Download Week 7 - UW Canvas

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Biology 200, Autumn 2014
Problem Set Week 7
1. FILL IN THE BLANKS:
Humans have 23 pairs of chromosomes:
a. After DNA replication, humans have ________ replicated chromosomes.
b. _____________ and ___________ are the two main types of molecules in chromatin.
c. An unreplicated chromosome contains ___________ DNA molecule(s).
It has ________ strands.
2. Matching: match the enzymatic activites (a-g) with the enzymes listed below (A-H).
Indicate ALL correct answers in the blanks. Blanks may have one, more, or no answers!!!
a. Enzyme that polymerizes activated nucleotides
b. Enzyme that is capable of separating the strands of DNA
c. Enzyme that uses the energy stored in rNTPs or dNTPs
to create large polymers.
d. Enzyme involved in synthesizing and joining Okazaki fragments
e. Enzyme that is capable of adding dNTPs to the 5’ end of a
growing DNA strand
f. Enzyme capable of adding an amino acid to the 3’ end of a tRNA
g. Enzyme capable of breaking phosphodiester bonds.
A.
B.
C.
D.
E.
F.
G.
H.
________
________
________
________
________
________
________
DNA Polymerase I
DNA Polymerase III
RNA Polymerase
RNase
Ligase
Helicase
Amino-acyl tRNA synthetase
Primase
3. a) During which part of the cell cycle is DNA replicated? _________________
b) What is the difference between a centromere and a kinetochore?
c) On the drawing to the right, label:
Chromosome
Chromatid
Centromere
Telomere
4. a) Why do cells need the enzyme telomerase?
b) Do all cells in the body express the enzyme telomerase?
c) What is the potential link between telomerase and cancer? Telomerase and aging?
Biology 200, Autumn 2014
Problem Set Week 7
5. Fill out the following table by marking an X in the box of the process that involves each
molecule or structure:
Molecule or Structure DNA replication Transcription Translation
ATP
DNA polymerase
tRNA
ribosome
helicase
UTP
RNA polymerase
AUG start site
Okazaki fragment
6. A cell with 10 pairs of chromosomes undergoes mitosis. How many chromosomes does
each of the resulting daughter cells have? (Choose ALL correct answers)
a. 2 pairs
b. 5
c. 5 pairs
d. 10
e. 10 pairs
f. 20
g. 20 pairs
7. A cell with 10 pairs of chromosomes undergoes meiosis. How many chromosomes does
each of the resulting cells have? (Choose ALL correct answers)
a. 2 pairs
b. 5
c. 5 pairs
d. 10
e. 10 pairs
f. 20
g. 20 pairs
8. How many sister chromatids are in the initial cell immediately before it goes into
meiosis in question 9? ____
9. The DNA below codes for a short protein. This is the wild-type version of the gene.
+1
terminator
5’ GATGCCCTGGAGCTATGGGAAGTCTTCCCTAGCTAACTTTAAGGC 3’
3’ CTACGGGACCTCGATACCCTTCAGAAGGGATCGATTGAAATTCCG 5’
a. What is the complete mRNA transcribed from this gene? (include 5’ and 3’ labels)
b. Using your mRNA above, translate the sequence. (include N and C termini)
c. A mutant allele produces a protein with this sequence: N- Met–Gly–Val–Phe–Pro–Ser-C
i. Circle a base pair in the WILD –TYPE DNA above that could be different in the mutant.
ii. Describe how this base pair changed and tell us what this type of mutation is called:
d. Having the mutant allele increases an individual’s risk for cancer. What type of protein is
this? Explain your logic briefly.
Biology 200, Autumn 2014
Problem Set Week 7
10. Below are 5 correctly drawn mitotic phases and one that does not fit:
a) Give the letter for the phase that does not fit ____.
b) Explain why the phase does not fit in.
c) Redraw the phase so that it does fit with the other five phases.
d) Starting with the cell at point C and using your corrected version of one of the phases,
list the letter of the phases of the cell cycle in the order in which they occur.
1. ____ 2. ____ 3. ____ 4. ____ 5. ____ 6. ____
e) Is there a stage of meiosis where the incorrect stage would fit? ____ If so, what stage of
meiosis is it? Be specific: ____________________
f) How many chromosomes are in a gamete from this organism? ____
11. Check the boxes for any process that occurs in that cell type. Check as many boxes as
apply. All descriptions will have at least one answer, some more than one.
Description
a. Follicle cells that are dividing in a
maturing follicle in the ovary
b. 1° Oocyte
c. Differentiated neuron that is in G0
d. Spermatogonium
DNA
replicates
Homologous
chromosomes pair
up and recombine
Sister
chromatids
separate
Histones
are
present
Biology 200, Autumn 2014
Problem Set Week 7
12. Imagine there are twin sisters, Abby and Babs. They both inherited mutations in their
DNA Polymerase III genes that make the enzyme slightly less efficient at proofreading. Abby
gets three different cancers before age 60. Babs never gets cancer. Assume both sisters are
accumulating mutations in their DNA at the same rate.
a. Explain how mutations cause Abby's cancers.
b. Why doesn't Babs get cancer?
FROM THE TEXT (Freeman, 5e):
Ch. 12: 1, 3, 4, 7, 12, 16
Ch. 13: 1, 2, 4-11, 13, 14
Ch. 15: 1, 3-6, 8-10, 13-16
FROM THE TEXT (Freeman, 4e):
Ch. 14: Test Your Knowledge 1-6; Test Your Understanding 2, 3, 4, 6; Applying Concepts 1-4
Ch. 11: Test Your Knowledge 1, 3, 4, 6; Test Your Understanding 1, 6; Apply Concepts 1, 2, 4
Ch. 12: Test Your Knowledge 1-6; Test Your Understanding 1-5; Applying Concepts 1, 2
Related documents