t s genome have been elucidated (18, 19). Comparison of these data with those of the d i s t a n t l y r e l a t e d E.coli phages Ff (M13, f 1, and fd) and IKe ( 1 , 14, 23, 30) revealed an almost complete absence of homology both at the nucleotide sequence level and at the level of the amino acid sequence of t h e i r encoded p r o t e i n s . I n t e r e s t i n g l y however, a s i m i l a r i t y was observed with respect t o the overall genetic organization as i l l u s t r a t e d by the r e l a t i v e map position of several genes and the o r i g i n of v i r a l strand r e p l i c a t i o n (17, 18). In t h i s paper the c h a r a c t e r i z a t i o n of t r a n s c r i p t i o n i n i t i a t i o n and termination s i t e s within the highly expressed region of the Pf3 genome, 102 encoding t h e s i n g l e - s t r a n d e d DNA-binding p r o t e i n (ssDBP) and t h e major p r o t e i n (MCP), a r e d e s c r i b e d ( s e e F i g . 1A). coat In a d d i t i o n t h e Pf3 t r a n s c r i p t i o n i n i t i a t i o n and t e r m i n a t i o n s i g n a l s have been f u n c t i o n a l l y t e s t e d i n E . c o l i by both in v i t r o and in v i v o methods. MATERIALS AND METHODS B a c t e r i a , b a c t e r i o p h a g e s , and Plasmids B a c t e r i o p h a g e Pf3 and i t s h o s t P . a e r u g i n o s a PA01 h a r b o r i n g t h e broad h o s t r a n g e plasmid RP1 (29) were from our own s t o c k . The Pf3 genomic l i b r a r y i n M13mp8/9 (18) was used as a s o u r c e f o r p r e p a r a t i o n of s t r a n d s p e c i f i c ssDNA probes ( s e e F i g . the IB). Promoter probe Plasmids pK02 and pKM2 and t e r m i n a t o r probe plasmid pKG1900 ( 3 , 21) were used in combination with E . c o l i s t r a i n N100 ( r e c A l 3 , galK2) (21). Methods The p r e p a r a t i o n of ^H l a b e l e d RNA and t h e i s o l a t i o n of RNA from b a c t e r i a was performed a s d e s c r i b e d by R i v e r a e t a l . ( 2 5 ) . further infected G e n e r a l l y RNA was p u r i f i e d by c e n t r i f u g a t i o n t h r o u g h a c u s h i o n of 5.7 M CsCl ( 2 0 ) . S e l e c t i o n of s p e c i f i c RNA s p e c i e s by immobilized DNA, and gel e l e c t r o p h o r e s i s were e s s e n t i a l l y as d e s c r i b e d by Smits et a l . (2 6, 27) e x c e p t t h a t DNA was immobilized on n i t r o c e l l u l o s e i n s t e a d of DBM paper discs. In v i t r o t r a n s c r i p t i o n s t u d i e s were performed u s i n g t h e r e c o n s t i t u t e d system d e s c r i b e d by Edens e t a l . E.coli (6). The p r o c e d u r e s for r e s t r i c t i o n fragment i s o l a t i o n , 5 ' or 3 ' l a b e l i n g , S 1 - n u c l e a s e mapping, and c l o n i n g t e c h n i q u e s were as d e s c r i b e d by M a n i a t i s e t al. (20). 103 Enzymes and biochemicals All enzymes were obtained from Boehringer Mannheim, Bethesda Research Laboratories, or New England Biolabs and used as recommended by the s u p p l i e r s . 3 2 2 Radioactive precursors ( H-uridine, a^P-UTP, a3 P-dATP, and Ύ3 Ρ-ΑΤΡ) were purchased from Amersham. Media were prepared from Difco products and, if required, contained 100pg/ml ampicillin (Sigma). All other chemicals used were of a n a l y t i c a l grade. RESULTS Identification and characterization of Pf3 s p e c i f i c transcripts To obtain information about the number and s i z e of Pf3 s p e c i f i c t r a n s c r i p t s in infected P.aeruginosa PA01[RP1] c e l l s , two different hybridization methods were employed. In the f i r s t method ^H-uridine or ' Plabeled RNA i s o l a t e d from infected c e l l s was hybridized to e i t h e r Pf3 s i n g l e stranded (ss) or r e p l i c a t i v e form (RF) DNA immobilized on n i t r o c e l l u l o s e filters. Subsequently hybridized RNA was eluted from the f i l t e r s by heat denaturation and s i z e f r a c t i o n a t e d on denaturing Polyacrylamide g e l s . second method use was made of t h e Nothern b l o t t i n g technique. In the After f r a c t i o n a t i o n of t o t a l RNA on e i t h e r methylmercuryhydroxide or formaldehyde containing agarose gels and t r a n s f e r to n i t r o c e l l u l o s e f i l t e r s , the Pf3 s p e c i f i c species were i d e n t i f i e d by hybridization with nick t r a n s l a t e d Pf3 RF DNA. Congruent r e s u l t s were obtained; with the aid of both methods two major Pf3 s p e c i f i c t r a n s c r i p t s with an approximate length of 900 and 300 nucleotides (nt) and several minor RNA t r a n s c r i p t s with lenghts of 3000, 1500, and 650 nt were detected in Pf3 infected c e l l s (Fig. 2A). No Pf3 s p e c i f i c RNAs became v i s i b l e if for hybridization Pf3 v i r a l ssDNA, or v i r a l strand s p e c i f i c from a Pf3 genomic l i b r a r y in Ml3mp8 were used (not shown). probes These r e s u l t s together with the e s t a b l i s h e d genetic organization of the Pf3 genome (18) 101 A A 5 6 1 2 3 4 7 8 -860/7 '810 M mm Figure 2. Зн-uridine labeled Pf3 s p e c i f i c RNA from infected P.aeruginosa c e l l s , size fractionated on 2.5? polyacrylamide/7M urea g e l s , and I d e n t i f i e d by h y b r i d i z a t i o n - s e l e c t i o n . A. Lane 1, Pf3 s p e c i f i c RNAs selected by hybridization t o Pf3 RF immobilized on n i t r o c e l l u l o s e ; lane 2, t o t a l RNA from Pf3 infected P.aeruginosa; lane 3, t o t a l RNA from M13 infected E.coli K37 ( s i z e markers); lane U, t o t a l RNA from uninfected P.aeruginosa. B. Lane 1, t o t a l RNA from Ml 3 infected E.coli K37 c e l l s ; lane2, t o t a l RNA from Pf3 infected P.aeruginosa; lanes 3 through 8, Pf3 s p e c i f i c RNAs selected by Pf3 RF (lane 3 ) , and the strand- and r e g i o s p e c i f i c probes A20 (lane 4), Al 5 (lane 5), Al (lane 6), H24 (lane 7 ) , and TH410 (lane 8). i n d i c a t e that similar t o the filamentous E.coli phages Ff and IKe (1, 14, 23, 30), only the non-viral strand of Pf3 functions as a template for transcription. 105 To identify the DNA region from which the two major RNAs were t r a n s c r i b e d , hybridization and s e l e c t i o n experiments were performed using defined r e s t r i c t i o n fragments and r e g i o and s t r a n d - s p e c i f i c probes. I t was found that both t r a n s c r i p t s were products of the DNA region encoding the MCP, and t h a t the l a r g e s t RNA in addition contained ssDBP coding sequences (Figs. 1 and 2B). This observation together with the established d i r e c t i o n of t r a n s c r i p t i o n suggested that the major Pf3 t r a n s c r i p t s had i d e n t i c a l 3 ' but different 5' terminal ends. To verify t h i s hypothesis, SI nuclease mapping experiments were performed on heteroduplexes formed between a 5 ' end-labeled Pf3 SaußA fragment 517^ t o 233, Fig. 1) labeled at i t s 5'-end with 32 (position P , and t o t a l RNA from Pf3 infected P.aruglnosa c e l l s . Size f r a c t i o n a t i o n on a sequencing gel revealed two major protected fragments. As deduced from a known sequence pattern run in p a r a l l e l , the smallest had a length of 239 nt (Fig. ЗА). This located t h e 5' end of one of the two major RNA species at position 5831 of the wt Pf3 genomic sequence (18). The second protected fragment was only a l i t t l e smaller than the Sau3A fragment (892 n t ) used. A more precise mapping experiment, performed with a 5 ' end-labeled Hinfl fragment (position 4972 to 5442, Fig. 1) yielded a protected fragment of 220 nt (Fig. 3B), thus positioning the 5 ' end of the other RNA species at nucleotide 5226 of the wt Pf3 genomic sequence. The lengths of the two major mRNAs together with the map positions of t h e i r r e s p e c t i v e 5 ' ends suggested t h a t t h e i r 3 ' ends were located around p o s i t i o n 300 of the Pf3 genome, _i.e. downstream of the MCP coding region (18, 19) (Fig. 1). To map the 3' ends of both Pf3 s p e c i f i c mRNAs more precisely t h e SI nuclease protection technique was applied t o heteroduplexes formed between t o t a l RNA from Pf3 infected c e l l s and a 3' end labeled SaußA fragment located from position 253 t o 546 of the Pf3 genome (Fig. 1 ) . Surprisingly several protected fragments were found varying in length from 50 to 60 n t , with a major fragment of 59 nt (Fig. 4A). However if a large excess of SI nuclease was used only the protected fragment of 50 nt length remained (Fig. 4B). There are several reasons to believe that the 50 nt band of the l a t t e r experiment and the low mobility bands in the i n i t i a l experiment are the r e s u l t of overdigestion of the heteroduplex. Such a phenomenon i s not uncommon p a r t i c u l a r l y if the terminus of the protected fragment i s rich in A/T bases (31). Together with s t r u c t u r a l analogy of the DNA region concerned with the E.coli rho independent t r a n s c r i p t i o n terminators (see below) the 59 nt band 106 A TCGA SI В TCGA SI •·= _- 250 m 200 Figure 3. SI nuclease mapping of 5'end termini of Pf3 mRNA using a 5'end labeled 892 bp SaußA fragment (A) and a 5'end labeled 471 bp Hinfl fragment (B). The size marker sequence ladder was produced by dideoxy-sequencing of IKe ssDNA with a 1 4 nt synthetic primer located from position 1695 (3'end) to 1682 (5'end) of the IKe genomic sequence (23) most l i k e l y represents the primary protected fragment, and indicates t h a t both major Pf3 s p e c i f i c t r a n s c r i p t s terminate at position 313 of the wt Pf3 genomic sequence. Summarizing the r e s u l t s of the hybridization and SI nuclease protection experiments i t can be s t a t e d t h a t the two major Pf3 t r a n s c r i p t s have t h e i r 5 ' ends at position 5226 and 5831 of the Pf3 genomic sequence, r e s p e c t i v e l y , and that the t r a n s c r i p t i o n of both mRNAs i s terminated most probably at position 313, giving r i s e t o RNA molecules that are 921 and 316 nt long. The 3' end of these two Pf3 t r a n s c r i p t s has the i n t r i n s i c property to form a stable stem and loop s t r u c t u r e of 24 nucleotides which i s followed by a sequence r e l a t i v e l y r i c h in A/U r e s i d u e s . Such a sequence is c h a r a c t e r i s t i c of a rho independent t r a n s c r i p t i o n termination signal in E.coli (24). Inspection of sequences located immediately upstream of the 5 ' ends of these mRNAs indicated the presence of an E.coli l i k e promoter (13) at position 5226. On the contrary, no sequences resembling the E.coli consensus promoter were found immediately upstream of position 5831 (see f i g . 6 ) . This observation leaves open the p o s s i b i l i t y that the smaller RNA was not generated by an independent t r a n s c r i p t i o n i n i t i a t i o n event, but rather was the r e s u l t of 107 A TC GA 1 2 Й TC G A 12 60' 50' АО' Figure M. SI nuclease mapping of the 3' terminus of Pf3 mRNA using a 3'end labeled 294 bp SaußA fragment, and 200 units (A) or 4000 units (B) of SI nuclease during different incubation times. Lanes 1, 30 min; lanes 2, 15 min. The sequence ladder was prepared as described in Figure 3· processing of a larger precursor molecule. Processing has been found to be an important mechanism in the generation of functional mRNA species during the infection cycle of the filamentous Ff phage (2, 26, 27), and t h i s p o s s i b i l i t y has to be considered for Pf3 accordingly (see the next s e c t i o n ) . Pf3 specified transcription in E . c o l i . To find out whether t h e Pseudomonas (Pf3) s p e c i f i c t r a n s c r i p t i o n signals were also functional in E . c o l i , we studied the t r a n s c r i p t i o n of the Pf3 genome or fragments thereof in E.coli both by in v i t r o and _in vivo methods. In v i t r o t r a n s c r i p t i o n of Pf3 RF DNA with E.coli RNA polymerase r e s u l t e d in the formation of several RNA species of which, with respect to t h e i r s i z e s , the major ones were i n d i s t i n g u i s h a b l e from the major t r a n s c r i p t s found in Pf3 infected P.aeruginosa c e l l s (Fig. 5). These t r a n s c r i p t s were also produced if Bell l i n e a r i z e d Pf3 RF (cleavage at map position 1150, Fig. 1) was used as a template. Transcription of EcoRV l i n e a r i z e d Pf3 RF on the other hand r e s u l t e d in RNA molecules that were approximately 200 and 800 nt long (Fig. 5 ) . 108 1 2 3 4 5 6 7 V4 i * Figure 5. In v i t r o t r a n s c r i p t i o n of different Pf3 templates, size fractionated on 1.5Î agarose gels containing formaldehyde (lanes 1 t o 3) or methylmercuryhydroxide (lanes 4 to?) as denaturing agents. The templates used were: Pf3 RF ( l a n e l ) , and Pf3 RF l i n e a r i z e d with Boll (lane 2 ) , EcoRV, or Hindlll (lane 5). In lane 6 the in v i t r o t r a n s c r i p t i o n reaction was carried out on a 1460 bp MboII fragment (position 4160-5620). An _in vivo mRNA preparation and Pf3 Haell r e s t r i c t i o n fragments of 2766, 1722, 1020, and 325 bp were electrophoresed in lanes 4 and 7, r e s p e c t i v e l y , and visualized by hybridization with 32p labeled Pf3 RF. The l a t t e r observation can only be explained by premature t r a n s c r i p t i o n termination at the EcoRV cleavage s i t e (run-off t r a n s c r i p t i o n ) . Since EcoRV cleaves Pf3 RF at position 171 (18, 19, Fig. 1) the data prove that the two major i_n v i t r o RNAs are transcribed from the DNA region encoding the ssDBP and MCP. Similar conclusions could be derived from t r a n s c r i p t i o n studies performed on Pf3 RF l i n e a r i z e d with Hindlll (map position 1, Fig. 1), or on an MboII fragment (map position 4160 to 5620, Figs. 1 and 5 ) . In each case the size of the run-off t r a n s c r i p t s indicated that they were i n i t i a t e d at or very close t o Pf3 map position 5230 and 5830, i . e . at positions where also 109 the 5 ' termini of the major _in vivo Pf3 t r a n s c r i p t s were found. Because the lengths of the in v i t r o RNAs transcribed from Pf3 RF or from Pf3 RF l i n e a r i z e d with Bell (outside the ssDBP/MCP coding region) were i d e n t i c a l to those of the major _ln vivo Pf3 RNAs, the data furthermore i n d i c a t e t h a t the Pf3 s p e c i f i c t r a n s c r i p t i o n termination signal functioned c o r r e c t l y in the E.coli in v i t r o t r a n s c r i p t i o n system. Apparently the major t r a n s c r i p t i o n i n i t i a t i o n and termination signals of the Pf3 genome are recognized by P.aeruginosa as well as by E.coli RNA polymerase. To verify whether t h i s conclusion also holds for the in vivo s i t u a t i o n , r e s t r i c t i o n fragments harboring e i t h e r a Pf3 promoter or a terminator were cloned in the promoter probe vectors pK02 and pKM2 (3) and in the t r a n s c r i p t i o n terminator probe plasmid pKG1900 (21), r e s p e c t i v e l y . These vectors contain the E.coli galK gene, the expression of which can be detected phenotypically in a gal К negative host ( e . g . E.coli N100) using McConkey agar plates containing galactose as the sole carbohydrate carbon source. In pK02 and pKM2 the galК gene i s not expressed unless a promoter sequence i s i n s e r t e d in a proper o r i e n t a t i o n in the polylinker sequence preceding the galK s t r u c t u r a l gene. On the contrary, c e l l s harboring pKG1900 do express the galК gene fron the gal-operon promoter, but i n s e r t i o n of a t r a n s c r i p t i o n termination signal abolish t h i s in between the promoter and the s t r u c t u r a l gene will expression. The Pf3 DNA r e s t r i c t i o n fragments used t o assay for t r a n s c r i p t i o n i n i t i a t i o n a c t i v i t y , j^.e. an Alul fragment (map position 5107 t o 53^5) and an Rsal/Hindlll fragment (map position 5569 t o 1, see Fig. 1), were purified and l i g a t e d s e p a r a t e l y into appropriately digested pK02. Subsequent transformation of E.coli N100 c e l l s yielded only gal К positive colonies for the l a t t e r r e s t r i c t i o n fragment. Plasmid i s o l a t i o n from the galK expressing colonies followed by r e s t r i c t i o n enzyme mapping proved t h a t a l l contained the Rsal/Hindlll fragment. This r e s u l t thus confirmed the presence of a promoter in t h i s region of the Pf3 genome, almost c e r t a i n l y coinciding with the t r a n s c r i p t i o n i n i t i a t i o n s i t e found ijn v i t r o i n E.coli and in vivo in P.aeruginosa. In view of the strong in v i t r o promoter a c t i v i t y , located on the 238 bp Alul fragment, the absence of galK p o s i t i v e transformants from l i g a t i o n of t h i s fragment in pK02 was somewhat unexpected. Several of the gal К negative colonies, however, were shown to harbor pK02 Plasmids containing the 238 bp Alul fragment, but in a l l cases the o r i e n t a t i o n of the promoter (as 110 identified by SI nuclease mapping) was directed away from the galК gene. t h a t t h e l i g a t i o n was succesfull, This proved but suggested t h a t only one of the constructs yielded viable transformants. I t i s well known however t h a t overexpression of the galK gene may be l e t h a l t o E.coli ( 3 ) . Therefore t h e 238 bp Alul fragment was l i g a t e d i n t o plasmid pKM2, which due t o the presence of the XtR1 terminator between the promoter i n s e r t i o n s i t e and the galK s t r u c t u r a l gene, i s s p e c i f i c a l l y adapted for the analysis of strong promoters ( 3 ) . This approach did yield galK p o s i t i v e transformants, and r e s t r i c t i o n enzyme mapping indicated t h a t indeed the fragment was inserted in such an o r i e n t a t i o n t h a t promoter a c t i v i t y was directed towards the galK gene. The f u n c t i o n a l i t y of the Pf3 t r a n s c r i p t i o n termination signal in E.coli was t e s t e d in a similar way by i n s e r t i o n of an Alul fragment extending from position 169 through 419 of the Pf3 genetic map (Fig. 1), i n t o the unique Smal s i t e of pKG1900. Transformation of t h e l i g a t i o n mixture t o E.coli N100 yielded both galК positive and negative c o l o n i e s . Plasmid DNA i s o l a t i o n of several of these colonies indicated t h a t the galK phenotype was not only dependent on the presence or absence of an i n s e r t e d fragment, but a l s o on the o r i e n t a t i o n of the fragment. Only in c e l l s containing Plasmids in which, with respect t o the d i r e c t i o n of t r a n s c r i p t i o n , the o r i e n t a t i o n of the Pf3 t r a n s c r i p t i o n termination signal was i d e n t i c a l t o t h a t in Pf3, galK expression was abolished. From the r e s u l t s obtained i t can be concluded t h a t the two major promoters and a t r a n s c r i p t i o n terminator of the Pf3 genome are functional s i g n a l s both in P.aeruginosa and in E . c o l i . DISCUSSION The knowledge of t h e nucleotide sequence and genetic organization of the Pf3 genome (18, 19) has allowed us to use the genome of t h i s phage as a model system for studying gene expression, P.aeruginosa. and in p a r t i c u l a r gene t r a n s c r i p t i o n in Analysis of the RNAs synthesized in infected P.aeruginosa cells revealed the presence of two major Pf3 s p e c i f i c t r a n s c r i p t s with a length of 111 approximately 900 and 300 n t , and several minor ones of 3000, 1500, and 650 nt. The use of strand s p e c i f i c hybridization probes has furthermore revealed that each of these RNAs i s transcribed from the non-viral strand of Pf3 RF. In t h i s respect the d i r e c t i o n of t r a n s c r i p t i o n of the Pf3 genome i s in accordance with that already deduced from i t s genomic sequence (18), and i s i d e n t i c a l to the mode of t r a n s c r i p t i o n of the well studied E.coll phages Ff and IKe ( 1 , 14, 23, 30). Studies with respect t o the o r i g i n of the Pf3 s p e c i f i c t r a n s c r i p t s by hybridization t o regio s p e c i f i c DNA probes remained inconclusive for the minor RNA species. This i s mainly due to the fact that for the 3000 and 1600 nt species aspecific hybridization with rRNA could not be excluded or t o the fact that only very small amounts of these RNA species are present in infected cells. However, the 900 nt mRNA was shown to contain the coding regions of the Pf3 ssDBP and MCP, whereas the 300 nt mRNA originated exclusively from the MCP coding region. These two major t r a n s c r i p t s have an i d e n t i c a l 3 ' terminal end which i s located around map position 313, while t h e i r 5 ' terminal ends were located at position 5226 and 5831 of the Pf3 genomic sequence, r e s p e c t i v e l y , as demonstrated by high r e s o l u t i o n SI nuclease mapping experiments. E s s e n t i a l l y the same RNA species were transcribed from the ssDBP/MCP coding region if Pf3 RF was transcribed in an _in v i t r o system by E.coli RNA polymerase. These r e s u l t s , together with the data obtained from studies with promoter and terminator probe Plasmids demonstrate that the Pf3 t r a n s c r i p t s are the r e s u l t of independent t r a n s c r i p t i o n i n i t i a t i o n (and termination) events. From these r e s u l t s several additional conclusions can be drawn. With respect to t r a n s c r i p t i o n i n i t i a t i o n i t i s evident that the major promoters of the Pf3 genome are functional both in P.aeruginosa and in E . c o l i . The promoter i n i t i a t i n g t r a n s c r i p t i o n at position 5226 of the Pf3 genome may even be considered a very strong promoter in both s p e c i e s . This i s i l l u s t r a t e d by the fact t h a t the mRNA i n i t i a t i n g at t h i s position i s very abundant in P.aeruginosa, and that in E.coli only attenuation by the XtRI terminator, which aborts about 90Í of the t r a n s c r i p t s reaching i t ( 3 ) , r e s u l t e d in nontoxic l e v e l s of galactokinase. Inspection of the nucleotide sequence of the DNA region upstream of the t r a n s c r i p t i o n i n i t i a t i o n s i t e at position 5226 revealed a s i g n i f i c a n t homology with the E.coli consensus pronoter (13), whereas no E.coli l i k e promoter 112 "-35" TTGACA E.coli Pf3 DBP "-10" TATAAT caaaaaagtacTTGcaAgttcccgaaaccctgtcTAgAgTtctaggtgcat 5200 Pf3 MCP +1 A +1 agcttgttaatgatgtttgtcatgaatgggctgaacgttcagatttgcta 5800 +1 Figure 6. Nucleotide sequences of the Pf3 promoters identified in vivo in P.aeruginosa and in vivo and in vitro in E.coli, aligned with the E.coli consensus promoter sequence. Homolous bases are in upper case l e t t e r s . sequence was found immediately upstream of position 5831 (Fig. 6). observation thus might explain the relative efficiency This (strength) of these Pf3 promoters in E.coli, both in the _in vitro and in vivo system. Only a few Pseudomonas promoters have been characterized up to now. most of these promoters are positively regulated by specific Because protein factors, their nucleotide sequences cannot be considered representative for constitutive Pseudomonas promoters (22). and From a direct comparison of P.putida E.coli RNA polymerases with respect to their interaction with several E.coli promoters present on plasmid pBR322 no differences in binding characteristics were observed (10). Recently i t has also been shown that P.aeruginosa efficiently (28). recognizes the E.coli consensus promoter sequence Our results demonstrate that also the opposite is true, i_.e. that Pseudomonas promoters are recognized by E.coli RNA polymerase. A similar conclusion can be drawn for the transcription termination signal. The Pf3 terminator i s composed of an inverted repeat, able to form a stable hairpin loop structure in the nascent mRNA, which i s followed in Τ and A residues rho by a region rich (Figure 7). This structure i s clearly similar to that of factor independent transcription terminators in E.coli (24). The observed unidirectionality of the Pf3 terminator in E.coli indicates that not only the possible secondary structure, but also the nature of the residues following the inverted repeat, determine transcription termination efficiency. As with the other filamentous bacteriophages isolated so far, Pf3 infection of i t s natural host P.aeruginosa harboring the broad host range plasmid RP1 does not k i l l nor lyse the host cell (29). Instead, infection results in a bacterium that continuously extrudes progeny phage through the cell membrane and wall, but is s t i l l capable of growth (5, 29). 113 τ с т С G G G G G G G С Τ С С С A Τ Τ A AT TCAATTCGTT 280 AG = - 1 0 . 7 j i, TCGTTTAGCGGC 310 Figure 7. Sequence of the Pf3 t r a n s c r i p t i o n termination signal. The inverted repeat s t r u c t u r e i s depicted as a hairpin loop. RNA 3 ' termini detected with SI nuclease mapping are indicated by arrows. The Gibbs free energy of the hairpin loop was calculated according t o F r e i e r et a l . ( 9 ) . Both the continuous production of phage and the s u b t l e parasitical r e l a t i o n s h i p with the host require a s t r i c t l y regulated expression of the coding regions of the filamentous phage genome. Despite of the absence of homology between the genomes of Pf3 and the E.coli specific filamentous phages Ff (18), a d i s t i n c t s i m i l a r i t y emerges with respect t o the expression of the ssDBP and the MCP coding regions of t h e i r genomes. The synthesis of the proteins encoded by the Ff phage genome i s regulated to a significant by the a v a i l a b i l i t y extent of functional messenger RNA ( 1 6 ) . To t h i s end the Ff phage has developed a t r a n s c r i p t i o n s t r a t e g y in which the r e l a t i v e positions of t r a n s c r i p t i o n i n i t i a t i o n and termination s i t e s , the frequency of t r a n s c r i p t i o n i n i t i a t i o n and the e x p l o i t a t i o n of host encoded RNA processing systems (2, 26) are the main factors determining mRNA a v a i l a b i l i t y . For the highly expressed DNA region encoding the single-stranded DNA binding protein and the major coat protein t h i s s t r a t e g y r e s u l t s in a nested set of t r a n s c r i p t s with different 5' ends, but with i d e n t i c a l 3' ends located at a strong rho-independent t r a n s c r i p t i o n termination signal downstream of the major coat protein gene. In t h i s respect Pf3 appears to employ a similar s t r a t e g y as the Ff phages in r e g u l a t i n g the expression of i t s ssDBP and MCP. Unfortunately, t h i s observation does not shed l i g h t on the evolutionary r e l a t i o n s h i p between Pf3 and the filamentous E.coli phages. I t could in fact be in favour of both the divergent and convergent evolution hypotheses mentioned in a previous paper (18). A d e f i n i t i v e IH answer to t h i s question must a w a i t t h e g e n e t i c a n a l y s i s of o t h e r members of t h i s c l a s s of bacterial viruses. ACKNOWLEDGMENTS We a r e g r a t e f u l t o D r s . McKenney and de Boer f o r t h e g i f t and Plasmids pK02 and pKM2, r e s p e c t i v e l y . of plasmid pKGI900 We t h a n k P e t e r - P a u l B i e r m a n s , Benen, Marja Timmermans, Guy Honnée and E r i c C l a a s f o r t h e i r different a s p e c t s of t h i s s t u d y . contributions Dr. L e t t i e Lubsen i s acknowledged c r i t i c a l r e a d i n g of t h e m a n u s c r i p t and h e l p f u l Jac. to for advise. LITERATURE CITED 1. Beck, E . , R. Sommer, E.A. Auerswald, C. Kurz, В. Z i n k , G. O s t e r b u r g , H. S c h a l l e r , К. Sugimoto, H. S u g i s a k i , T. Okamoto, and M. Takanami. 1978. N u c l e o t i d e s e q u e n c e of b a c t e r i o p h a g e fd DNA. N u c l e i c Acids Res. 1 2 : 1Й 95-¿4 503. 2. Blumer, K . J . , and D.A. S t e e g e . 1984. mRNA p r o c e s s i n g i n E s c h e r i c h i a c o l i : an a c t i v i t y encoded by t h e h o s t p r o c e s s e s b a c t e r i o p h a g e fi mRNAs. N u c l e i c Acids Res. 1_2: 1 8 4 7 - 1 8 6 1 . 3. de Boer, H.A. 1984. A v e r s a t i l e plasmid system f o r t h e s t u d y of prokaryotic transcription signals in Escherichia c o l i . Gene 3 0 : 2 5 1 - 255. 4. C l a r k e , P . H . , and M.H. Richmond. 1975. G e n e t i c s and b i o c h e m i s t r y of Pseudomonas. Wiley, 5. London. D e n h a r d t , D . T . , D. D r e s s i e r , and D.S. Ray, ( e d . ) . 1978. The s i n g l e - s t r a n d e d DNA p h a g e s . Cold S p r i n g Harbor L a b o r a t o r y , Cold S p r i n g H a r b o r , NY. 115 6. Edens, L., R.N.H. Konings, and J.G.G. Schoenmakers. 1976. Mapping of promoter s i t e s on t h e genome of b a c t e r i o p h a g e M13. Eur. J. Biochem. 70: 577-587. 7. Eggink, G., P.H. van L e l y v e l d , A. Arnberg, N. Arfman, C. W i t t e v e e n , and B. W i t h o l t . 1987. S t r u c t u r e of the Pseudomonas p u t i d a alkBAC o p e r o n . J . B i o l . Chem. 262, 6400-6406. 8. F r a n k l i n , F . C . H . , M. B a g d a s a r i a n , M.M. B a g d a s a r i a n , and K.N. Timmis. 1981. A m o l e c u l a r and f u n c t i o n a l a n a l y s i s of t h e TOL plasmid pWWO from Pseudomonas p u t i d a and c l o n i n g of t h e genes f o r t h e e n t i r e r e g u l a t e d a r o m a t i c r i n g meta c l e a v a g e pathways. P r o c . N a t l . Acad. S c i . USA 7 8 : 7458-7462. 9. Freier, S.M., R. K i e r z e k , J.A. J a e g e r , N. Sugimoto, M.H. C a r u t h e r s , T. Neilson, and D.H. T u r n e r . 1986. Improved f r e e - e n e r g y parameters p r e d i c t i o n s of RNA duplex s t a b i l i t y . for P r o c . N a t l . Acad. S c i . USA 8 3 : 9373-9377. 10. Gragerov, A . I . , A.A. Chenchik, V.A. A i v a s a s h v i l l i , B e a b e a l a s h v i l l i , and V.G. N i k i f o r o v . R.Sh. 1984. E . c o l i and P . p u t i d a RNA polymerases d i s p l a y i d e n t i c a l c o n t a c t s with p r o m o t e r s . G e n e t . 195: 11. Mol. Gen. 511-515. H a a s , D. I 9 8 3 . G e n e t i c a s p e c t s of b i o d é g r a d a t i o n by Pseudomonas. Experi e n t i a 39: 1199-1213. 12. Harayama, S . , P.R. Lehr bach, and K.N. Timmis. 1984. Transposon m u t a g e n e s i s of meta cleavage pathway operon genes of t h e T0L plasmid of P.putida mt-2. 13. H a r l e y , C . B . , and R.P. Reynolds. 1987. A n a l y s i s of E . c o l i sequences. 14. promoter N u c l e i c Acids Res. 1_5: 2 3 4 3 - 2 3 6 1 . H i l l , D . F . , and G.B. P e t e r s e n . 1982. N u c l e o t i d e sequence of b a c t e r i o p h a g e fi 116 J . B a c t e r i o l . 1_60: 2 5 1 - 2 5 5 . DNA. J. Virol. 44: 32-46. 15. Huetter, R., and T. Leisinger ( e d . ) . 1981. Microbial degradation of xenobiotics and r e c a l c i t r a n t compounds. 16. Academic Press, London. LaFarina, M., and P. Model. 1983. T r a n s c r i p t i o n in bacteriophage fi infected E . c o l i . Messenger populations in the infected c e l l . Biol. Ш : 17. J. Mol. 377-393. Luiten, R.G.M., R.I.L. Eggen, J.G.G. Schoenmakers, and R.N.H. Konings. 1987. Spontaneous deletion mutants of bacteriophage Pf3: Mapping of s i g n a l s involved in r e p l i c a t i o n and assembly. 18. DNA 6_: 129-137. Luiten, R.G.M., D.G. Putterman, J.G.G. Schoenmakers, R.N.H. Konings, and L.A. Day. 1985. Nucleotide sequence of the genome of Pf3, an IncP-1 Plasmid s p e c i f i c filamentous phage of Pseudomonas aeruginosa. J. Virol. 56: 268-276. 19. Luiten, R.G.M., J.G.G. Schoenmakers, and R.N.H. Konings. 1983. The major coat protein gene of the filamentous Pseudomonas aeruginosa phage Pf3: Absence of an N-terminal leader signal sequence. NucleicAcids Res. n_: 8073-8085. 20. Maniatis, T., E.F. F r i t s c h , and J. Sambrook. 1982. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor. 21. McKenney, K., H. Shimatake, D. Court, U. Schmeissner, С Brady, and M. Rosenberg. 1981. A system to study promoter and terminator s i g n a l s recognized by Escherichia c o l i RNA polymerase, i n : J.G. C h i r i k j i a n , and T.S. Papas ( e d . ) . Gene amplification and a n a l y s i s . Structural Analysis of Nucleic Acids, vol. 2. Elsevier, 22. New York. рр383-^15. Mermod, N.. P.R. Lehrbach, W. Reineke, and K.N. Timmis. 1984. Transcription of t h e TOL plasmid t o l u a t e catabolic pathway operon of Pseudomonas putida i s determined by a pair of coordinately and p o s i t i v e l y regulated overlapping promoters. 23. EMBO J. 3: 2461-2466. Peeters, B.P.H., R.M. Peters, J.G.G. Schoenmakers, and R.N.H. Konings. 1985. Nucleotide sequence and genetic organization of the genome of the N-specific filamentous bacteriophage IKe. J. Mol. Biol. 181 : 27-39. 117 24. P l a t t , T. 1986. Transcription termination and the regulation of gene expression. 25. Ann. Rev. Biochem. 55: 339-372. Rivera, M.J., M.A. Smits, W. Quint, J.G.G. Schoenmakers, and R.N.H. Konings. 1978. Expression of bacteriophage M13 DNA in vivo. Localization of the t r a n s c r i p t i o n i n i t i a t i o n and termination signal of the mRNA coding for the major capsid p r o t e i n . Nucleic Acids Res. 5: 2895-2912. 26. Smits, M.A., J. Jansen, R.N.H. Konings, J.G.G. Schoenmakers. 1984. I n i t i a t i o n and termination signals for t r a n s c r i p t i o n in bacteriophage M13. 27. Nucleic Acids Res. J_2: 4071-4081. Smits, Μ.Α., J.G.G. Schoenmakers, and R.N.H. Konings. 1980. Expression of bacteriophage M13 DNA in vivo. I s o l a t i o n , i d e n t i f i c a t i o n , and c h a r a c t e r i z a t i o n of phage s p e c i f i c mRNA species. Eur. J. Biochem. 112: 309-321. 28. S o l d a t i , L., D.J. Jeenes, and D. Haas. 1987. Effective gene expression in Pseudomonas aeruginosa under the control of the Escherichia c o l l consensus promoter. 29. FEMS Microbiol. L e t t . 42^ I63-I67. Stanisich, V.A. 1974. The properties and host range of bacteriophage of Pseudomonas aeruginosa. male-specific J . Gen. Microbiol. 84_: 332- 342. 30. Van Wezenbeek, P.M.G.F., T.J.M. Hulsebos, and J.G.G. Schoenmakers. 1980. Nucleotide sequence of the filamentous bacteriophage Ml 3 genome: Comparison with phage fd. 31. Gene 1_1_: 129-148. Weaver, R.F., and C. Weismann. 1979. Mapping of RNA by a modification of the Berk-Sharp procedure: the 5 ' termini of 15S 8-globin mRNA precursor and mature 10S ß-globin mRNA have i d e n t i c a l map Nucleic Acids Res. 7: 118 1175-1193. coordinates. SUMMARY Pf3 i s a filamentous bacteriophage s p e c i f i c for Pseudomonas aeruginosa 0 harboring a conjugative plasmid of the incompatibility group P-1. The virion i s about 700 nm long and has a diameter of about 6 nm, and i s the smallest filamentous bacteriophage i s o l a t e d thus far. Similar to a l l other filamentous b a c t e r i a l v i r u s e s , Pf3 infection r e s u l t s in extrusion of progeny phage i n t o the c u l t u r e medium without k i l l i n g of the host c e l l . The virion consists of a c i r c u l a r single-stranded DNA genome encapsidated in a f l e x i b l e tube formed by a large number of major coat protein subunits and several copies of at l e a s t one other (minor) coat p r o t e i n . To gain i n s i g h t i n t o the evolutionary r e l a t i o n s h i p of Pf3 with the other characterized filamentous bacteriophages, in p a r t i c u l a r with the Escherichia coli specific phages Ff and IKe, a molecular genetic study of the genome of Pf3 was undertaken. An additional aim of t h i s project was to study gene expression and DNA r e p l i c a t i o n in Pseudomonas, and t o map the s i g n a l s involved in these processes. Chapter 1 deals with the c h a r a c t e r i z a t i o n of the Pf3 major coat protein gene and i t s encoded protein product. I t appeared t h a t , contrary t o the major coat proteins of the bacteriophages Ff, IKe, If 1, and Pf1, the Pf3 major coat protein i s not synthesized via a precursor protein containing a leader peptide at i t s N-terminal end. This leader peptide i s supposed to be responsible for c o t r a n s l a t i o n a l i n s e r t i o n of the coat protein in the cytoplasmic membrane, and i s removed during or s h o r t l y after t h i s process. The absence of a leader peptide in the primary t r a n s l a t i o n product of the Pf3 major coat protein gene thus might suggest t h a t t h i s protein i s not a membrane p r o t e i n . However, the s t r i k i n g s i m i l a r i t y in the d i s t r i b u t i o n of hydrophobic amino acids in the Pf3 major coat protein and the mature major coat proteins of the other phages, and the fact that filamentous phage morphogenesis and extrusion are processes that are closely associated with the host cell membrane prompted us to conclude that the Pf3 major coat protein must be a membrane p r o t e i n . Because of the length of the Pf3 major coat protein (ИЧ amino acids) i n s e r t i o n of t h i s protein in the membrane must occur post-translationally. 121 In chapter 2 the complete nucleotide sequence of the single-stranded genome of Pf3. as determined independently by two research groups, i s presented. The circular Pf3 genome consists of 5833 nucleotides. Two genes have been i d e n t i f i e d : the major coat protein gene described in chapter 1, and a gene that codes for a single-stranded DNA-binding p r o t e i n . Neither these genes nor any other part of the Pf3 DNA sequence displays significant homology with the genomic sequences of the phages Ff or IKe. The overall genome organization of Pf3i i . e . the two genes mentioned and the order and size of seven other open reading frames, shows a s t r i k i n g s i m i l a r i t y t o the genetic organization of the phages Ff and IKe. This s i m i l a r i t y , however, i s too small to permit a prediction with respect to the functions of the proteins encoded by the Pf3 open reading frames. The discovery and characterization of spontaneous deletion mutants (miniphages) of Pf3 i s the subject of chapter 3. Miniphages contain a c i r c u l a r single-stranded DNA molecule that i s up to 80Í smaller than the wt Pf3 genome, r e s u l t i n g in equally shortened viral filaments. Three different miniphages have been studied in d e t a i l . The nucleotide sequence of t h e i r genomes revealed that they evolved via deletion of a large segment of the wt Pf3 genome, probably via a similar mechanism involving short direct r e p e a t s . In the wt Pf3 genome these direct repeats flank on both sides the DNA fragment present in the miniphage genome, whereas in the miniphage DNA only a single copy of t h i s repeat was present, thereby joining the ends of the preserved DNA fragment. One miniphage genome contained a tandemly duplicated sequence and from i t s s t r u c t u r e i t could be concluded that the deletion had preceded the duplication event. The duplicated fragment also appeared to be flanked by short direct r e p e a t s , one copy of which remained at the link between the duplicated segments, suggesting that the deletions and duplications had occurred via a similar process, most probably via a "slipped mispairing" mechanism. Downstream slipping of the 3'end of the growing DNA strand thus would r e s u l t in a deletion of DNA sequences, whereas slipping upstream would r e s u l t in a (tandem) duplication. This mechanism i s p a r t i c u l a r l y appealing because the single-stranded DNA intermediates in the r e p l i c a t i o n cycle of filamentous bacteriophage genomes might f a c i l i t a t e the growing DNA strand to complementary sequences on the template DNA. This process may apply to a l l DNA molecules r e p l i c a t i n g via single-stranded DNA intermediates, e.g. 122 Bacillus and Streptomyces Plasmids, and thus may be one of the major factors determining the observed s t r u c t u r a l i n s t a b i l i t y of these Plasmids. The genomes of a l l three miniphages have one segment of wt Pf3 DNA in common. From the fact t h a t in the presence of wt helper phage, a l l three Pf3 miniphages are r e p l i c a t e d e f f i c i e n t l y , and are assembled into (defective) single-stranded DNA containing filamentous p a r t i c l e s i t can be concluded that the DNA region shared by a l l three miniphage genomes contains the Pf3 morphogenetlc signal and the r e p l i c a t i o n o r i g i n s for the synthesis of both the v i r a l and the complementary s t r a n d . A more detailed characterization of the origin of viral strand synthesis i s described in chapter H. By using in v i t r o deletion mapping techniques, the region containing a functional origin of v i r a l strand r e p l i c a t i o n could be reduced to 139 b a s e p a i r s . Similar t o the v i r a l strand origins of the phages Ff and IKe, the Pf3 origin of v i r a l strand r e p l i c a t i o n encodes r e p l i c a t i o n i n i t i a t i o n as well as termination functions. Although the nucleotide sequence of the Pf3 v i r a l strand r e p l i c a t i o n origin i s not homologous at a l l with that of the phages Ff or IKe, a feature shared by a l l these origins i s the presence of inverted repeat sequences. This s t r u c t u r a l element is thought to function as a recognition and attachment signal for DNA r e p l i c a t i o n p r o t e i n s . From the fact that the functional analyses of the deletion mutants could be performed in E.coli i t follows that Pf3 i s able to r e p l i c a t e in t h i s host as well. In chapter 5 studies with respect to the mechanism of expression of part of the Pf3 genome _in vivo in infected P. aeruginosa and both _ln vivo and in v i t r o in E.coll are described. Within the domain encoding the single-stranded DNA binding protein and major coat protein two Pf3 s p e c i f i c messenger RNAs have been mapped. Transcription of one of the mRNAs i s i n i t i a t e d 301 basepairs upstream of the single-stranded DNA-binding protein gene, whereas synthesis of the other mRNA i s i n i t i a t e d 122 basepairs upstream of the major coat protein gene. terminated at an i d e n t i c a l position, i . e . major coat protein gene. The synthesis of both mRNAs i s 60 basepairs downstream of the Despite the fact that only one Pf3 promoter showed homology with the E.coli consensus promoter sequence, both t r a n s c r i p t i o n i n i t i a t i o n s i t e s were shown to be recognized in an _in vivo and an _in v i t r o E.coli t r a n s c r i p t i o n system. Also the Pf3 t r a n s c r i p t i o n termination signal was recognized e f f i c i e n t l y in these heterologous systems. These r e s u l t s demonstrate that differences in t r a n s c r i p t i o n of genes shuttled from 123 Pseudomonas t o E.coli or vice versa, are not the r e s u l t of differences in promoter sequences or t r a n s c r i p t i o n factors l i k e RNA polymerase, but more probably r e f l e c t differences in gene regulatory mechanisms exploited by these two h o s t s . Summarizing i t can be s t a t e d that not many evolutionary p a r a l l e l s have been detected between the filamentous bacteriophage Pf3 and the evolutionary r e l a t e d phages Ff and IKe. Although there i s some s i m i l a r i t y in genetic organization, a direct comparison of e i t h e r t h e i r nucleotide sequences or the amino acid sequences of t h e i r encoded proteins did not give clues as to the evolutionary r e l a t i o n s h i p between Pf3 and the E.coll specific phages. Therefore the hypothesis that filamentous bacteriophages have originated and evolved fron the same ancestor i s not supported by the experimental data presented. I t might therefore well be that Pf3 has evolved from another ancestor than the phages Ff or IKe. In t h i s connection i t i s appealing t o r e c a l l the s t r u c t u r a l and functional s i m i l a r i t i e s between filamentous bacteriophages, conjugative Plasmids, and t h e i r encoded p i l i . The fact that conjugative plasmids not only carry the genetic information for the different constituents of the p i l u s , but also for the proteins and DNA signals involved in the r e p l i c a t i o n and t r a n s f e r of single-stranded DNA to the acceptor c e l l , has firmly been established. Reversing the hypothesis of Brinton that conjugative plasmids are a specialized c e l l associated form of bacteriophage, leads to a new hypothesis that t h a t different (subclasses of) filamentous viruses have evolved from different conjugative plasmids. Future research of conjugative plasmids and filamentous bacteriophages may shed l i g h t on the v a l i d i t y of these hypotheses. 124 SAMENVATTING Pf3 i s een bakterieel virus (bakteriofaag of faag) welke Pseudomonas aeruginosa bakterien i n f e k t e e r t . Samen met een aantal gelijkvormige bakteriofagen behoort Pf3 t o t de klasse van filamenteuze fagen ( I n o v i r i d a e ) , d.w.z. virussen met een draadvormig u i t e r l i j k . Het Pf3 v i r u s d e e l t j e i s een f l e x i b e l e buis met een diameter van 6 nm en een lengte van ongeveer 700 nm. De buis bestaat voornamelijk uit een groot aantal identieke eiwitmolekulen, de zogenaamde (hoofd-)manteleiwitten, die een c i r c u l a i r enkelstrengs DNA molekuul, het v i r a l e genoom of chromosoom, omsluiten. Waarschijnlijk bevat het virusdeeltje nog enkele molekulen van een aantal andere eiwitten, maar s l e c h t s één hiervan i s t o t nog toe ondubbelzinnig aangetoond. Om diverse redenen i s Pf3 het onderwerp van de in d i t proefschrift beschreven molekulair genetische studie geworden. Allereerst was er de vraag of Pf3, een P.aeruginosa v i r u s , evolutionair verwant was aan de goed bestudeerde Escherichia c o l i fagen Ff (M13, fi en fd) en IKe. Deze l a a t s t e virussen zijn eveneens filamenteus van vorm, en hebben eenzelfde levenscyclus als Pf3: opmerkelijk aan deze levenscyclus i s dat de bakteriecel als gevolg van de i n f e k t i e n i e t wordt gedood. De door een filamenteuze faag geinfekteerde bakterie b l i j f t groeien en delen, zij het minder snel dan een niet geinfekteerde c e l . Intakte virusdeeltjes komen binnen de cel niet voor. De reden hiervan i s dat de assemblage van nakomeling virussen plaatsvindt aan de celmembraan. G e l i j k t i j d i g met deze assemblage wordt het faagdeeltje door de celmembraan en -wand heen de cel uit getransporteerd. Deze voor a l l e filamenteuze overeenkomstige levenscyclus suggereert dat al deze virussen aan elkaar verwant z i j n , en mogelijk afstammen van een gemeenschappelijke voorouder. De beste manier om deze verwantschap t e bestuderen i s door de basenvolgorde van de r e s p e k t i e v e l i j k e v i r a l e genomen met elkaar t e vergelijken. Vooral op d i t nivo, of via funktionele of sekwentie overeenkomsten in de door deze genomen gekodeerde eiwitten, kan een eventuele evolutionaire r e l a t i e goed worden vastgesteld. Een aldus opgezette vergelijkende studie tussen de bakteriofagen Ff en IKe heeft aangetoond dat deze twee virussen inderdaad evolutionair verwant z i j n . Uit onderzoek van Pf3 127 zou nu kunnen blijken of ook een filamenteus v i r u s , specifiek voor een geheel andere soort b a k t e r i e , t o t dezelfde genetische familie behoort. Een tweede belangrijke reden voor de keuze van Pf3 als onderzoeksobjekt was het f e i t dat Pf3 a l s gastheer P.aeruginosa heeft. Het afgelopen decennium zijn bakterien uit het geslacht Pseudomonas s t e r k in de belangstelling komen t e s t a a n . Reden hiervoor i s vooral het f e i t dat deze groep bakterien in s t a a t i s vele door de mens in de natuur gebrachte chemicaliën, zoals bijvoorbeeld tolueen en naftaleen, af te breken. Onderzoek heeft aangetoond dat de genen welke voor de bij de afbraak van voornoemde chemicaliën betrokken enzymen köderen, n i e t zonder meer in E.coli tot expressie kunnen worden gebracht. Deze gegevens suggereren dat de mechanismen van genexpressie in E.coll en Pseudomonas sterk van elkaar v e r s c h i l l e n . Onderzoek naar de genexpressie van Pf3 kan nu u i t s l u i t s e l geven over de aard van dit v e r s c h i l : zijn er fundamentele verschillen tussen de expressiesignalen, en dus ook tussen de enzymen die voor de expressie verantwoordelijk zijn (b.v. RNA polymerase), of i s het verschil in expressie terug t e voeren t o t verschillen in genregulatiemechanismen? In de afzonderlijke hoofdstukken zijn de r e s u l t a t e n beschreven van s t u d i e s , die bovengenoemde vragen pogen te beantwoorden. In hoofdstuk 1 wordt de k a r a k t e r i s e r i n g beschreven van het gen dat voor het b e l a n g r i j k s t e mantel eiwit van Pf3 kodeert. Tevens wordt ingegaan op enkele eigenschappen van het door d i t gen gekodeerde e i w i t . Het primaire t r a n s l a t i e p r o d u k t van het manteleiwitgen i s ΊΊ aminozuren lang en volkomen identiek met het eiwit dat in het Pf3 v i r u s d e e l t j e voorkomt. De struktuur van dit gen, en dus ook van het primaire t r a n s l a t i e p r o d u k t , wijkt daarmee duidelijk af van de struktuur van de overeenkomstige genen van een v i e r t a l andere filamenteuze bakteriofagen, t e weten Ff, IKe, I f 1 , en Pf 1. Het manteleiwitgen van deze fagen kodeert voor een zogenaamd precursor e i w i t . In deze precursor wordt het " r i j p e " manteleiwit, i . e . het eiwit zoals dat in het v i r u s d e e l t j e wordt aangetroffen, voorafgegaan door een twintig t o t d e r t i g aminozuren lange signaalsekwentie. Dit signaalpeptide i s ervoor verantwoordelijk dat het manteleiwit tijdens (of na) de synthese in de celmembraan terechtkomt. Na membraaninsertie van het precursore!wit wordt het signaalpeptide a f g e s p l i t s t . Het f e i t dat het Pf3 manteleiwitgen niet voor een dergelijk signaalpeptide kodeert zou kunnen betekenen dat het manteleiwit niet in de membraan geinserteerd wordt. Echter, de duidelijke overeenkomsten in de 128 verdeling van hydrofobe aminozuur residuen in het Pf3 manteleiwit en de r i j p e mantel eiwitten van de andere genoemde filamenteuze bakteri ofagen, én het f e i t dat de assemblage en extrusie van filamenteuze fagen nauw geassocieerd zijn met de bakteriele celmembraan, wijzen er s t e r k op dat het Pf3 manteleiwit na synthese toch in de membraan wordt geinserteerd. De i n s e r t i e in de membraan kan, omdat het eiwit slechts 44 aminozuren lang i s , echter pas plaatsvinden nadat het komplete eiwit van het ribosoom i s vrijgekomen (postt r a n s l a t i o n e e l ) , d i t in t e g e n s t e l l i n g t o t de membraaninsertie van de manteleiwitten van de andere filamenteuze fagen, die waarschijnlijk al tijdens de synthese via het signaal peptide aan de membraan worden verankerd (cotranslationeel). In hoofdstuk 2 wordt de volledige nukleotidesekwentie van het genoom van Pf3 beschreven, zoals deze door twee onderzoeksgroepen onafhankelijk van elkaar i s bepaald. Het c i r c u l a i r e Pf3 genoom bestaat u i t 5833 nukleotiden. Twee genen van dit genoctn zijn ondubbelzinnig g e ï d e n t i f i c e e r d , t e weten het manteleiwitgen (beschreven in hoofdstuk 1), en een gen dat kodeert voor een enkelstrengs DNA bindend eiwit. Deze genen, noch enig ander gen van het Pf3 genoom vertonen een s i g n i f i k a n t e homologie met de genomische DNA sekwenties van de bakteriofagen Ff en IKe. De ligging van deze twee genen ten opzichte van elkaar, en de volgorde en grootte van zeven andere open leesramen l i j k e n echter wel s t e r k op de genorganisatie van Ff en IKe. Deze overeenkomst i s echter t e beperkt om op basis hiervan funkties t e kunnen postuleren voor de door de open leesramen gekodeerde Pf3 eiwitten. In hoofdstuk 3 worden de ontdekking en k a r a k t e r i s e r i n g van spontane deletiemutanten van Pf3 (minifagen) beschreven. Deze minifagen bevatten een c i r c u l a i r enkelstrengs DNA molekuul dat t o t 80% kleiner i s dan het wildtype Pf3 genoom. Het assembleren van een dergelijk klein DNA molekuul t o t een "faag" heeft t o t gevolg dat het virusdeeltje evenredig korter wordt, vandaar de naam minifaag. De genomen van drie verschillende minifagen zijn gedetailleerd onderzocht: u i t nukleotidesekwentie-analyses i s gebleken dat de minifaag DNA's zijn ontstaan via d e l e t i e s ( v e r l i e s ) van grote DNA fragmenten u i t het wildtype Pf3 genoom. Het f e i t dat het verloren gegane DNA segment, en dus ook het u i t e i n d e l i j k e minifaag genoom, oorspronkelijk aan beide zijden geflankeerd werd door korte identieke sekwenties, suggereert dat de verschillende minifaag-genomen volgens eenzelfde mechanisme zijn ontstaan. Deze korte sekwentie werd in het minifaag-genoom slechts éénmaal teruggevonden op de plaats waar de uiteinden van het behouden DNA fragment gefuseerd zijn. 129 Eén minifaag-genoom bevatte bovendien een tandem gedupliceerd DNA fragment, en u i t de sekwentie-analyse kon worden afgeleid dat de duplikatie na het deletieproces moet zijn opgetreden. Het f e i t dat ook d i t fragment oorspronkelijk door identieke sekwenties werd geflankeerd, maar dat deze sekwentie s l e c h t s éénmaal werd teruggevonden op de l a s van de twee DNA kopieën, doet vermoeden dat d e l e t i e en duplikatie volgens eenzelfde mechanisme zijn verlopen. Het mechanisme dat mogelijk aan deze processen ten grondslag l i g t i s "slipped mispairing", d.w.z. een verschuiven (slippen) van het 3 ' uiteinde van de groeiende DNA streng naar komplementaire sekwenties op de DNA m a t r i j s . Een dergelijke verschuiving zou bijvoorbeeld kunnen optreden tijdens de omzetting van de (enkelstrengs) v i r a l e DNA streng in de dubbelstrengs r e p l i k a t i e v e vorm. Het "slipped mispairing" mechanisme i s mogelijk ook verantwoordelijk voor de waargenomen s t r u k t u r e l e i n s t a b i l i t e i t van vele Bacillus en Streptomyces Plasmiden, waarvan onlangs i s aangetoond dat ze via enkelstrengs i n t erme di airen r e p l i c e r e n . Omdat Pf3 minifagen het vermogen tot expressie van eiwitten verloren hebben, zijn ze zowel voor hun r e p l i k a t i e als voor hun assemblage afhankelijk van een wildtype (helper) Pf3 faag-genoom in dezelfde gastheercel. Het f e i t echter dat minifaag DNA's e f f i c i e n t worden gerepliceerd en vervolgens geassembleerd t o t , weliswaar verkorte, v i r u s d e e l t j e s toont aan dat het DNA segment, dat de drie minifaag-genomen gemeenschappelijk hebben, a l l e cis-werkende r e p l i k a t i e ( v i r a l e en komplementaire streng o r i g i n s ) , en assemblage signalen bevat. In hoofdstuk k zijn s t u d i e s met als doel een nadere l o k a l i s e r i n g van de origin van v i r a l e streng synthese beschreven. Uitgaande van één minifaaggenoom kon door middel van _in v i t r o deletievorming het gebied dat een funktionele o r i g i n voor de v i r a l e streng synthese bevat t o t 139 baseparen worden gereduceerd. Deze origin bleek, evenals de origins van de E.coli fagen Ff en IKe, de signalen, welke verantwoordelijk z i j n voor zowel de i n i t i a t i e als terminerlng van de v i r a l e streng synthese, te bevatten. Hoewel er geen enkele aanwijzing werd gevonden voor nukleotidesekwentie homologie tussen de v i r a l e streng origins van Pf3, Ff en IKe, werd er wel enige s t r u k t u r e l e overeenkomst tussen deze origins gevonden in de vorm van de aanwezigheid van inverted r e p e a t s . Een dergelijk struktuurelement wordt verondersteld t e fungeren a l s herkennings- en aanhechtingsplaats van r e p l i k a t i e - e i w i t ( t e n ) . Uit het f e i t dat de funktionele analyse van de deletiemutanten in E.coli kon worden uitgevoerd volgt bovendien dat Pf3 in s t a a t i s om ook in deze gastheer te repliceren. 130 In hoofdstuk 5 wordt de expressie van een gedeelte van het Pf3 genoom in vivo in P.aeruginosa en in vivo en in v i t r o in E.coli beschreven. Het gebied dat zowel voor het Pf3 enkelstrengs DNA bindend eiwit als het hoofdmanteleiwit kodeert, wordt middels twee boodschapper RNA's (mRNA's) t o t expressie gebracht. De i n i t i a t i e p l a a t s e n voor deze mRNA's zijn 301 baseparen vóór het gen voor het enkelstrengs DNA bindend e i w i t , r e s p e k t i e v e l i j k 122 baseparen vóór het mantel eiwitgen gelegen. De synthese van deze mRNA's wordt op eenzelfde p o s i t i e , t e weten 60 baseparen na het manteleiwitgen, getermineerd. Ondanks het f e i t dat de nukleotide-sekwentie van slechts één van de twee t r a n s k r i p t i e - i n i t i a t i e p l a a t s e n homologie met de consensus sekwentie van E.coli promoters vertoonde, bleek E.coli RNA polymerase, zowel in vivo a l s _in v i t r o , toch beide plaatsen a l s promoter t e kunnen herkennen. Ook het Pf3 t r a n s k r i p t i e - t e r m i n e r i n g s signaal bleek in E.coli als zodanig t e worden herkend. De r e s u l t a t e n tonen aan dat de verschillen in genexpressie tussen E.coli en P.aeruginosa niet het gevolg zijn van verschillen in s e k w e n t i e s p e c i f i c i t e i t van RNA polymerase, maar eerder gezocht moet worden in verschillen in genregulatie mechanismen. Samenvattend kan gesteld worden dat er weinig evolutionaire overeenkomsten zijn gevonden tussen de filamenteuze bakteriofaag Pf3 en de onderling verwante fagen Ff en IKe. Hoewel de genetische o r g a n i s a t i e s van deze organismen een zekere gelijkenis vertonen, geven direkte vergelijkingen van hun nukleotidesekwenties en van de daarvan afgeleide aminozuursekwenties geen enkele aanwijzing voor een evolutionaire verwantschap tussen Pf3 en de E.coli specifieke fagen Ff en IKe. De hypothese dat filamenteuze bakteriofagen uit een gemeenschappelijke voorouder zijn geëvolueerd wordt door de in d i t proefschrift neergelegde experimentele gegevens dus niet ondersteund. Het b l i j f t daarom zeer wel mogelijk dat Pf3 vanuit een andere voorouder dan de fagen Ff en IKe i s ontstaan. In dit verband i s het interessant t e wijzen op de s t r u k t u r e l e en funktionele overeenkomsten tussen filamenteuze fagen en de p i l i , welke door konjugatieve Plasmiden worden gekodeerd. Konjugatieve Plasmiden bevatten n i e t alleen de genetische informatie voor de struktuurel ementen van de p i l u s , maar ook voor de eiwitten welke bij de synthese en overdracht van enkelstrengs Plasmide DNA naar de akseptor cel zijn betrokken. 131 Omkering van de hypothese van Brinton, dat konjugatieve Plasmiden een bijzondere celgebonden vorm van (filamenteuze) bakteriofagen z i j n , l e i d t t o t de nieuwe hypothese dat verschillende (klassen van) filamenteuze fagen ontstaan zijn uit verschillende konjugatieve Plasmiden. Toekomstig onderzoek van konjugatieve Plasmiden en filamenteuze bakteriofagen kan de j u i s t h e i d van (één van deze) hypotheses mogelijk aantonen. 132 CURRICULUM VITAE De schrijver Kerkrade. van d i t proefschrift werd op 3 december 1954 geboren i n Na het behalen van het diploma gymnasium β aan het gymnasium "Rolduc" in 1973i begon h i j in datzelfde J a a r met de s t u d i e Biologie aan de Katholieke U n i v e r s i t e i t t e Nijmegen. examen Biologie B4 afgelegd. In september 1977 werd het kandidaats Gedurende de doktoraalfase werden de hoofdvakken Organische Chemie (Prof. d r . B. Zwanenburg) en Molekulaire Biologie (Prof. d r . J.G.G. Schoenmakers), en het bijvak Biochemie (Prof. dr. H. Bloemendal) bewerkt. De s t u d i e werd afgesloten met het behalen van de doktoraal-examens Biologie (september 1981), en Chemie (oktober 1981). Van 1 oktober 1981 t o t en met 30 a p r i l 1986 was hij a l s wetenschappelijk medewerker verbonden aan de Katholieke U n i v e r s i t e i t Nijmegen, gedurende welke periode hij aan het Laboratorium voor Molekulaire Biologie het in d i t proefschrift beschreven onderzoek heeft v e r r i c h t . Sedert 1 mei 1986 i s h i j a l s molekulair bioloog werkzaam op de afdeling Bakteriele Genetika van Gist-brocades n.v. t e Delft. 133 STELLINGEN 1. Michel en Ehrlich zijn er ondanks uiterst gekompliceerde beschrijvingen toch in geslaagd om een beeld te schetsen van de faktoren die voor Plasmide instabiliteit verantwoordelijk zijn. B. Michel, and S.D. Ehrlich. 1986. Proc. Natl. Acad. Sci. USA З, 3386-3390 EMBO J. 5, 3691-3696 2. Hashed en Oberer benadrukken weliswaar de belangrijke rol die de pllus blj Infektie van filamenteuze fagen vervult, maar wijzen parallelen in het assemblage mechanisme van pilus en faag ten onrechte af als niet signifikant. I. Hashed, and E. Oberer. 1986. Microbiol. Rev. 50, 101-427 3. del Solar et al. stellen In hun argumentatie ten onrechte dat de komplementalre streng synthese van ФХІУІ en M13 op dezelfde wijze wordt geïnitieerd, en dat deze voor beide fagen niet In polA cellen kan plaatsvinden. G.H. del Solar, A.Puyet, and M. Espinosa. 1987. Nucí. Acids Res. 1_5, 5561-5580 1. De ontdekking van lineaire reuze-plasmiden in een aantal Streptomyceten doet de grens tussen Plasmide en chromosoom in dit bakteriele genus vervagen. M. Kinashi, M. Shlmaji, and A. Sakai. 1987. Nature 328, И5Ч-Ч56 5. Homologie tussen oellulase sekwenties en het aktleve centrum van lysozym wordt meer ondersteund door een verondersteld overeenkomstig katalyse-mechanisme dan door een onbevooroordeelde komputeranalyse. M.C. Paice, M. Desrochers, D. Rho, L. Jurasek, С Roy, C.F. Rollln, E. deMiguel, and M. Yaguchi. 1984. Blo/Technology 2, 535-539 T.T. Teeri, P. Lehtovaara, S. Kauppinen, I. Salovuori, and J. Knowles. 1987. Gene 5J_, ^3-52 6. In tegenstelling tot Escherichia coll is positieve regulatie van de genexpressie bij Pseudomonas eerder regel dan uitzondering. 7. De genetische stabiliteit van een mlkroörganisme lijkt omgekeerd evenredig te zijn met zijn Industrieel belang. 8. Dat met Veronica "de televisie eindelijk volwassen is geworden" blijkt niet uit de door deze omroeporganisatie uitgezonden programma's. 9. Gelet op het gemak waarmee momenteel transgene planten en dieren kunnen worden gekonstrueerd lijkt het aannemelijk dat de "biotechnologie" spoedig weer terug is op de boerderij. 10. Een consensus/concensus over de schrijfwijze van dit woord kan gemakkelijk bereikt worden door er een woordenboek op na te slaan.