Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 155:192–199 (2014) Epigenetic Plasticity Following Early Stress Predicts Long-Term Health Outcomes in Rhesus Macaques E. L. Kinnally* California National Primate Research Center, University of California Davis, CA 95616 KEY WORDS maternal care; serotonin transporter; rhesus macaque; development; DNA methylation; inflammation; body condition ABSTRACT Early life stress has been linked with poorer lifelong health outcomes across species, including modern and ancient humans. Epigenetic mechanisms, such as DNA methylation patterning of stress pathway genes in stress-responsive tissue, may play an important role in the long-term health effects of early stress across species. The relationships among early maternal care quality, DNA methylation patterns in a candidate stress pathway gene (serotonin transporter, 5-HTT) linked region in blood DNA, and adult health outcomes were examined in male and female rhesus macaques, excellent models of human health. Male (n 5 12) and female (n 5 32) infants were observed with their mothers for the first 12 weeks of life and 5-HTT linked DNA methylation was measured in blood at 12 weeks of age. Approximately 8 years later, health-related measures were collected for the 25 animals (6 male and 19 female) that Early life stress in the form of maltreatment or neglect can lead to disadvantageous health outcomes, such as inflammatory and metabolic disease (Danese et al., 2009; Wegman and Stetler, 2009). This phenomenon has been observed in animals (Conti et al., 2012), living humans (Danese et al., 2009), and in skeletal artifacts of ancient humans, as is demonstrated and comprehensively reviewed in this issue (Vercellotti, this issue; Klaus, this issue). These data suggest that the links between early childhood stress and health outcomes are highly evolutionarily conserved. Across species, there is perhaps no more potent or common early stressor than the disruption of attachment relationships. Poor care is an experience common to most mammals, and its adverse effects have been observed across species (Ainsworth, 1979; Fairbanks and McGuire, 1988; Mason and Mendoza, 1998; Maestripieri et al., 2006). In many mammals, mothers provide sole care of offspring. There are consistencies in stages and general properties of maternal care. Mothers exhibit a number of speciesappropriate, developmentally timed behaviors toward their infants. Across species, these include tactile contact, nursing, face to face contact or mutual eye gaze, which give way to maintaining proximity, and protection from environmental threats when the infant becomes increasingly ambulatory. Eventually mothers encourage independence by providing a secure base for offspring to explore the world or rejecting the infant and resisting attempts to maintain proximity. Across species, two general dimensions of maternal care include positive contact and negative contact or avoidance between mother and infant. Variation in these dimensions has been observed across mammalian species. One of the most commonly Ó 2014 WILEY PERIODICALS, INC. were available for study. Health composite scores were generated using factor analysis of body condition, body weight, and diagnosis of diarrhea during the lifespan. Better quality maternal care predicted lower 5-HTT linked methylation at 12 weeks of age. Lower 5-HTT methylation, in turn, predicted better health composite scores in adulthood, including better body condition, greater body weight and absence of lifetime diarrhea. These data suggest that the epigenetic regulation of 5HTT may be one biomarker of the link between early stress and lifetime health trajectories. Future studies will examine whether epigenetic signatures in modern and ancient human DNA lends insight into stress and health and natural selection in human evolutionary history. Am J Phys Anthropol 155:192–199, 2014. VC 2014 Wiley Periodicals, Inc. used methods to assess variation in maternal care categorizes levels of protectiveness vs. aggression toward/ rejection of infants (Fairbanks and McGuire, 1988; Stevenson-Hinde and Simpson, 1986). Non-human primate species such as rhesus macaques display natural variation in maternal protectiveness vs. aggressiveness, and this variation has been related to long-term behavioral outcomes for the infant (Stevenson-Hinde and Simpson, 1986; Fairbanks and McGuire, 1988; Bardi and Huffman, 2002; McCormack et al., 2006; Kinnally et al., 2009). In non-human primates, experimental deprivation of mother-infant contact has been linked with poorer health outcomes (Conti et al., 2012), and poor maternal care has been linked with greater infant mortality (Fairbanks and McGuire, 1995), but the consequences of natural variation in maternal care on lifetime health outcomes are not as well understood. We have only recently begun to identify the intervening molecular processes for the long-lasting effects of stress (Meaney, 2010). Epigenetic plasticity in stress pathway Funding Sources: P50 MH062185-08, P51 OD0011107 and R24 OD010962. *Correspondence to: California National Primate Research Center, One Shields Avenue, Davis, CA 95616. E-mail: [email protected] Received 5 February 2014; accepted 22 June 2014 DOI: 10.1002/ajpa.22565 Published online 6 August 2014 in Wiley Online Library (wileyonlinelibrary.com). EARLY STRESS, EPIGENETICS, AND HEALTH genes has recently emerged as a potential mechanism for long-term health risks conferred by early life stress. Epigenetic marks are chemical modifications that change the function, but not the sequence, of the genome. DNA methylation of cytosines within promoter region CpG islands (regions dense with nucleotides cytosine and guanine, bonded with a phosphate) typically limits gene expression (Bird, 1986). Recent evidence suggests that epigenetic regulation of stress pathway genes are indeed sensitive to aspects of the environment: DNA methylation patterning in many stress pathway are changed following early stress, and these changes have long-term neurobehavioral and health consequences (Weaver et al., 2004; Roth et al., 2008; McGowan et al., 2009; Provençal et al., 2013). However, these changes may be highly tissue- and genespecific. DNA methylation patterns are unique to each cell and gene, meaning that there is opportunity for great variation across tissues and genes (Bird, 1986). The serotonin transporter gene (5-HTT) is a candidate gene that is expressed constitutively in neurons and lymphocytes, and it has been strongly implicated in the effects of early life stress. Neuronal and lymphocyte 5-HTT expression is impaired following deprivation or abuse in multiple species (Ichise et al., 2006; Jahng et al., 2007; Lee et al., 2007; Kinnally et al., 2008; Miller et al., 2009). Variation in 5-HTT expression has also been linked with health outcomes including inflammation (Macchi et al., 2013), cardiovascular health (Brummett et al., 2011) and metabolism (Chen et al., 2012; Shinozaki et al., 2012), possibly through its role in stress coping (Kinnally et al., 2009), but also through its actions in peripheral tissue (Chen et al., 2012; Giannaccini et al., 2013; Wendelbo et al., 2014). DNA methylation patterns in the 5-HTT gene are a potential candidate mechanism for the links among early stress, 5-HTT expression, and health because greater peripheral blood DNA methylation regulates 5-HTT expression in human and rhesus macaque PBMCs (Philibert et al., 2007, 2008; Kinnally et al., 2010a). Additionally, human studies have demonstrated that early life stress is linked with greater methylation of the 5-HTT regulatory region (Beach et al., 2011; Wang et al., 2012). The effects of normative variation in maternal care on 5HTT methylation patterning, and their combined effects on somatic health outcomes, are not known. To investigate the role of epigenetic regulation of stress pathway genes in the translation between early life stress and health outcomes, 5-HTT linked DNA methylation patterns within peripheral blood mononuclear cell (PBMC) DNA were measured in infant (90–120-day-old) rhesus macaques. The present study tested the hypothesis that naturally occurring early life stress (poor maternal care) would be associated with higher DNA methylation. Eight years later, infants were assessed for multiple health outcomes, including poor body condition, low body weight, and incidence of a common inflammatory disease in macaques (diarrhea). It was hypothesized that both higher quality maternal care and lower 5-HTT linked methylation would predict indicators of better health. MATERIALS AND METHODS Experimental subjects Subjects were 44 (12 male and 32 female) infant rhesus macaques (Macaca mulatta), selected from over 150 infants born in five outdoor enclsoures. Infants were raised with their mothers in one of five half-acre outdoor enclosures at the California National Primate Research 193 Center (CNPRC) and typically remained in these groups into adulthood. Each field cage contained a large social group (40–140 members) comprising at least six distinct matrilines with extended kin networks and animals of all age/sex classes. Mean pairwise relatedness between subjects was 3%. Mothers (primiparous n 5 22; multiparous n 5 22) ranged from 3.5 to 17 years of age with a mean of 6.5 years of age. All procedures were conducted with approval by the UC Davis Institutional Animal Care and Use Committee. Procedures Mother–infant observations. Subjects were observed in their social groups three times weekly (5 min per observation) between 07:00 h and 13:00 h, during postnatal weeks 1–12 in 2006, until the day animals underwent a biobehavioral assessment that included blood sampling an infant body weight measurement (described below). Mother–infant interactions were coded using a transactional coding system describing the overall theme of an interaction from the perspectives of the initiator and the recipient (Lyons et al., 1992; Kinnally et al., 2010b). A transaction was defined as a change from one state of association to a new state. A protective themed transaction was one in which mothers pulled the infant toward her ventrum. Affiliative themes included any transaction with physical (non-aggressive) contact, including touching or grooming. Accommodating transactions occurred when the mother moved her body to facilitate an infant overture, as in huddling or stopping her activity to facilitate the infant’s overture. Neutral transactions included approaching the infant or minimal response to infant overture. Resistant transactions were defined as moving away upon infant approach. An aggressive theme was defined as one including threatening, biting, chasing, scratching, flattening (pressing into the ground), dragging, pushing away, and/or grabbing infants. Inter-rater reliability for transactional coding was 85% or better. Maternal care scores. Rate of transactions in which the mother initiated each of type of transaction or responded to an infant’s overture with each theme were calculated per 5-min observation. Factor analysis was used to detect the latent factors underlying maternal behavior. Three factors were extracted explaining 58% variance. The first two factors described 45% of this variance, and thus only these primary factors were analyzed. Factor one described protectiveness, loading positively maternal rate of initiating protective overtures (factor loading 0.634), initiating affiliative overtures (factor loading 0.412), responding protectively (factor loading 0.673), responding affiliatively (factor loading 0.751), and responding accommodatingly to infant overtures (factor loading 0.710). Factor two described maternal aggressiveness, loading rates of initiating aggressiveness (factor loading 0.801), rates of aggressive responses to infant overtures (factor loading 0.577), and rates at which mothers initiated neutral transactions (factor loading 0.744). Maternal care scores were generated by subtracting aggressiveness factor scores from protectiveness factor scores. Blood sampling and peripheral blood mononuclear cell extraction. Procedures for blood sampling and sample preparation was conducted as described American Journal of Physical Anthropology 194 E. L. KINNALLY previously (Capitanio et al., 2005; Kinnally et al., 2010a, b). When infants were 90–120 days of age, and after mother–infant observations were collected, blood was sampled via femoral venipuncture four times over a 25-h period and each sample was decanted into EDTA-treated collection vials. Blood was collected during a standardized biobehavioral assessment during which experimental conditions are consistent across all subjects. The first sample was collected at 11:00 h (AM sample), approximately 2.0 h following social separation/relocation. The second blood sample was collected approximately 5.0 h after the first sample at 16:00 h (PM sample). The third blood sample was collected 16.0 h later after dexamethasone treatment (DEX sample) and the fourth sample was collected 30 min later, after treatment with adrenocorticotropic hormone (ACTH sample). The present study used PM samples collected in infancy as described in a previous study (Kinnally et al., 2010a), because the present study represented a follow up of that earlier study. Whole blood samples were centrifuged for 10 min at 3000 RPM at 4 C. Plasma was removed and decanted into 1.5 ml sarstedt (VWR, South Plainfield, NJ) tubes for storage at 280 C. Peripheral blood mononuclear cells (PBMCs) were isolated from the remaining sample within 1 h of sampling. White blood cells were aliquotted to RPMI media (Invitrogen, Inc., Carlsbad, CA) supplemented with 10% fetal bovine serum and applied to lymphocyte separation media (MP Biomedicals, Solon, OH). Samples were centrifuged at 2000 RPM at 23 C for 30 min. The purified phase was washed three times with media, centrifuged, and then resuspended in Trizol RNA stabilizing reagent (Invitrogen, Inc., Carlsbad, CA). Samples were stored for no longer than one year at 280 C. 5-HTT-linked CpG methylation analysis. DNA was extracted from Trizol suspension according to manufacturer’s instructions and converted for methylation sequencing using a commercially available sodium bisulfite modification kit (Qiagen, Inc., Valencia, CA). DNA methylation patterns in a CpG island on the non-coding complementary strand of the 5-HTT promoter were quantified. The target region was amplified using polymerase chain reaction. PCR amplification was conducted with three primer sets (Integrated DNA Technologies) targeting contiguous regions of the first 650 bp of the 5HTT CpG island. Primers were as follows: F1 50 GGG AAGAAGTTTTGGAAAGA AA30 R1 50 CCACTATCTAAAA ATCAAACCATATAA30 ; F2 50 GGTTGTAA AGTTATTGTA ATTATAAAGG30 ; R2 50 TTTCTTTCCAAAACTTCTTCC C30 ; F3 50 GGTTTTTTATATGGTTTGATTTTTAGATA30 ; R3 50 CCTACCCTACCCTACCT ACTACTCC30 . Reverse primers were tagged with biotin. Biotin-labeled amplicons were captured on streptavidin beads (Roche, Inc., Basel, Switzerland), washed sequentially with 70% ethanol, denaturing buffer (10 mM sodium hydroxide) and washing buffer (10 mM Tris, pH 7.6). Beads with amplicon were incubated with binding buffer (10 mM Tris, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20, pH 7.6) and 0.4 lM sequencing primer at 80 C to anneal primers to the template. Amplicons were subjected to pyrosequencing (Tost and Gut, 2007; Biotage, Inc., Uppsala, Sweden). The quantity of methylated residues was assessed using Q-CpG software (Biotage, Inc.). Each amplicon was sequenced in two to three separate reactions. Sequencing primers were as follows: SEQ1 50 AAGAAGTCTTGGAAAGAA A30 ; SEQ2 50 TTGTAGGGT American Journal of Physical Anthropology TGTGTTAGG30 ; SEQ3 50 AAGTTATTGTAATTATAAA GG AAT30 ; SEQ4 50 GGGYGTAGGGTTAGGAT30 ; SEQ5 50 AT GGTTTGATTTTTAG ATAG30 ; SEQ6 50 TGAGGYGAATAA SEQ7 50 TAGGAGGGCAGG GAT30 . ATTTAATG30 ; Sequencing was conducted using the PyroMark PSQ MA instrument and PyroGold reagents (Biotage, Inc., Uppsala, Sweden). Proportion of methylated residues in each reaction at each locus was assessed using Q-CpG software (Biotage, Inc. Uppsala, Sweden). Six residues were not estimable for any subject, and were removed from the analysis. Data were analyzed for subjects with at least 70% coverage (mean 5 85.4%) of a total of 59 residues. To facilitate comparison among subjects, all samples were run on one plate for each sequencing reaction. A subset of samples was assayed twice, and underwent repeated sodium bisulfite conversion, PCR amplification and pyrosequencing. Coefficient of variance between these samples was less than 30%, indicating adequate reliability of methylation estimates. A subset of these analyzed samples was used in an earlier study (Kinnally et al., 2010a). Adult health measures. Approximately 90 months (8 years) later, 25 of the original 44 animals were available for health outcome follow-up. Some had died of natural causes or been humanely euthanized due to chronic health problems (n 5 15), while others had been relocated to another facility (n 5 3) or assigned to an experimental protocol (n 5 1). The remaining subjects had reached 93 months of age in the CNPRC breeding facility (n 5 25), and lived in either in outdoor or indoor enclosures. In the remaining animals at the CNPRC, we collected the most recent weight measurement (in kg) at 93 months of age, most recent standardized body condition measurement by CNPRC staff at 93 months of age (likert scale of 1–5, a score of 1 indicating poorest and 5 indicating best body condition), and presence of a common inflammatory disease (diarrhea), by 93 months of age. Presence or absence of diarrhea was scored dichotomously (scored as a 0 or 1) based on whether the animal had experienced diarrhea one time or more in their lives, either having been hospitalized for this condition, or observed by CNPRC staff to exhibit diarrhea. Body condition data was not available for one subject, so a mean replacement body score was employed to generate this subject’s health factor score. Adult health composite scores were generated using principal components analysis with promax rotation. High health composite scores reflect greater body weight (factor loading 0.865), good body condition (factor loading 0.898), and absence of diarrhea diagnosis (20.346 factor loading). See Table 1 for range, mean, and standard deviation of all measures. Data analysis Multiple backward regression was used to determine predictors of infant 5-HTT linked methylation patterns and adult health. This backward elimination statistical technique was employed to determine which predictors contributed unique and significant variance to the models, and to remove those that did not. Social hierarchy rank, infant weight at 3–4 months of age, and sex were considered as possible demographic variables that could influence either 5-HTT linked methylation or health outcomes because they may influence aspects of social life. The first model therefore included 5-HTT methylation as 195 EARLY STRESS, EPIGENETICS, AND HEALTH TABLE 1. Descriptive information for predictors and outcome measures in infancy (n 5 44) and in adulthood (n 5 25) Variables Age Infancy (n 5 44) Maternal care scores 5-HTT linked C-methylation (%) Maternal rank (rank/group size) Body weight (kg) Adult follow-up (n 5 25) Maternal care scores 5-HTT linked C-methylation (%) Maternal rank Body weight (kg) Body condition scores (1–5) Presence lifetime diarrhea Yes (n 5 12) No (n 5 13) Range Mean SD months months months months 24.80 to 3.50 1.12–15.54 0.02–0.98 0.51–1.22 20.08 4.36 0.43 0.87 1.41 2.86 0.27 0.14 3–4 months 3–4 months 3–4 months 93 months 93 months 93 months 24.80 to 1.90 1.12–9.19 0.02–0.97 6.18–16.18 1.50–4.00 0.00–1.00 20.37 4.00 0.43 8.93 2.85 NA 1.50 2.35 0.28 2.33 0.54 NA 3–4 3–4 3–4 3–4 the dependent variable and maternal care scores, infant weight, maternal social hierarchy rank as a function of the total number of adult females in the group, and infant sex as potential predictors. The second model tested the association of these predictors and 5-HTT linked methylation with adult health composite scores. Post hoc regression analyses were conducted with each health outcome as a dependent variable and 5-HTT methylation, maternal care scores, infant weight, maternal social hierarchy rank, and infant sex as potential predictors. Backward multiple regression was used for body weight and body condition measures and backward logistic regression was conducted for presence or absence of diarrhea. Enclosure of birth, group size, maternal parity, nor most recent housing conditions (indoors or outdoors at the CNPRC) statistically influenced methylation or health measures (ANOVAs; P > 0.05), so these variables were not included in any analyses. To ensure that our living population did not differ significantly from animals that had been relocated, died, or placed on an experimental protocol, we compared maternal care scores and 5-HTT linked methylation ratios between subjects that lived until follow-up vs. (1) those that died of natural causes or euthanasia due to disease, (2) relocated to other facilities, in two separate univariate analyses of variance controlling for the effects of sex and maternal rank, and in the case of 5-HTT methylation, controlling for maternal care scores. This analysis could not be conducted for those assigned to experimental protocols because only one subject from our original study had been so assigned. All statistical analyses were conducted using SPSS 21.0. Two-tailed significance level was set at P 0.05. TABLE 2. Regression model describing the effects of infant sex, infant weight, maternal rank, and maternal care scores on infant blood 5-HTT linked methylation Variables Maternal rank Infant sex Infant weight Maternal care scores a ß T p 20.015 20.012 20.174 20.319 0.103 20.076 21.143 22.178 0.918 0.940 0.260 0.035a P < 0.05. Fig. 1. Lower maternal care scores predict higher blood 5HTT linked DNA methylation. RESULTS Predictors of 5-HTT linked methylation The model predicting infant methylation patterns was significant (F(1, 43) 5 4.745, P 5 0.035, adjusted R2 5 0.080; see Table 2 and Fig. 1). As predicted, lower maternal care scores predicted higher average 5-HTT linked methylation in PBMC DNA (t 5 22.178, P 5 0.035). 5-HTT methylation was not predicted by infant sex (t 5 20.076, P 5 0.940) or maternal social rank (t 5 0.103, P 5 0.918). Maternal care scores did not differ between our follow-up subjects and subjects that had not been available for follow-up due to death (F(3, 36) 5 2.535, P 5 0.120) or relocation to another facility (F(3, 24) 5 0.422, P 5 0.522). Predictors of health outcomes The model predicting health scores was significant (F(2, 23) 5 7.892, P 5 0.003, adjusted R2 5 0.375: see Table 3 and Fig. 2). Lower DNA methylation predicted higher health composite scores, indicating better body condition, greater weight, and lower risk of diarrhea (t 5 22.404, P 5 0.026). Sex also predicted higher health composite scores, with males having higher health American Journal of Physical Anthropology 196 E. L. KINNALLY TABLE 3. Regression model describing the effects of infant sex, infant weight, maternal rank, maternal care scores, and infant blood 5-HTT linked methylation on adult health composite scores Variables Maternal rank Infant sex Infant weight Maternal care scores 5-HTT linked methylation % a ß T P 20.118 0.419 20.231 0.081 20.409 20.710 2.459 21.249 0.425 22.404 0.486 0.023a 0.223 0.676 0.026a P < 0.05. Fig. 2. Higher blood 5-HTT linked methylation in infancy predicts poorer health outcomes in adulthood. composite scores (t 5 2.459, P 5 0.023). Neither maternal care (t 5 2.425, P 5 0.676) nor maternal rank (t 5 20.710, P 5 0.486) predicted health composite scores. Post-hoc regression analyses of individual health outcomes show that methylation significantly predicted body weight (F(1, 23) 5 17.906, P < 0.0001, adjusted R2 5 0.585), and tended to predict body condition (F(1, 23) 5 3.977, P 5 0.059, adjusted R2 5 0.115) and diarrhea risk (F(1, 23) 5 3.784, P 5 0.052, adjusted R2 5 0.182), while sex predicted only body weight (F(1, 23) 5 17.906, P < 0.0001, adjusted R2 5 0.585), such that males were heavier. 5-HTT methylation did not differ between our follow-up subjects and subjects that had not been available for follow-up due to death (F(4, 35) 5 2.969, P 5 0.094) or relocation to another facility (F(4, 23) 5 0.025, P 5 0.875). DISCUSSION AND CONCLUSIONS Previous studies have suggested that epigenetic regulation of stress pathway genes plays a pivotal role in the translation between early life stress and health-related outcomes (Meaney, 2010; Provençal et al., 2013). In this long-term developmental study, it is demonstrated that poorer maternal care reprograms DNA methylation patterns in a CpG island linked with the 5-HTT gene early in life, and that this reprogramming predicts adult health outcomes in a provisioned, semi-naturalistically housed population of rhesus macaques. The effects of early attachment relationships are perhaps one of the most formative for long-term neurobehaAmerican Journal of Physical Anthropology vioral and health trajectories. High quality maternal care predicted lower DNA methylation in a 5-HTT linked CpG island in PBMC DNA. These effects were independent of demographic factors that may also influence social life, such as social hierarchy rank. Our findings are consistent with a body of literature that suggests that stressful early experiences result epigenetic reorganization in stress pathway genes (Weaver et al., 2004; Champagne et al., 2006; Roth et al., 2009). However, it is somewhat inconsistent with a previous study in which no difference in 5HTT methylation between individuals exposed to control rearing or an experimental early life stressor, nursery rearing, in macaques (Kinnally et al., 2010a). It is possible that infants were sensitive to variation in maternal behavior in this study due to the singular importance of the mother-infant relationship (Harlow and Zimmerman, 1959; Ainsworth, 1979; Mason and Mendoza, 1998). Because of the developmental importance of this relationship, incremental variation in the quality of mother-infant interactions results in pronounced variation in infant development (Rosenblum and Paully, 1984; StevensonHinde and Simpson, 1986; Fairbanks and McGuire, 1988; Maestripieri et al., 1997). This may point to a unique and powerful role for the mother–infant relationship in epigenetic and health development. Indeed, in parallel with our findings, variation in the quality of the attachment relationship has been repeatedly linked with alterations in the 5-HT system (Maestripieri et al., 2006; Kinnally et al., 2010b), as well as many other physiological systems (Hofer, 1970; Meaney, 2010; McCormack et al., 2006). It is also possible that gene–environment interactions play a role in epigenetic programming, and that maternal cues are central to these interactions. If so, nursery rearing may not have been sufficient to elicit differences in methylation patterns in the previous study. Our study, however, cannot systematically examine the role of genetic factors on these results. Though our infant subjects were unrelated, it is possible that the effects of maternal care on infant epigenetic development were not entirely environmental, but also had genetic underpinnings. For example, it is possible that maternal behavior, 5-HTT linked methylation patterns, and health outcomes have a common genetic basis. If so, it is possible that infants inherited this genetic background, which was the actual predictor of infant outcomes. Future studies will eliminate confounding genetic factors by cross-fostering infants to unrelated mothers in new social groups. Nonetheless, 5HTT methylation patterns may represent a biomarker of early stress in rhesus macaques. Our findings provide one example of the link between variation in early experiences and epigenetic organization in primates. Epigenetic reprogramming following poor maternal care in infancy, in turn, predicted health outcomes in adulthood. Individuals that displayed higher methylation early in life had lower adult health composite scores, as indexed by body condition, body weight, and disease risk. Sex also predicted our health composite measure, but post-hoc analyses show that this result is due to normative sex differences in body weight. Sex did not predict body condition or diarrhea risk. This finding suggests that one of the consequences of poor maternal care is higher 5-HTT linked methylation and poorer health in males and females, but surprisingly, maternal care scores alone did not predict health outcomes. It is possible that an unmeasured correlate of maternal care actually predicted both 5-HTT methylation and health, and that this unknown factor actually drove our results. EARLY STRESS, EPIGENETICS, AND HEALTH Possible mediating factors include maternal health or adverse social conditions. Another possible reason for this paradoxical finding is that in our subjects who survived to eight years of age, there were intervening exposures (e.g., social, dietary, pathogenic, or physiological factors) that may also have influenced health. These exposures may have obscured the connection between early experience and lifelong health outcomes. This rather highlights the importance of developmental epigenetic programming: while the psychological effects of early experiences may be diminished with time, the epigenome may persist in its effects on physiology and health. The mechanisms by which enhanced methylation may shift health trajectories are not yet known. Peripheral regulation of 5-HTT plays a direct role in pathogenesis of diarrhea (Wendelbo et al., 2014) and in metabolism (Chen et al., 2012; Giannaccini et al., 2013), which could explain the effects of epigenetic regulation of blood 5HTT on our health composite measure. It is also possible that PBMC dysregulation of 5-HTT corresponds with the reorganization of multiple neural, endocrine, and immune changes in response to early stress, and that epigenetic changes in these systems underlie health outcomes. Similar changes have been observed following early stress in neural and non-neural tissue, including blood (Oberlander et al., 2008; Beach et al., 2011), buccal cells (Essex et al., 2013), and sperm (Franklin et al., 2010), despite the fact DNA methylation patterns are not necessarily consistent across tissue (Bird, 1986). Our results indicate that peripheral epigenetic regulation of 5-HTT may be one useful biomarker of risk for poor health outcomes in primates. One limitation of this study was that only 25 out of 44 of our original subjects were available for follow up health studies. Fifteen subjects had died due to natural causes or been humanely euthanized for chronic health problems. These subjects did not differ in the maternal care scores they received, or, paradoxically, in 5-HTT methylation. One might expect that if 5-HTT methylation predicted poor health outcomes, individuals that had died due to chronic health problems should have had higher DNA methylation. It is difficult to assess the implications of this finding for our study, because some animals had received humane euthanasia before natural death, potentially obscuring epigenetic links with mortality. Future studies should examine the strength of these links. An additional limitation of the study was that our DNA sample was collected approximately 8 h after a stressful separation of infants from mothers. It is now known that some, but not all, DNA methylation patterns in blood may be dynamically regulated during stress, changing by as much as 1% in blood cells immediately following stress (Unternaehrer et al., 2012). Thus, it is possible that our blood methylation patterns reflect post-stress changes, rather than “basal” methylation patterns. A previous study associated post-stressor 5-HTT linked methylation with baseline 5-HTT expression (Kinnally et al., 2010a), which may suggest that small or brief changes in methylation may not substantially affect gene expression itself. Further research in this area is clearly warranted. These findings may be of particular interest to the fields of modern and ancient human biology. Understanding the importance of epigenetics in the adverse health effects of early stress in human evolutionary history may be challenging in the absence of available 197 model tissues to extract from modern and ancient humans. By characterizing links between stress, blood DNA methylation patterns, and health in primates, this study may provide a platform for human population biologists and bioarchaeologists to understand the role of epigenetic plasticity in modern and ancient humans using blood samples or ancient DNA (aDNA) from skeletal remains. Our work is consistent with a large body of work demonstrating that epigenetic mechanisms may play a role in the long-term effects of early stress on stress-related outcomes (Weaver et al., 2004; Champagne et al., 2006; Roth et al., 2009; McGowan et al., 2009). In particular, our work is consistent with human studies demonstrating that epigenetic marks may be one mechanism for the long term effects of early stress on health related outcomes, including metabolism regulation and inflammation (Mulligan, 2012; McDade et al., 2013). Collectively, these studies suggest that epigenetics may be an important mechanism for the complex geneenvironment interactions known to impact ontogeny. A future direction of this work is to apply these approaches in human bioarchaeology to understand the role of stress on health in our evolutionary ancestors. Previous studies have developed a number of methods to assess variation in childhood stress from skeletal remains, including nutritional stress via linear enamel hypoplasia (Klaus and Tam, 2009), growth impairments via Harris lines (Larsen, 1987), and even physical abuse via skeletal breakage (Wheeler et al., 2013). These stressors may have impact health outcomes via epigenetic mechanisms, but such techniques have not yet been widely validated in bioarchaeology. The present data suggests that early stress impacts PBMC methylation patterns, which predicted health outcomes. This may be of interest to bioarchaeologists because PBMC and bone DNA methylation patterns may overlap somewhat because PBMCs can transform into osteoclasts, which adhere to and are resorbed by bone (Boyle et al., 2003). In particular, bone resorption bays, or Howship’s Lacunae, in bone, show enriched numbers of osteoclasts, which may mean that these sites of bone tissue are most likely to overlap with blood epigenetic signatures. Further, the detection of DNA methylation patterns from bone DNA in ancient human and animal samples has been described (Briggs et al., 2010). These methods capitalize on the differential rates of deamination of methylated vs. unmethylated cyotsines in degraded aDNA. Thus, using DNA collected from regions of bone that include osteoclasts, future studies may characterize the role of DNA methylation in the link between stress and health in ancient humans. It is possible that epigenetic profiles in aDNA may be linked with childhood stress and predict health outcomes in much the same way blood epigenetic profiles linked the two in the present study. This is an exciting avenue of research that will further our understanding of the role of environment and epigenetics in health in human evolutionary history. ACKNOWLEDGMENTS The author thanks John Capitanio, Laura Del Rosso, Laura Agostonelli, Erna Tarara, Rudy Leibel, J. John Mann and the staff at the California National Primate Research Center, all of whom who were essential for the data collection in this study. The author has no conflicts of interest to declare. American Journal of Physical Anthropology 198 E. L. KINNALLY LITERATURE CITED Ainsworth MD. 1979. Infant–mother attachment. Am Psychologist 34:932–937. Boyle WJ, Simonet WS, Lacey DL. 2003. Osteoclast differentiation and activation. Nature 423(6937):337–342. Bardi M, Huffman MA. 2002. Effects of maternal style on infant behavior in Japanese macaques (Macaca fuscata). Develop Psychobiol 41:364–372. Beach SR, Brody GH, Todorov AA, Gunter TD, Philibert RA. 2011. Methylation at 5HTT mediates the impact of child sex abuse on women’s antisocial behavior: an examination of the Iowa adoptee sample. Psychosom Med 73:83–87. Bird A. 1986. CpG-rich islands and the function of DNA methylation. Nature, 321:209–213. Boyle WJ, Simonet WS, Lacey DL 2003. Osteoclast differentiation and activation. Nature 423:337–342. €bo S. Briggs AW, Stenzel U, Meyer M, Krause J, Kircher M, P€ aa 2010. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA. Nucl Acids Res 38(6): e87. Brummett BH, Siegler IC, Ashley-Koch A, Williams RB. 2011. Effects of 5HTTLPR on cardiovascular response to an emotional stressor. Psychosomat Med 73:318–322. Capitanio J, Mendoza S, Mason W, Maninger N. 2005. Rearing environment and hypothalamic-pituitary-adrenal regulation in young rhesus monkeys (Macaca mulatta). Develop Psychobiol 46:318–330. Champagne FA, Weaver IC, Diorio J, Dymov S, Szyf M, Meaney MJ. 2006. Maternal care associated with methylation of the estrogen receptor-alpha1b promoter and estrogen receptoralpha expression in the medial preoptic area of female offspring. Endocrinology 147:2909–2915. Chen X, Margolis KJ, Gershon MD, Schwartz GJ, Sze JY. 2012. Reduced serotonin reuptake transporter (SERT) function causes insulin resistance and hepatic steatosis independent of food intake. PLoS One 7(3):e32511. Conti G, Hansman C, Heckman JJ, Novak MF, Ruggiero A, Suomi SJ. 2012. Primate evidence on the late health effects of early-life adversity. PNAS U S A 109(23):8866–8871. Danese A, Moffitt TE, Harrington H, Milne BJ, Polanczyk G, Pariante CM, Poulton R, Caspi A. 2009. Adverse childhood experiences and adult risk factors for age-related disease: depression, inflammation, and clustering of metabolic risk markers. Arch Pediatr Adolesc Med 163(12):1135–1143. Essex MJ, Thomas Boyce W, Hertzman C, Lam LL, Armstrong JM, Neumann S, Kobor MS. 2013. Epigenetic vestiges of early developmental adversity: childhood stress exposure and DNA methylation in adolescence. Child Develop 84:58–75. Fairbanks L, McGuire M. 1988. Long-term effects of early mothering behavior on responsiveness to the environment in vervet monkeys. Develop Psychobiol 21:711–724. Fairbanks LA, McGuire MT.1995. Maternal condition and the quality of maternal care in vervet monkeys. Behaviour 132: 733–754. Franklin TB, Russig H, Weiss IC, Gr€ aff J, Linder N, Michalon A, Vizi S, Mansuy IM. 2010. Epigenetic transmission of the impact of early stress across generations. Biol Psychiatry 68(5):408–415. Giannaccini G, Betti L, Palego L, Marsili A, Santini F, Pelosini C, Lucacchini A. 2013. The expression of platelet serotonin transporter (SERT) in human obesity. BMC Neurosci 14:128. Harlow H, Zimmerman RR. 1959. Affectional responses in the infant monkey; orphaned baby monkeys develop a strong and persistent attachment to inanimate surrogate mothers. Science 130:421–432. Hofer MA. 1970. Environmental influences on the early development of autonomic cardiac regulation in the rat. Psychother Psychosomat Med 18:243–247. Ichise M, Vines D, Gura T, Anderson G, Suomi S, Higley J, Innis RB. 2006. Effects of early life stress on [11C]DASB positron emission tomography imaging of serotonin transporters American Journal of Physical Anthropology in adolescent peer- and mother-reared rhesus monkeys. J Neurosci 26:4638–4643. Jahng J, Kim J, Kim H, Kim B, Kang D, Lee J. 2007. Chronic food restriction in young rats results in depression- and anxiety-like behaviors with decreased expression of serotonin reuptake transporter. Brain Res 1150:100–107. Kinnally E, Lyons L, Abel K, Mendoza S, Capitanio, J. 2008. Effects of early experience and genotype on serotonin transporter regulation in infant rhesus macaques. Genes Brain Behav 7:481–486. Kinnally EL, Capitanio JP, Leibel R, Deng L, LeDuc C, Haghighi F, Mann JJ. 2010a. Epigenetic regulation of serotonin transporter expression and behavior in infant rhesus macaques. Genes Brain Behav 9:575–582. Kinnally EL, Tarara ER, Abel K, Mendoza SP, Lyons LA, Mason WA, Capitanio JP. 2010b. Serotonin transporter expression is influenced by early life stress and predicts disinhibited behavior in infant rhesus macaques. Genes Brain Behav 9:45–52. Klaus, HD, Tam ME. 2009. Contact in the Andes: bioarchaeology of systemic stress in Colonial M orrope, Peru. Am J Phys Anthropol 138(3):356–368. Larsen CS. 1987. Bioarchaeological interpretations of subsistence economy and behavior from human skeletal remains. Advances in archaeological method and theory 339–445. Lee JH, Kim HJ, Kim JG, Ryu V, Kim, BT, Kang DW, Jahng JW. 2007. Depressive behaviors and decreased expression of serotonin reuptake transporter in rats that experienced neonatal maternal separation. Neurosci Res 58:32–39. Lyons D, Mendoza S, Mason W. 1992. Sexual segregation in squirrel monkeys (Saimiri sciureus): a transactional analysis of adult social dynamics. J Comparat Psychol 106:323–330. Macchi F, Homberg JR, Calabrese F, Zecchillo C, Racagni G, Riva MA, Molteni R. 2013. Altered inflammatory responsiveness in serotonin transporter mutant rats. J Neuroinflammation 10:116. Mason W, Mendoza S. 1998. Generic aspects of primate attachments: parents, offspring and mates. Psychoneuroendocrinology 23:765–778. McCormack K, Sanchez M, Bardi M, Maestripieri D. 2006. Maternal care patterns and behavioral development of rhesus macaque abused infants in the first 6 months of life. Develop Psychobiol 48:537–550. McDade TW, Hoke M, Borja JB, Adair LS, Kuzawa, C. 2013. Do environments in infancy moderate the association between stress and inflammation in adulthood? Initial evidence from a birth cohort in the Philippines. Brain Behav Immun 31:23– 30. McGowan PO, Sasaki AC, D’Alessio A, Dymov S, Labont e B, Szyf M, Turecki G, Meaney MJ. 2009. Epigenetic regulation of the glucocorticoid receptor in human brain associates with childhood abuse. Nat Neurosci 12(3):342–348. Maestripieri D, Higley JD, Lindell S, Newman T, McCormack K, Sanchez M. 2006. Early maternal rejection affects the development of monoaminergic systems and adult abusive parenting in rhesus macaques (Macaca mulatta). Behav Neurosci 120:1017–1024. Maestripieri D, Wallen K, Carroll K. 1997. Infant abuse runs in families of group-living pigtail macaques. Child Abuse Neglect 21:465–471. Meaney MJ. 2010. Epigenetics and the biological definition of gene3 environment interactions. Child Develop 81:41–79. Miller J, Kinnally E, Ogden R, Oquendo M, Mann JJ, Parsey R. 2009. Reported childhood abuse is associated with low serotonin transporter binding in vivo in major depressive disorder. Synapse 63:565–573. Mulligan CJ. 2012. Methylation changes at NR3C1 in newborns associate with maternal prenatal stress exposure and newborn birth weight. Epigenetics 7:853–857. Oberlander T, Weinberg J, Papsdorf M, Grunau R, Misri S, Devlin A. 2008. Prenatal exposure to maternal depression, neonatal methylation of human glucocorticoid receptor gene (NR3C1) and infant cortisol stress responses. Epigenetics 3: 97–106. EARLY STRESS, EPIGENETICS, AND HEALTH Philibert RA, Sandhu H, Hollenbeck N, Gunter T, Adams W, Madan A. 2008. The relationship of 5HTT (SLC6A4) methylation and genotype on mRNA expression and liability to major depression and alcohol dependence in subjects from the Iowa Adoption Studies. Am J Med Genet B Neuropsychiatr Genetics 147:543–549. Provençal N, Suderman MJ, Caramaschi D, Wang D, Hallett M, Vitaro F, Tremblay RE, Szyf M. 2013. Differential DNA methylation regions in cytokine and transcription factor genomic loci associate with childhood physical aggression. PLoS One 8(8):e71691. Rosenblum L, Paully G. 1984. The effects of varying environmental demands on maternal and infant behavior. Child Develop 55:305–314. Roth TL, Lubin FD, Funk AJ, Sweatt JD. 2009. Lasting epigenetic influence of early-life adversity on the BDNF gene. Biol Psychiatry 65:760–769. Shinozaki G, Romanowicz M, Kung S, Rundell J, Mrazek D. 2012. Investigation of serotonin transporter gene (SLC6A4) by child abuse history interaction with body mass index and diabetes mellitus of White female depressed psychiatric inpatients. Psychiatr Genet 22:109–114. Stevenson-Hinde J, Simpson M. 1986. Mothers’ characteristics, interactions, and infants’ characteristics. Child Develop 52: 1246–1254. 199 Tost J, Gut I. 2007. DNA methylation analysis by pyrosequencing. Nature Protocols, 2(9), 2265–2275. Unternaehrer E, Luers P, Mill J, Dempster E, Meyer AH, Staehli S, Meinlschmidt G. 2012. Dynamic changes in DNA methylation of stress-associated genes (OXTR, BDNF) after acute psychosocial stress. Translational Psychiatry 2:e150. Wang D, Szyf M, Benkelfat C, Provençal N, Turecki G, Caramaschi D, Booij L. 2012. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression. PloS One 7:e39501. Weaver I, Cervoni N, Champagne F, D’Alessio A, Sharma S, Seckl J, Dymov S, Szyf M, Meaney MJ. 2004. Epigenetic programming by maternal behavior. Nat Neurosci 7:847–854. Wegman HL, Stetler C. 2009. A meta-analytic review of the effects of childhood abuse on medical outcomes in adulthood. Psychosomat Med 71:805–812. Wendelbo I, Mazzawi T, El-Salhy M. 2014. Increased serotonin transporter immunoreactivity intensity in the ileum of patients with irritable bowel disease. Mol Med Rep 9(1):180– 184. Wheeler SM, Williams L, Beauchesne P, Dupras TL. 2013. Shattered lives and broken childhoods: evidence of physical child abuse in ancient Egypt. Int J Paleopathol 3:71–81. American Journal of Physical Anthropology