Download Purification, characterization, assembly and crystallization of

Journal of General Virology (1996), 77, 567-573.
567
Printed in Great Britain
Purification, characterization, assembly and crystallization of assembled
alfalfa mosaic virus coat protein expressed in Escherichia coli
Vidadi Yusibov, 1 Abhinav Kumar,2~ Adam North, ~ John E. Johnson2t and L. Sue Loesch-Fries ~*
1 DEpartment o f Botany and Plant Pathology and 2 Department of Biological Sciences, Purdue University,
West Lafayette, I N 47907, USA
The coat protein of alfalfa mosaic virus (AMV) was
cloned and expressed in Escherichia coil as a fusion
protein containing a 37 amino acid extension with a
(His)6 region for affinity purification. About half of the
expressed recombinant coat protein (rCP) was soluble
upon extraction and half was insoluble in inclusion
bodies. Western blot analysis confirmed the identity of
the rCP and protoplast infectivity assays indicated that
the rCP was biologically active in an early event of AMV
infection, called genome activation. The rCP assembled
into T = 1 empty icosahedral particles, as described
previously for native coat protein. Empty particles
formed hexagonal crystals that diffracted X-rays to 5"5 A
resolution. The crystals of trypsin-treated particles of
rCP appear to be isomorphous with crystals of trypsintreated particles of native coat protein. Spherical
particles containing RNA assembled when the rCP was
combined with in vitro transcripts of AMV RNA4, the
smallest naturally encapsidated AMV RNA. Bacilliform
particles that resembled native virions assembled when
the rCP was combined with transcripts of RNA1, the
largest genomic RNA.
Introduction
The C terminus is required for virion assembly (Van der
Kuyl et al., 1991 a; Van der Vossen et al., 1994). Thus,
regions of the CP involved in different functions may be
mutated separately. However, mutations in regions
involved in early functions, such as genome activation,
which affects replication, will also affect later functions,
such as assembly. Therefore, to study the effects of CP
mutations on assembly and structure, we adapted an in
vitro assembly system described by Fukuyama et aL
(1981) for use with AMV CP expressed in Escherichia
coll. Thus, AMV assembly can be uncoupled from
replication.
AMV particles are bacilliform which is unique among
plant viruses. There is evidence that some viruses in the
related ilarvirus genus may have bacilliform particles
(Halk, 1981); however, these virus particles do not
appear to be as stable as those of AMV. RNA-protein
interactions primarily stabilize AMV particles. If the N
terminus of CP in particles is removed by mild trypsin
treatment, the particles lose their bacilliform shape and
became spherical (Bol et al., 1974). If the particles are
completely disrupted by salt, reassociation of the
bacilliform particles is not possible in vitro (Hull, 1970).
This is in contrast to the reversible disassociation of
viruses, such as cowpea chlorotic mottle virus, which will
reassociate in vitro (Bancroft & Hiebert, 1967; Zhao et
al., 1995). In the absence of RNA, AMV CP dimers selfassociate to form empty T = 1 icosahedral particles,
which have been crystallized and analysed by X-ray
The coat proteins (CPs) of many plant viruses are
multifunctional and required throughout infection, in
addition to being required for particle assembly. For
example, the CP of some viruses is directly or indirectly
involved in the accumulation of viral plus-strand R N A
(Marsh et al., 1991 ; Van der Kuyl et al., 1991 b; Chapman
et al., 1992; Van der Vossen et at., 1994; De Graaff et al.,
1995). Many CPs are also required for the virus infection
to spread from cell-to-cell (Van der Kuyl et al., 1991 a;
Van der Vossen et al., 1994; Dolja et al., 1994; Chapman
et al., 1992) and/or for systemic spread throughout the
plant (Sacher & Ahlquist, 1989; Allison et al., 1990;
Dolja et al., 1994). The CP of alfalfa mosaic virus (AMV)
is involved in all of these functions, as well as being
required at the start of infection (Bol et al., 1971 ; Quadt
et al., 1991). Mutational analysis of AMV CP has
suggested that separate regions of the protein are
important for different functions (Van der Vossen et al.,
1994). For example, the N terminus of the CP is involved
in an early event of infection, called genome activation,
which requires binding of the N terminus to the 3'
untranslated region of AMV RNAs (Baer et al., 1994).
* Author for correspondence. Fax + 1 317 494 5896.
e-mail loeschfries @ btny.purd ue.edu
~" Present address: Department of Molecular Biology, The Scripps
Research Institute, La Jolla, CA 92037, USA.
0001-3632© 1996 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
568
V. Yusibov and others
diffraction (Fukuyama et al., 1983). In the presence of
various RNA or DNA molecules, the CP aggregates into
spherical or ovoid particles or into tubular particles with
lengths characteristic of the nucleic acid (Hull, 1970;
Driedonks et al., 1977, 1978).
In this paper we describe the assembly of icosahedrat
T = 1 particles by recombinant AMV CP expressed in E.
colt. Particles containing RNA4, the subgenomic messenger for CP, or RNA1, the largest genomic RNA,
assembled when RNA transcripts were included in the in
vitro assembly reaction.
Methods
Cloning of the A M V CP gene for expression in E. colt. The CP gene
was cloned by PCR using the previously described first strand primer,
5' GGGGATTCCCTACGGGCCCAG 3', (Loesch-Fries et aL, 1985)
and second strand primer° 5' TCGAGATCTGCAGTCATGAGTTCTTC 3' with pSP65A4 as the template (Loesch-Fries et al., 1985) so that
a PstI restriction site (indicated by double underlining) was placed just
upstream of the CP ATG codon (indicated by single underlining). The
PCR product containing the CP gene was cloned into the pGEM-T
vector (Promega). A PstI fragment, containing the CP ORF and the Y
untranslated region from RNA4 eDNA, was ligated into the pTrcHisB
plasmid (Invitrogen), which had been linearized by digestion with PstI
to create pTHB-CP (Fig. 1). The recombinant coat protein (rCP)
produced from this plasmid contained 37 non-viral amino acids at the
N terminus, including a (His)n region for attachment to a Ni 2+ resin for
purification.
Expression and purification o f A M V recombinant CP. For expression
of rCP, a single transformed bacterial colony (Topl0, Invitrogen) was
grown overnight in SOB medium (2 % tryptone, 0.5 % yeast extract,
0"05 % NaC1, 2.5 mM-KC1, 10 mM-MgCI~) (Sambrook et al., 1989). The
cells were then diluted 1:100 in SOB medium containing 75 ~tg/ml
ampicillin and grown for 3-4 h at 24 °C with vigorous shaking to an
OD~00 of 0-3. Protein expression was induced by adding IPTG to a final
concentration of 1 mM and incubation was continued for 4 h at 24 °C.
The cells were collected by centrifugation, resuspended at 1 : 5 (w/v) in
native binding buffer (NBB) containing 0.5 M-NaC1, 20 mM-Na~HPOa,
3 gg/ml lysozyme pH 7-8, and lysed in a French Press. The lysate was
incubated for 15 rain on ice with RNase and DNase, then centrifuged
at 15000g at 4°C for 15 min. The soluble rCP was purified by binding
to a Ni ~+ resin (Invitrogen). The resin was mixed with the supernatant
containing the rCP, gently stirred for 10-t5 rain at 4 °C, collected by
centrifugation at 600 g for 2 min, and washed with NBB five times each
at pH values of 7-8, 7,5, 7-0, 6-5, 6-0 and 5.5 at 4 °C to remove host
proteins. Finally, the rCP was eluted from the resin by washing with
NBB containing 350mM-imidazole at pH 6.0, The protein was
concentrated to 12-13 mg/ml using a Centricon-10 (Amicon) according
Pstl
~
PsU
AT. (Hi.)., EK I AMVcP
~
Fig. 1. Diagrammatic representation of plasmid pTHB-CP. Ptrc is a
hybrid promoter for transcription initiation in E. colt; ATG is the
translation initiation site for the fusion protein; (His), is a polyhistidine
region, which has high affinity for Ni 2+ resin; EK is an enterokinase
cleavage site; AMV CP is the alfalfa mosaic virus coat protein gene;
term is the transcription termination sequence from the E. colt rrnB
gene.
to the manufacturer's instructions. The purified protein was analysed
by polyacrylamide gel electrophoresis (Laemmli, 1970) and Western
blot analysis using a mixture of two monoclonal antibodies to AMV
CP (Halk, 1986; Loesch-Fries et al., 1987).
Preparation, inoculation and immunoassays of protoplasts. Protoplasts
were isolated from axenic tobacco plants (Nicotiana tabaeum var.
Xanthi-nc) and inoculated with AMV genomic RNAs (RNA1, 2, 3)
alone or in combination with AMV rCP or native CP (isolated
according to Kruseman et aL, 1971) using a polyethylene glycol method
(Loesch-Fries et al., 1985; Samac et aL, 1983). The protoplasts were
collected 24 h after inoculation and assayed by immunofluorescence
using polyclonal antibodies to AMV CP to determine the percentage
infected (Loesch-Fries & Hall, 1980). The immunofluorescence assay
detected only infected protoplasts in which AMV CP had accumulated
during infection. The sensitivity of the assay was below that required to
detect rCP from the inoculum.
Transcription and isolation of virus RNA. Capped transcripts of
RNA4 (898 nt) were synthesized from pSP65A4 templates using SP6
polymerase (Epicenter) as described (Loesch-Fries et aL, 1985). An
aliquot of the transcription reaction was used for the inoculation of
protoplasts without purification of the transcripts. Capped transcripts
of RNA1 (3643 nt) were synthesized using T7 polymerase and a fulllength eDNA of RNA1. A mixture of AMV genomic RNAs 1, 2 and
3 was isolated from native virions as previously described (LoeschFries et al., 1985).
Assembly of" empty particles and encapsidation of A M V RNA with
rCP. Empty particles were assembled by dialysis of rCP at 4 °C against
(1) 20 raM-sodium pyrophosphate, pH 5.5, (2) 20 raM-sodium pyrophosphate, pH 7.0 and (3) 50 raM-sodium pyrophosphate, pH 7.0, as
described by Fukuyama et al. (1981), except the length of dialysis was
extended to 2 days at each step.
Encapsidation of AMV RNA4 transcripts by rCP was accomplished
by extensive dialysis of a suspension of rCP and transcripts at a ratio
of 450 rCP: 1 RNA (w/w) in NBB at 4 °C against (1) 20 mM-sodium
pyrophosphate, pH 5,5 for 2 days, (2) 20 raM-sodium pyrophosphate,
pH 6.0 for 2 days and (3) 50 mM-sodium pyrophosphate, pH 6.0 for 2
days. To form particles containing AMV RNA1 transcripts, a mixture
ofrCP and RNA1 transcripts at a ratio of 156 rCP: 1 RNA (w/w) was
dialysed against 50, 75 or 100 mM*NaCl or sodium pyrophosphate,
pH 6 or 6-5 for 15 h at 4 °C.
Electron microscopy. Assembled particles were deposited on carboncoated grids, negatively stained with 2 % uranyl acetate, and air dried.
The particles were examined in a Philips EM 400 electron microscope.
Crystallization o f particles. Empty particles of rCP were treated with
trypsin at a molar ratio of 1 : 10000 (trypsin:rCP) at 24 °C for 1~15 h
prior to crystallization according to Fukuyama et aL (1981). Mild
trypsin treatment removes the amino acid extension and 26 N-terminal
viral amino acids from rCP (Bol et aL, 1974). Empty particles and
RNA4-containing particles, which were not treated with trypsin, were
crystallized by dialysis of a 50 lal suspension at 12-13 mg rCP/ml
against 50 ml 0"2 M-citrate buffer, pH 4.6 at 24 °C as described by
Fukuyama et aL (1981). To analyse the RNA in RNA4-containing
particles, crystals of these particles were washed with 0.2 M-citrate
buffer, pH 4.6, disrupted with 10mM-Tris-HC1 buffer pH 7-0 containing 1 mM-EDTA, 1% SDS and 2M-urea, and analysed by
electrophoresis in a 1% agarose gel followed by staining with ethidium
bromide.
X-ray analysis of crystals. Diffraction data were collected from the
crystals of empty icosahedral particles assembled from rCP using
synchrotron radiation at the A-1 station, Cornell High Energy
Synchrotron Source (2 = 0.9144 A). Experimental conditions included
0.3 ° oscillation angle and 150 mm crystal to detector distance with 60 s
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
Assembly o f alfalfa mosaic virus coat protein
exposure time at room temperature. Diffraction images were processed
using the DENZO program (Otwinowski, 1993).
Results
569
f r a g m e n t e d m o l e c u l e s due to p r o t e o l y s i s d u r i n g i s o l a t i o n
as s h o w n b y the lower m o l e c u l a r m a s s b a n d s in Fig. 2,
lane 2. Purified rCP, in c o n t r a s t , c o n t a i n e d little d e g r a d e d
p r o t e i n (Fig. 2, lanes 3 a n d 6).
Purification and characterization o f rCP
T h e soluble f r a c t i o n o f r C P was purified f r o m lysed
b a c t e r i a for use in the e x p e r i m e n t s d e s c r i b e d below. T h e
soluble f r a c t i o n was a b o u t h a l f o f the t o t a l r C P in
i n d u c e d E. coli expressing p T H B - C P (Fig. 1). T h e rest o f
the r C P was insoluble a n d in inclusion b o d i e s ( d a t a n o t
shown). U p o n purification, the yield was a p p r o x i m a t e l y
4 m g soluble r C P per litre o f cell culture o f i n d u c e d E.
coll. Fig. 2 shows t h a t the r C P m i g r a t e d as e x p e c t e d for
an A M V C P fusion p r o t e i n o f 29 k D a c o n t a i n i n g a 37
a m i n o a c i d extension at the N terminus, r C P was
r e c o g n i z e d b y m o n o c l o n a l a n t i b o d i e s to A M V C P (Fig.
2, lanes 5 a n d 6). P r e p a r a t i o n s o f native C P c o n t a i n e d
kDa
1
2
3
!~
....~,,.
4
~
43-
~
:
.
.
.
~
Fig. 2. Analysis of AMV rCP expressed in E. coil
by gel electrophoresis and Western blotting.
Proteins were separated by electrophoresis in a
13% SDS-polyacrylamide gel and stained with
Coomassie brilliant blue R250 (lanes 1-3) or
electroblotted to a nylon membrane and incubated with monoclonal antibodies to AMV CP
followed by detection with anti-mouse IgG alkaline phosphatase conjugate (lanes 4-6). Lane 1,
marker proteins; lane 2, native AMV CP; lanes 3
and 6, purified rCP; lane 4, total proteins from
uninduced E. coli containing pTHB-CP; lane 5,
total proteins from induced E. coil expressing
pTHB-CP. The molecular masses of the marker
proteins are indicated.
5
"
~
t
T h e g e n o m i c R N A s o f A M V require the presence o f
A M V C P to infect p l a n t s o r p r o t o p l a s t s (Bol et al., 1971).
T o d e t e r m i n e w h e t h e r the r C P expressed in E. coli was
b i o l o g i c a l l y active, t o b a c c o p r o t o p l a s t s were i n o c u l a t e d
with A M V g e n o m i c R N A s ( R N A 1 , 2, 3) a n d rCP.
P r e p a r a t i o n s o f soluble p r o t e i n s f r o m u n i n d u c e d o r
i n d u c e d E. coli c o n t a i n i n g p T H B - C P a n d a p r e p a r a t i o n
o f purified r C P were each assayed. T a b l e 1 shows t h a t the
A M V g e n o m i c R N A p r e p a r a t i o n was n o t infectious
w i t h o u t the a d d i t i o n o f native C P o r R N A 4 , which
encodes the CP. A d d i t i o n o f r C P to the i n o c u l u m also
ii!
lOO ......
71 t
Biological activity o f rCP
~i~:
rCP
CP
15~
T a b l e 1. Activity o f A M V rCP in genome activation
Percentage infectiont
Inoculum*
RNA1, 2, 3
RNA1, 2, 3
+ uninduced soluble protein preparation
from E. coil containing pTHB-CP
RNA1, 2, 3
+induced soluble protein preparation
from E. coli expressing pTHB-CP
RNAI, 2, 3
+ rCP
RNA1, 2, 3
+CP
RNA1, 2, 3
+ RNA4
Experiment 1;~
Experiment 2
0
0
NT
0
10
12
25
NT
NT
33
50
46
* Inoculum for 10~ protoplasts contained RNAt, 2, 3 preparation (0-5 ~tg) alone or in
combination with transcripts of RNA4 (3 lag), or preparations of total soluble proteins from
induced or uninduced E. coli (5 lag), purified rCP (5 lag) or native CP (5 gg); 5 lag of induced total
soluble protein contains 1.4-1-7 gg rCP.
t Infection was assayed by an immunofluorescence assay using antibodies to AMV CP. Only
infected protoplasts were detected.
Data for Experiment t are the average of two independent replicates.
yv, Not tested.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
570
V. Yusibov and others'
Fig. 3. Electronmicrographsof particles assembledfrom rCP, negativelystained with 2 % uranyl acetate. All electronmicrographsare
at the samemagnification.The bars indicate 100 nm. (A) Empty sphericalparticles; (B) AMV RNA4 containingcomplexes.The arrow
points to a bacilliformparticle. Left inset, particlesreleased from crystals. Right inset, analysisof the encapsidated RNA4 by agarose
gel electropboresis: lane 1, RNA4 transcripts; lane 2, RNA released from crystals; lane 3, solution from which crystalsformed. The
arrowhead at the left indicatesthe position of RNA4.
resulted in infectivity. The activity of the rCP preparations increased with purification a n d / o r concentration of
the rCP to nearly the same activity as native CP. Binding
of CP to AMV R N A is required for activity (Van der
Vossen et aI., 1994; Reusken et al., 1994; Yusibov &
Loesch-Fries, 1995); therefore, the data in Table 1
suggest that rCP binds to AMV R N A even though the
protein has an N-terminal extension.
In vitro assembly of empty particles and particles
containing R N A
To determine if rCP would assemble into empty
icosahedral particles as previously reported for native CP
(Fukuyama et al., 1981), rCP (9-0 mg/ml) was extensively
dialysed against pyrophosphate buffer. Spherical particles formed within 6 days of dialysis (Fig. 3A). Particles,
negatively stained with uranyl acetate, had electron
dense centres indicating that the uranyl acetate had
penetrated the particles, suggesting that the particles
were empty. The rCP in the assembled particles shown in
Fig. 3A contained the N-terminal 37 amino acid
extension. However, the particles were quite uniform in
size and shape. Their average diameter (19nm) was
identical to the diameter of the trypsin-treated icosa-
hedral particles assembled with native AMV CP by
Fukuyama et aI. (1981), This suggests that the Nterminal extension in rCP does not dramatically affect
particle assembly.
To assemble particles containing AMV RNA4, rCP
was mixed with RNA4 transcripts. Fig. 3B shows that a
heterogeneous population of particles resulted. The
majority of the negatively stained particles had electron
transparent centres indicating that there was little empty
space for penetration of the uranyl acetate, which
suggests that the particles contained RNA. Two size
classes of spherical particles were present, as well as, a
few short bacilliform particles (Fig, 3B): 73 % of the
spherical particles had an average diameter of 19 nm and
27 % had an average diameter of 26 nm. Dialysis of the
particles against citrate buffer resulted in the formation
of hexagonal crystals no larger than 0-3 mm. A few
crystals were disrupted for examination of particles by
electron microscopy; others were rinsed with 0.2 Mcitrate buffer, pH 4.6 and disrupted for analysis of the
encapsidated R N A by agarose gel etectrophoresis. Fig.
3B shows that the crystals formed from the smaller
uniform particles (left inset), which contained R N A that
co-migrated with RNA4 transcripts upon electrophoresis
(right inset). The in vitro assembly was repeated using
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
Assembly of alfalfa mosaic virus coat protein
571
Fig. 4. Electron micrographs of particles assembled from rCP and RNA1 transcripts negativelystained with 2 % uranyl acetate.
Particles and aggregatesformed during dialysisof a mixture of RNAI transcripts and rCP (A, B) or native CP (C) against 75 mMsodium pyrophosphate,pH 6.5. The electron micrographsare from separate experiments. Spindle-shapedaggregatesare indicatedby
arrows. The bar indicates 100 nm for all three micrographs.
native AMV CP, isolated from virions, and RNA4
transcripts. The resulting particles were identical in size
and heterogeneity to those shown in Fig. 3B (data not
shown). The estimated radius of the interior of the empty
T = 1 particle is 58 A (Fukuyama et aI., 198I), which
suggests that a single hydrated transcript of RNA4
(898 nt) would fill approximately 77 % of the interior.
Thus, the small spherical particles shown in Fig. 3B are
likely to be T = 1 particles, each containing a single
molecule of RNA4.
To assemble particles containing AMV RNA1, the
rCP was mixed with RNA1 transcripts and dialysed
against pyrophosphate buffers as described above. No
bacilliform particles were observed (data not shown).
Therefore, the rCP was mixed with RNA1 transcripts at
a ratio of 156 rCP: 1 RNA (w/w) and dialysed against
50, 75 or 100 m ~ solutions of sodium pyrophosphate or
NaC1, at pH 6 or 6.5. Dialysis against NaC1 resulted in
the formation of spherical particles that resembled T-1 particles. Similar results were obtained with 50 or
100 mM-pyrophosphate, pH 6 or 6"5 (data not shown).
However, the assembly products formed during dialysis
against 75 mM-pyrophosphate were strikingly different.
Small spheres, bacilliform particles and large aggregates
were present. At pH 6-0, only a few short bacilliform
particles were present (data not shown). However, at
pH 6'5, bacilliform particles formed which were similar
in size to native particles containing RNA1 (Fig. 4A, B).
Spindle-shaped aggregates, some of which appeared to
be made up of bacilliform particles and spherical
particles, were also present (Fig. 4B, arrows). To
determine if bacilliform particles could be made with
native CP, RNA1 transcripts and CP isolated from virus
particles were assembled under the same conditions that
were used for rCP. As shown in Fig. 4C, only occasional
short bacilliform particles were found. In a number of
experiments, rCP consistently assembled virus-like bacilliform particles while native CP did not.
Crystallization and X-ray analysis of empty particles
The empty particles (Fig. 3A) were treated with trypsin
to remove the N terminus of the rCP for crystallization
as described by Fukuyama et al. (1981). Analysis of the
trypsin-treated particles by SDS-PAGE indicated that
all of the rCP was converted to a protein (21 kDa) that
migrated faster than rCP (data not shown). Crystals were
obtained using the conditions described by Fukuyama et
aL (1981) as outlined in Methods. The crystals grew to a
size of about 1.5 mm in l week and had a hexagonal
shape as described by Fukuyama et at. (1981). The
crystals diffracted X-rays to 5-5 A resolution with
occasional spots appearing as far as 5-0 A. Film
processing showed that the crystals belong to the
hexagonal system (space group P63) with unit cell
parameters a = 198.95; c = 311-25 A.
Discussion
The goal of this study was to determine whether AMV
CP expressed in E. coli (rCP) was similar to native CP in
biological activity and in the assembly of virus particles
in vitro. Our results indicate that the recombinant protein
containing a 37 amino acid extension is active in infection
and assembly. This suggests that the extension at the N
terminus of tile recombinant CP does not affect the
accessibility of the N terminus for binding with the viral
RNA. It also suggests that no post-translational modi-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
572
V. Yusibov and others
fication, such as acylation of serine at position 2, which
occurs in native AMV CP, is needed for biological
activity.
When incubated under assembly conditions, AMV
rCP formed empty spherical particles that were similar in
diameter to those assembled from native CP (Fukuyama
et al., 1981). Preliminary analysis of the X-ray diffraction
data indicated that the empty particles are similar in size
and surface properties to those previously investigated
by Fukuyama et aL (1983).
AMV CP will encapsidate nucleic acids resulting in
variously shaped particles (Hull, 1970; Lebeurier et al.,
1971 ; Driedonks et al., 1978). The availability of AMV
RNA transcripts made it possible to provide pure
preparations of the smallest and largest AMV R N A for
the assembly reaction. Particles containing AMV RNA4
formed under conditions similar to those for empty rCP
particles. Most of the particles appeared to contain
RNA4 as determined by electron microscopy. We
expected to observe some empty particles because rCP
was present at great molar excess in relation to the
concentration of RNA4; however, few were present.
Perhaps the strong and specific interactions between
AMV RNA4 3" end and the rCP permitted few empty
particles to form. The electron micrographs of particles
recovered from crystals indicated that only the smallest
class of particles crystallized. These are similar in size to
the empty particles, which suggests that they are T =- 1
particles containing a single molecule of RNA4.
Long bacilliform particles were consistently observed
when rCP was assembled with RNA1 transcripts,
whereas they were seldom observed when native CP and
RNA1 transcripts were assembled. Our result with native
CP is consistent with earlier reports of AMV polymerization in the presence of nucleic acid (Jaspars, 1985).
Previous assembly products formed by dialysis of a
mixture of AMV RNAI and 2 or poly(A) and CP
consisted of irregular spheres and ellipsoid particles
(Hull, 1970; Driedonks et al., 1978) and an occasional
long bacilliform particle (Lebeurier et al., 1971). Thus,
rCP isolated from E. coli was much more competent in
the assembly of bacilliform particles than was CP isolated
from virions. Perhaps this is because the rCP preparation
is quite homogeneous compared to native CP preparations such as shown in Fig. 2, lane 2, which contains a
significant amount of truncated protein. Furthermore,
Sehnke & Johnson (1994) showed that a portion of
native CP molecules lacks the N terminus. Thus,
truncated protein molecules may interfere with the
assembly of bacilliform particles.
We have demonstrated that an in vitro assembly
system using AMV coat protein isolated from bacteria
will be valuable for structural studies of spherical and
bacilliform particles of AMV. This will allow further
study of the well-characterized interaction of AMV CP
and AMV RNA Y ends in the context of assembly.
The authors are grateful to Debra Sherman mad Paul Chipman for
help with the electron microscopy. The use of the Electron Microscope
Center in the School of Agriculture at Purdue University is acknowledged. The authors thank Dr Keith Perry and Dr Richard Kuhn
for critically reading the manuscript and for helpful suggestions. This
work was supported by grants from the USDA (90-34190-5207) and
Pioneer Hi-Bred International, Inc. This is Journal Paper no. 14689 of
the Purdue Agricultural Research Programs.
References
ALLISON, R., THOMPSON, C. & AHLQUIST, P. (1990). Regeneration of a
functional RNA virus genome by recombination between deletion
mutants and requirement for cowpea chlorofic mottle virus 3a and
coat genes for systemic infection. Proceedings of the National
Academy of Sciences, USA 87, 1820-1824.
BUR, M. L., Hous~R, F., LOESCI-I-FRIES, L. S. & GEHRKE, L. (1994).
Specific RNA binding by amino-terminal peptides of alfalfa mosaic
virus coat protein. EMBO Journal 13, 727-735.
BANCROFT, J.B. & HrE~BRT, E. (1967). Formation of an infectious
nucleoprotein from protein and nucleic acid isolated from a small
spherical virus. Virology 32, 35+-356.
BOL, J.F., VAN VLO~N-DO'nN~, L. & JASeARS, E. M. J. (1971). A
functional equivalence of top component a RNA and coat protein in
the initiation of infection by alfalfa mosaic virus. Virology 46, 73-85.
BOL, J. F., KRAAL, B. & BREDERODE,F. TrI. (1974). Limited proteolysis
of alfalfa mosaic virus: influence on the structural and biological
function of the coat protein. Virology 58, 101-110.
CHAPMAN, S., HILLS, G., WARTS, J. & BAtrL¢OraBE, D. (1992).
Mutational analysis of the coat protein gene of potato virus X:
effects on virion morphology and viral pathogenicity. Virology 191,
223-230.
DE GRAAFF, M., MAN IN'TWELD,M. R. & JASPARS,E. M. J. (1995). In
vitro evidence that the coat protein of alfalfa mosaic virus plays a
direct role in the regulation of plus and minus RNA synthesis:
implications for the life cycle of alfalfa mosaic virus. Virology 208,
583-589.
DOLJA, V. V., HALDEMAN, R., ROBERTSON, N. L., DOUGHERTY, W. G.
& CARRINGTON, J. C. (1994). Distinct functions of capsid protein in
assembly and movement of tobacco etch pot~wirus in plants. EMBO
Journal 13, 1482-1491.
DRmDONKS, R.A., KRIJOSMAN, P. C.J. & MELLEMA, J.E. (1977).
Alfalfa mosaic virus protein polymerization. Journal of Molecular
Biology 113, 123-140.
DRIZDO~KS, R. A., KRIJOSMAN, P. C. J. & MELLEMA, J. E. (1978). A
characterization of alfalfa-mosaic-virus protein polymerization in
the presence of nucleic acid. European Journal of Biochemistt;v 82,
405-417.
FUKt~AMA, K., ABDEL-MEGuID, S.S. & ROSSMANN, M . G . (1981).
Crystallization of alfalfa mosaic virus coat protein as a T = 1
aggregate. Journal of Molecular Biology 150, 33-41.
FUKt~AMA, K., ABDzL-MEC3UIt), S.S. & ROSSMANN, M . G . (1983).
Structure of a T = 1 aggregate of alfalfa mosaic virus coat protein
seen at 4.5 A resolution. Journal of Afolecular Biology 167, 873-894.
HALK, E.L. (198I). Comparative electrophoretic mobility of three
ilarviruses and alfalfa mosaic virus in polyacrylamide gels. Abstract,
Fifth International Congress of Virology, P1/13.
HALK, E.L. (1986). Serotyping plant viruses with monoclonal
antibodies. Methods in Enzymology 118, 766-780.
HULL, R. (1970). Studies on alfalfa mosaic virus. III. Reversible
dissociation and reconstitution studies. Virology 40, 3447.
JASPARS, E. M. J. (1985). Interaction of alfalfa mosaic virus nucleic acid
and protein. In Molecular Plant Virology, vol. 1, pp. 155-221. Edited
by J. W. Davies. Boca Raton, Fla.: CRC Press.
KRUSEMAN,J., KRAAL, B., JASPARS,E. M. J., BOL, J. F., BREDERODE,F.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51
A s s e m b l y o f alfalfa mosaic virus coat protein
TH. & VELDSTRA,H. (1971). Molecular weight of the coat protein of
alfalfa mosaic virus. Biochemistry 10, 447--455.
LAEMMLL U.K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680-685.
LEBEURIER, G., FRAENKEL-CONRAT,H., WURTZ, M. & HIRTH, L.
(1971). Self-assembly of protein subunits from alfalfa mosaic virus.
Virology 43, 51-61.
LOESCH-FRIES,L. S. & HALL,T. C. (1980). Synthesis, accumulation and
encapsidation of individual brome mosaic virus RNA components in
barley protoplasts. Journal of General Virology 47, 323-332.
LOESCH-FRn~S, L. S., JANWS, N.P., KRAHN, K.J., NELSON, S.E. &
HALL, T. C. (1985). Expression of alfalfa mosaic virus RNA 4 cDNA
transcripts in vitro and in vivo. Virology 146, 177-187.
LOESCH-FRIES,L. S., MENLO, D., ZINNEN, T., BURHOP, L., HILL, K.,
KRAHN,K., JARWS,N , NELSON,S. & HALK, E. (1987). Expression of
althlfa mosaic virus RNA 4 in transgenic plants confers virus
resistance. E~ltBO Journal 6, 1845-1851.
MARSH, L. E., HUNTLEY,C. C., POGUE,G. P., CONNELL,J. P. & HALL,
T. C. (1991). Regulation of ( + ): (--) strand asymmetry in replication
of brome mosaic virus RNA. Virology 182, 76-83.
OTWINOWSKI, Z. (1993). Oscillation data reduction program. In
Proceedings of the CCP4 Study Weekend: Data Collection and
Processing, pp. 55-62. Edited by L. Sawyer, N. Isaacs & S. Bailey.
SERC Daresbury Laboratory, UK.
QUADT, R., ROSDORFF,H. J. M., HUNT, T.W. & JASPARS, E. M.J.
(1991). Analysis of protein composition of alfalfa mosaic virus
RNA-dependent RNA polymerase. Virology 182, 309-315.
REUSKEN, C. B. E. M., NEELEMAN, L. & BOL, J.F. (1994). The 3'untranslated region of alfalfa mosaic virus RNA3 contains at least
two independent binding sites for viral coat protein. Nucleic Acids
Research 22, 1346-1353.
aACHEN, R. & AHLQUIST, P. (1989). Effects of deletions in the N-
573
terminal basic arm of brome mosaic virus coat protein on RNA
packaging and systemic infection. Journal of Virology 63, 4545-4552.
SAMAC, D.A., NELSON, S.E. & LOESCH-FmEs, L.S. (1983). Virus
protein synthesis in alfalfa mosaic virus infected alfalfa protoplasts.
Virology 131,455-462.
SAMBROOK, J., FRITSCH, E.F. & MANIATIS, T. (1989). Molecular
Cloning: A Laboratory Manual, 2nd edn. New York: Cold Spring
Harbor Laboratory.
SFJ-I~AKE,P. C. & JOHNSON,J. E. (1994). A chromatographic analysis of
capsid protein isolated from alfalfa mosaic virus: zinc binding and
proteolysis cause distinct charge heterogeneity. Virology 204,
843-846.
VAN DER KUYL, A. C., NEELEMAN,L. & BOL, J. F. (1991 a). Complementation and recombination between alfalfa mosaic virus RNA3
mutants in tobacco plants. Virology 183, 731-738.
VAN DER K ~ L , A. C., NE~LEMAN,L. & BOL, J. F. (1991 b). Role of
alfalfa mosaic virus coat protein in regulation of the balance between
viral plus and minus strand RNA synthesis. Virology 185, 496-499.
VAN DEN VOSSEN,E. A. G., NEELEMAN,L. & BOL, J. F. (1994). Early
and late functions of alfalfa mosaic virus coat protein can be mutated
separately. Virology 202, 891-903.
Yusmov, V. M. & LOESCH-FRIES,L. S. (1995). N-terminal basic amino
acids of alfalfa mosaic virus coat protein involved in the initiation of
infection. Virology 208, 405-407.
ZHAO, X., FOX, J. M., OLSON, N. H., BAKER, T. S. & YOUNG, M. J.
(1995). In vitro assembly of cowpea chlorotic mottle virus from coat
protein expressed in Escherichia cob and in vitro-transcribed viral
cDNA. Virology 207, 486--494.
(Received 14 September 1995; Accepted 21 November 1995)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:38:51