Download Epigenetic plasticity following early stress predicts longterm health

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 155:192–199 (2014)
Epigenetic Plasticity Following Early Stress Predicts
Long-Term Health Outcomes in Rhesus Macaques
E. L. Kinnally*
California National Primate Research Center, University of California Davis, CA 95616
KEY WORDS
maternal care; serotonin transporter; rhesus macaque; development; DNA
methylation; inflammation; body condition
ABSTRACT
Early life stress has been linked with
poorer lifelong health outcomes across species, including
modern and ancient humans. Epigenetic mechanisms,
such as DNA methylation patterning of stress pathway
genes in stress-responsive tissue, may play an important
role in the long-term health effects of early stress across
species. The relationships among early maternal care
quality, DNA methylation patterns in a candidate stress
pathway gene (serotonin transporter, 5-HTT) linked
region in blood DNA, and adult health outcomes were
examined in male and female rhesus macaques, excellent models of human health. Male (n 5 12) and female
(n 5 32) infants were observed with their mothers for
the first 12 weeks of life and 5-HTT linked DNA methylation was measured in blood at 12 weeks of age. Approximately 8 years later, health-related measures were
collected for the 25 animals (6 male and 19 female) that
Early life stress in the form of maltreatment or
neglect can lead to disadvantageous health outcomes,
such as inflammatory and metabolic disease (Danese
et al., 2009; Wegman and Stetler, 2009). This phenomenon has been observed in animals (Conti et al., 2012),
living humans (Danese et al., 2009), and in skeletal artifacts of ancient humans, as is demonstrated and comprehensively reviewed in this issue (Vercellotti, this issue;
Klaus, this issue). These data suggest that the links
between early childhood stress and health outcomes are
highly evolutionarily conserved. Across species, there is
perhaps no more potent or common early stressor than
the disruption of attachment relationships. Poor care is
an experience common to most mammals, and its
adverse effects have been observed across species (Ainsworth, 1979; Fairbanks and McGuire, 1988; Mason and
Mendoza, 1998; Maestripieri et al., 2006). In many mammals, mothers provide sole care of offspring. There are
consistencies in stages and general properties of maternal care. Mothers exhibit a number of speciesappropriate, developmentally timed behaviors toward
their infants. Across species, these include tactile contact, nursing, face to face contact or mutual eye gaze,
which give way to maintaining proximity, and protection
from environmental threats when the infant becomes
increasingly ambulatory. Eventually mothers encourage
independence by providing a secure base for offspring to
explore the world or rejecting the infant and resisting
attempts to maintain proximity. Across species, two general dimensions of maternal care include positive contact
and negative contact or avoidance between mother and
infant. Variation in these dimensions has been observed
across mammalian species. One of the most commonly
Ó 2014 WILEY PERIODICALS, INC.
were available for study. Health composite scores were
generated using factor analysis of body condition, body
weight, and diagnosis of diarrhea during the lifespan.
Better quality maternal care predicted lower 5-HTT
linked methylation at 12 weeks of age. Lower 5-HTT
methylation, in turn, predicted better health composite
scores in adulthood, including better body condition,
greater body weight and absence of lifetime diarrhea.
These data suggest that the epigenetic regulation of 5HTT may be one biomarker of the link between early
stress and lifetime health trajectories. Future studies
will examine whether epigenetic signatures in modern
and ancient human DNA lends insight into stress and
health and natural selection in human evolutionary history. Am J Phys Anthropol 155:192–199, 2014. VC 2014
Wiley Periodicals, Inc.
used methods to assess variation in maternal care categorizes levels of protectiveness vs. aggression toward/
rejection of infants (Fairbanks and McGuire, 1988;
Stevenson-Hinde and Simpson, 1986). Non-human primate species such as rhesus macaques display natural
variation in maternal protectiveness vs. aggressiveness,
and this variation has been related to long-term behavioral outcomes for the infant (Stevenson-Hinde and
Simpson, 1986; Fairbanks and McGuire, 1988; Bardi
and Huffman, 2002; McCormack et al., 2006; Kinnally
et al., 2009). In non-human primates, experimental
deprivation of mother-infant contact has been linked
with poorer health outcomes (Conti et al., 2012), and
poor maternal care has been linked with greater infant
mortality (Fairbanks and McGuire, 1995), but the consequences of natural variation in maternal care on lifetime
health outcomes are not as well understood.
We have only recently begun to identify the intervening
molecular processes for the long-lasting effects of stress
(Meaney, 2010). Epigenetic plasticity in stress pathway
Funding Sources: P50 MH062185-08, P51 OD0011107 and R24
OD010962.
*Correspondence to: California National Primate Research Center, One Shields Avenue, Davis, CA 95616.
E-mail: [email protected]
Received 5 February 2014; accepted 22 June 2014
DOI: 10.1002/ajpa.22565
Published online 6 August 2014 in Wiley Online Library
(wileyonlinelibrary.com).
EARLY STRESS, EPIGENETICS, AND HEALTH
genes has recently emerged as a potential mechanism for
long-term health risks conferred by early life stress. Epigenetic marks are chemical modifications that change the
function, but not the sequence, of the genome. DNA methylation of cytosines within promoter region CpG islands
(regions dense with nucleotides cytosine and guanine,
bonded with a phosphate) typically limits gene expression
(Bird, 1986). Recent evidence suggests that epigenetic regulation of stress pathway genes are indeed sensitive to
aspects of the environment: DNA methylation patterning
in many stress pathway are changed following early
stress, and these changes have long-term neurobehavioral
and health consequences (Weaver et al., 2004; Roth et al.,
2008; McGowan et al., 2009; Provençal et al., 2013). However, these changes may be highly tissue- and genespecific. DNA methylation patterns are unique to each
cell and gene, meaning that there is opportunity for great
variation across tissues and genes (Bird, 1986). The serotonin transporter gene (5-HTT) is a candidate gene that is
expressed constitutively in neurons and lymphocytes, and
it has been strongly implicated in the effects of early life
stress. Neuronal and lymphocyte 5-HTT expression is
impaired following deprivation or abuse in multiple species (Ichise et al., 2006; Jahng et al., 2007; Lee et al.,
2007; Kinnally et al., 2008; Miller et al., 2009). Variation
in 5-HTT expression has also been linked with health outcomes including inflammation (Macchi et al., 2013), cardiovascular health (Brummett et al., 2011) and metabolism
(Chen et al., 2012; Shinozaki et al., 2012), possibly
through its role in stress coping (Kinnally et al., 2009),
but also through its actions in peripheral tissue (Chen
et al., 2012; Giannaccini et al., 2013; Wendelbo et al.,
2014). DNA methylation patterns in the 5-HTT gene are a
potential candidate mechanism for the links among early
stress, 5-HTT expression, and health because greater
peripheral blood DNA methylation regulates 5-HTT
expression in human and rhesus macaque PBMCs (Philibert et al., 2007, 2008; Kinnally et al., 2010a). Additionally, human studies have demonstrated that early life
stress is linked with greater methylation of the 5-HTT
regulatory region (Beach et al., 2011; Wang et al., 2012).
The effects of normative variation in maternal care on 5HTT methylation patterning, and their combined effects
on somatic health outcomes, are not known.
To investigate the role of epigenetic regulation of stress
pathway genes in the translation between early life stress
and health outcomes, 5-HTT linked DNA methylation patterns within peripheral blood mononuclear cell (PBMC)
DNA were measured in infant (90–120-day-old) rhesus
macaques. The present study tested the hypothesis that
naturally occurring early life stress (poor maternal care)
would be associated with higher DNA methylation. Eight
years later, infants were assessed for multiple health outcomes, including poor body condition, low body weight,
and incidence of a common inflammatory disease in macaques (diarrhea). It was hypothesized that both higher
quality maternal care and lower 5-HTT linked methylation would predict indicators of better health.
MATERIALS AND METHODS
Experimental subjects
Subjects were 44 (12 male and 32 female) infant rhesus macaques (Macaca mulatta), selected from over 150
infants born in five outdoor enclsoures. Infants were
raised with their mothers in one of five half-acre outdoor
enclosures at the California National Primate Research
193
Center (CNPRC) and typically remained in these groups
into adulthood. Each field cage contained a large social
group (40–140 members) comprising at least six distinct
matrilines with extended kin networks and animals of
all age/sex classes. Mean pairwise relatedness between
subjects was 3%. Mothers (primiparous n 5 22; multiparous n 5 22) ranged from 3.5 to 17 years of age with a
mean of 6.5 years of age. All procedures were conducted
with approval by the UC Davis Institutional Animal
Care and Use Committee.
Procedures
Mother–infant observations. Subjects were observed
in their social groups three times weekly (5 min per
observation) between 07:00 h and 13:00 h, during postnatal weeks 1–12 in 2006, until the day animals underwent a biobehavioral assessment that included blood
sampling an infant body weight measurement (described
below). Mother–infant interactions were coded using a
transactional coding system describing the overall theme
of an interaction from the perspectives of the initiator
and the recipient (Lyons et al., 1992; Kinnally et al.,
2010b). A transaction was defined as a change from one
state of association to a new state. A protective themed
transaction was one in which mothers pulled the infant
toward her ventrum. Affiliative themes included any
transaction with physical (non-aggressive) contact, including touching or grooming. Accommodating transactions
occurred when the mother moved her body to facilitate
an infant overture, as in huddling or stopping her activity
to facilitate the infant’s overture. Neutral transactions
included approaching the infant or minimal response to
infant overture. Resistant transactions were defined as
moving away upon infant approach. An aggressive theme
was defined as one including threatening, biting, chasing,
scratching, flattening (pressing into the ground), dragging, pushing away, and/or grabbing infants. Inter-rater
reliability for transactional coding was 85% or better.
Maternal care scores. Rate of transactions in which
the mother initiated each of type of transaction or
responded to an infant’s overture with each theme were
calculated per 5-min observation. Factor analysis was
used to detect the latent factors underlying maternal
behavior. Three factors were extracted explaining 58%
variance. The first two factors described 45% of this variance, and thus only these primary factors were analyzed. Factor one described protectiveness, loading
positively maternal rate of initiating protective overtures
(factor loading 0.634), initiating affiliative overtures (factor loading 0.412), responding protectively (factor loading 0.673), responding affiliatively (factor loading 0.751),
and responding accommodatingly to infant overtures
(factor loading 0.710). Factor two described maternal
aggressiveness, loading rates of initiating aggressiveness
(factor loading 0.801), rates of aggressive responses to
infant overtures (factor loading 0.577), and rates at
which mothers initiated neutral transactions (factor
loading 0.744). Maternal care scores were generated by
subtracting aggressiveness factor scores from protectiveness factor scores.
Blood sampling and peripheral blood mononuclear
cell extraction. Procedures for blood sampling and
sample preparation was conducted as described
American Journal of Physical Anthropology
194
E. L. KINNALLY
previously (Capitanio et al., 2005; Kinnally et al., 2010a,
b). When infants were 90–120 days of age, and after
mother–infant observations were collected, blood was
sampled via femoral venipuncture four times over a 25-h
period and each sample was decanted into EDTA-treated
collection vials. Blood was collected during a standardized
biobehavioral assessment during which experimental conditions are consistent across all subjects. The first sample
was collected at 11:00 h (AM sample), approximately 2.0
h following social separation/relocation. The second blood
sample was collected approximately 5.0 h after the first
sample at 16:00 h (PM sample). The third blood sample
was collected 16.0 h later after dexamethasone treatment
(DEX sample) and the fourth sample was collected 30
min later, after treatment with adrenocorticotropic hormone (ACTH sample). The present study used PM samples collected in infancy as described in a previous study
(Kinnally et al., 2010a), because the present study represented a follow up of that earlier study. Whole blood samples were centrifuged for 10 min at 3000 RPM at 4 C.
Plasma was removed and decanted into 1.5 ml sarstedt
(VWR, South Plainfield, NJ) tubes for storage at 280 C.
Peripheral blood mononuclear cells (PBMCs) were isolated from the remaining sample within 1 h of sampling.
White blood cells were aliquotted to RPMI media (Invitrogen, Inc., Carlsbad, CA) supplemented with 10% fetal
bovine serum and applied to lymphocyte separation
media (MP Biomedicals, Solon, OH). Samples were centrifuged at 2000 RPM at 23 C for 30 min. The purified
phase was washed three times with media, centrifuged,
and then resuspended in Trizol RNA stabilizing reagent
(Invitrogen, Inc., Carlsbad, CA). Samples were stored for
no longer than one year at 280 C.
5-HTT-linked CpG methylation analysis. DNA was
extracted from Trizol suspension according to manufacturer’s instructions and converted for methylation
sequencing using a commercially available sodium bisulfite modification kit (Qiagen, Inc., Valencia, CA). DNA
methylation patterns in a CpG island on the non-coding
complementary strand of the 5-HTT promoter were
quantified. The target region was amplified using polymerase chain reaction. PCR amplification was conducted
with three primer sets (Integrated DNA Technologies)
targeting contiguous regions of the first 650 bp of the 5HTT CpG island. Primers were as follows: F1 50 GGG
AAGAAGTTTTGGAAAGA AA30 R1 50 CCACTATCTAAAA
ATCAAACCATATAA30 ; F2 50 GGTTGTAA AGTTATTGTA
ATTATAAAGG30 ; R2 50 TTTCTTTCCAAAACTTCTTCC
C30 ; F3 50 GGTTTTTTATATGGTTTGATTTTTAGATA30 ;
R3 50 CCTACCCTACCCTACCT ACTACTCC30 . Reverse
primers were tagged with biotin. Biotin-labeled amplicons were captured on streptavidin beads (Roche, Inc.,
Basel, Switzerland), washed sequentially with 70% ethanol, denaturing buffer (10 mM sodium hydroxide) and
washing buffer (10 mM Tris, pH 7.6). Beads with amplicon were incubated with binding buffer (10 mM Tris,
2 M NaCl, 1 mM EDTA, 0.1% Tween 20, pH 7.6) and 0.4
lM sequencing primer at 80 C to anneal primers to the
template. Amplicons were subjected to pyrosequencing
(Tost and Gut, 2007; Biotage, Inc., Uppsala, Sweden).
The quantity of methylated residues was assessed using
Q-CpG software (Biotage, Inc.). Each amplicon was
sequenced in two to three separate reactions. Sequencing
primers
were
as
follows:
SEQ1
50 AAGAAGTCTTGGAAAGAA A30 ; SEQ2 50 TTGTAGGGT
American Journal of Physical Anthropology
TGTGTTAGG30 ; SEQ3 50 AAGTTATTGTAATTATAAA GG
AAT30 ; SEQ4 50 GGGYGTAGGGTTAGGAT30 ; SEQ5 50 AT
GGTTTGATTTTTAG ATAG30 ; SEQ6 50 TGAGGYGAATAA
SEQ7
50 TAGGAGGGCAGG
GAT30 .
ATTTAATG30 ;
Sequencing was conducted using the PyroMark PSQ MA
instrument and PyroGold reagents (Biotage, Inc., Uppsala, Sweden). Proportion of methylated residues in each
reaction at each locus was assessed using Q-CpG software (Biotage, Inc. Uppsala, Sweden). Six residues were
not estimable for any subject, and were removed from
the analysis. Data were analyzed for subjects with at
least 70% coverage (mean 5 85.4%) of a total of 59 residues. To facilitate comparison among subjects, all samples were run on one plate for each sequencing reaction.
A subset of samples was assayed twice, and underwent
repeated sodium bisulfite conversion, PCR amplification
and pyrosequencing. Coefficient of variance between
these samples was less than 30%, indicating adequate
reliability of methylation estimates. A subset of these
analyzed samples was used in an earlier study (Kinnally
et al., 2010a).
Adult health measures. Approximately 90 months (8
years) later, 25 of the original 44 animals were available
for health outcome follow-up. Some had died of natural
causes or been humanely euthanized due to chronic
health problems (n 5 15), while others had been relocated to another facility (n 5 3) or assigned to an experimental protocol (n 5 1). The remaining subjects had
reached 93 months of age in the CNPRC breeding facility (n 5 25), and lived in either in outdoor or indoor
enclosures. In the remaining animals at the CNPRC, we
collected the most recent weight measurement (in kg) at
93 months of age, most recent standardized body condition measurement by CNPRC staff at 93 months of age
(likert scale of 1–5, a score of 1 indicating poorest and 5
indicating best body condition), and presence of a common inflammatory disease (diarrhea), by 93 months of
age. Presence or absence of diarrhea was scored dichotomously (scored as a 0 or 1) based on whether the animal
had experienced diarrhea one time or more in their
lives, either having been hospitalized for this condition,
or observed by CNPRC staff to exhibit diarrhea. Body
condition data was not available for one subject, so a
mean replacement body score was employed to generate
this subject’s health factor score. Adult health composite
scores were generated using principal components analysis with promax rotation. High health composite scores
reflect greater body weight (factor loading 0.865), good
body condition (factor loading 0.898), and absence of
diarrhea diagnosis (20.346 factor loading). See Table 1
for range, mean, and standard deviation of all measures.
Data analysis
Multiple backward regression was used to determine
predictors of infant 5-HTT linked methylation patterns
and adult health. This backward elimination statistical
technique was employed to determine which predictors
contributed unique and significant variance to the models, and to remove those that did not. Social hierarchy
rank, infant weight at 3–4 months of age, and sex were
considered as possible demographic variables that could
influence either 5-HTT linked methylation or health outcomes because they may influence aspects of social life.
The first model therefore included 5-HTT methylation as
195
EARLY STRESS, EPIGENETICS, AND HEALTH
TABLE 1. Descriptive information for predictors and outcome measures in infancy (n 5 44) and in adulthood (n 5 25)
Variables
Age
Infancy (n 5 44)
Maternal care scores
5-HTT linked C-methylation (%)
Maternal rank (rank/group size)
Body weight (kg)
Adult follow-up (n 5 25)
Maternal care scores
5-HTT linked C-methylation (%)
Maternal rank
Body weight (kg)
Body condition scores (1–5)
Presence lifetime diarrhea
Yes (n 5 12)
No (n 5 13)
Range
Mean
SD
months
months
months
months
24.80 to 3.50
1.12–15.54
0.02–0.98
0.51–1.22
20.08
4.36
0.43
0.87
1.41
2.86
0.27
0.14
3–4 months
3–4 months
3–4 months
93 months
93 months
93 months
24.80 to 1.90
1.12–9.19
0.02–0.97
6.18–16.18
1.50–4.00
0.00–1.00
20.37
4.00
0.43
8.93
2.85
NA
1.50
2.35
0.28
2.33
0.54
NA
3–4
3–4
3–4
3–4
the dependent variable and maternal care scores, infant
weight, maternal social hierarchy rank as a function of
the total number of adult females in the group, and
infant sex as potential predictors. The second model
tested the association of these predictors and 5-HTT
linked methylation with adult health composite scores.
Post hoc regression analyses were conducted with each
health outcome as a dependent variable and 5-HTT
methylation, maternal care scores, infant weight, maternal social hierarchy rank, and infant sex as potential
predictors. Backward multiple regression was used for
body weight and body condition measures and backward
logistic regression was conducted for presence or absence
of diarrhea. Enclosure of birth, group size, maternal parity, nor most recent housing conditions (indoors or outdoors at the CNPRC) statistically influenced methylation
or health measures (ANOVAs; P > 0.05), so these variables were not included in any analyses.
To ensure that our living population did not differ significantly from animals that had been relocated, died, or
placed on an experimental protocol, we compared maternal care scores and 5-HTT linked methylation ratios
between subjects that lived until follow-up vs. (1) those
that died of natural causes or euthanasia due to disease,
(2) relocated to other facilities, in two separate univariate analyses of variance controlling for the effects of sex
and maternal rank, and in the case of 5-HTT methylation, controlling for maternal care scores. This analysis
could not be conducted for those assigned to experimental protocols because only one subject from our original
study had been so assigned. All statistical analyses were
conducted using SPSS 21.0. Two-tailed significance level
was set at P 0.05.
TABLE 2. Regression model describing the effects of infant sex,
infant weight, maternal rank, and maternal care scores on
infant blood 5-HTT linked methylation
Variables
Maternal rank
Infant sex
Infant weight
Maternal care scores
a
ß
T
p
20.015
20.012
20.174
20.319
0.103
20.076
21.143
22.178
0.918
0.940
0.260
0.035a
P < 0.05.
Fig. 1. Lower maternal care scores predict higher blood 5HTT linked DNA methylation.
RESULTS
Predictors of 5-HTT linked methylation
The model predicting infant methylation patterns was
significant (F(1, 43) 5 4.745, P 5 0.035, adjusted
R2 5 0.080; see Table 2 and Fig. 1). As predicted, lower
maternal care scores predicted higher average 5-HTT
linked methylation in PBMC DNA (t 5 22.178,
P 5 0.035). 5-HTT methylation was not predicted by
infant sex (t 5 20.076, P 5 0.940) or maternal social
rank (t 5 0.103, P 5 0.918). Maternal care scores did not
differ between our follow-up subjects and subjects that
had not been available for follow-up due to death (F(3,
36) 5 2.535, P 5 0.120) or relocation to another facility
(F(3, 24) 5 0.422, P 5 0.522).
Predictors of health outcomes
The model predicting health scores was significant
(F(2, 23) 5 7.892, P 5 0.003, adjusted R2 5 0.375: see
Table 3 and Fig. 2). Lower DNA methylation predicted
higher health composite scores, indicating better body
condition, greater weight, and lower risk of diarrhea
(t 5 22.404, P 5 0.026). Sex also predicted higher health
composite scores, with males having higher health
American Journal of Physical Anthropology
196
E. L. KINNALLY
TABLE 3. Regression model describing the effects of infant sex,
infant weight, maternal rank, maternal care scores, and infant
blood 5-HTT linked methylation on adult health composite scores
Variables
Maternal rank
Infant sex
Infant weight
Maternal care scores
5-HTT linked methylation %
a
ß
T
P
20.118
0.419
20.231
0.081
20.409
20.710
2.459
21.249
0.425
22.404
0.486
0.023a
0.223
0.676
0.026a
P < 0.05.
Fig. 2. Higher blood 5-HTT linked methylation in infancy
predicts poorer health outcomes in adulthood.
composite scores (t 5 2.459, P 5 0.023). Neither maternal
care (t 5 2.425, P 5 0.676) nor maternal rank
(t 5 20.710, P 5 0.486) predicted health composite scores.
Post-hoc regression analyses of individual health outcomes show that methylation significantly predicted
body weight (F(1, 23) 5 17.906, P < 0.0001, adjusted
R2 5 0.585), and tended to predict body condition (F(1,
23) 5 3.977, P 5 0.059, adjusted R2 5 0.115) and diarrhea
risk (F(1, 23) 5 3.784, P 5 0.052, adjusted R2 5 0.182),
while sex predicted only body weight (F(1, 23) 5 17.906,
P < 0.0001, adjusted R2 5 0.585), such that males were
heavier. 5-HTT methylation did not differ between our
follow-up subjects and subjects that had not been available for follow-up due to death (F(4, 35) 5 2.969,
P 5 0.094) or relocation to another facility (F(4,
23) 5 0.025, P 5 0.875).
DISCUSSION AND CONCLUSIONS
Previous studies have suggested that epigenetic regulation of stress pathway genes plays a pivotal role in the
translation between early life stress and health-related
outcomes (Meaney, 2010; Provençal et al., 2013). In this
long-term developmental study, it is demonstrated that
poorer maternal care reprograms DNA methylation
patterns in a CpG island linked with the 5-HTT gene
early in life, and that this reprogramming predicts adult
health outcomes in a provisioned, semi-naturalistically
housed population of rhesus macaques.
The effects of early attachment relationships are perhaps one of the most formative for long-term neurobehaAmerican Journal of Physical Anthropology
vioral and health trajectories. High quality maternal care
predicted lower DNA methylation in a 5-HTT linked CpG
island in PBMC DNA. These effects were independent of
demographic factors that may also influence social life,
such as social hierarchy rank. Our findings are consistent
with a body of literature that suggests that stressful early
experiences result epigenetic reorganization in stress
pathway genes (Weaver et al., 2004; Champagne et al.,
2006; Roth et al., 2009). However, it is somewhat inconsistent with a previous study in which no difference in 5HTT methylation between individuals exposed to control
rearing or an experimental early life stressor, nursery
rearing, in macaques (Kinnally et al., 2010a). It is possible
that infants were sensitive to variation in maternal
behavior in this study due to the singular importance of
the mother-infant relationship (Harlow and Zimmerman,
1959; Ainsworth, 1979; Mason and Mendoza, 1998).
Because of the developmental importance of this relationship, incremental variation in the quality of mother-infant
interactions results in pronounced variation in infant
development (Rosenblum and Paully, 1984; StevensonHinde and Simpson, 1986; Fairbanks and McGuire, 1988;
Maestripieri et al., 1997). This may point to a unique and
powerful role for the mother–infant relationship in epigenetic and health development. Indeed, in parallel with our
findings, variation in the quality of the attachment relationship has been repeatedly linked with alterations in
the 5-HT system (Maestripieri et al., 2006; Kinnally et al.,
2010b), as well as many other physiological systems
(Hofer, 1970; Meaney, 2010; McCormack et al., 2006). It is
also possible that gene–environment interactions play a
role in epigenetic programming, and that maternal cues
are central to these interactions. If so, nursery rearing
may not have been sufficient to elicit differences in methylation patterns in the previous study. Our study, however, cannot systematically examine the role of genetic
factors on these results. Though our infant subjects were
unrelated, it is possible that the effects of maternal care
on infant epigenetic development were not entirely environmental, but also had genetic underpinnings. For example, it is possible that maternal behavior, 5-HTT linked
methylation patterns, and health outcomes have a common genetic basis. If so, it is possible that infants inherited this genetic background, which was the actual
predictor of infant outcomes. Future studies will eliminate
confounding genetic factors by cross-fostering infants to
unrelated mothers in new social groups. Nonetheless, 5HTT methylation patterns may represent a biomarker of
early stress in rhesus macaques. Our findings provide one
example of the link between variation in early experiences
and epigenetic organization in primates.
Epigenetic reprogramming following poor maternal
care in infancy, in turn, predicted health outcomes in
adulthood. Individuals that displayed higher methylation early in life had lower adult health composite
scores, as indexed by body condition, body weight, and
disease risk. Sex also predicted our health composite
measure, but post-hoc analyses show that this result is
due to normative sex differences in body weight. Sex did
not predict body condition or diarrhea risk. This finding
suggests that one of the consequences of poor maternal
care is higher 5-HTT linked methylation and poorer
health in males and females, but surprisingly, maternal
care scores alone did not predict health outcomes. It is
possible that an unmeasured correlate of maternal care
actually predicted both 5-HTT methylation and health,
and that this unknown factor actually drove our results.
EARLY STRESS, EPIGENETICS, AND HEALTH
Possible mediating factors include maternal health or
adverse social conditions. Another possible reason for
this paradoxical finding is that in our subjects who survived to eight years of age, there were intervening exposures (e.g., social, dietary, pathogenic, or physiological
factors) that may also have influenced health. These
exposures may have obscured the connection between
early experience and lifelong health outcomes. This
rather highlights the importance of developmental epigenetic programming: while the psychological effects of
early experiences may be diminished with time, the epigenome may persist in its effects on physiology and
health.
The mechanisms by which enhanced methylation may
shift health trajectories are not yet known. Peripheral
regulation of 5-HTT plays a direct role in pathogenesis
of diarrhea (Wendelbo et al., 2014) and in metabolism
(Chen et al., 2012; Giannaccini et al., 2013), which could
explain the effects of epigenetic regulation of blood 5HTT on our health composite measure. It is also possible
that PBMC dysregulation of 5-HTT corresponds with the
reorganization of multiple neural, endocrine, and
immune changes in response to early stress, and that
epigenetic changes in these systems underlie health outcomes. Similar changes have been observed following
early stress in neural and non-neural tissue, including
blood (Oberlander et al., 2008; Beach et al., 2011), buccal
cells (Essex et al., 2013), and sperm (Franklin et al.,
2010), despite the fact DNA methylation patterns are
not necessarily consistent across tissue (Bird, 1986). Our
results indicate that peripheral epigenetic regulation of
5-HTT may be one useful biomarker of risk for poor
health outcomes in primates.
One limitation of this study was that only 25 out of 44
of our original subjects were available for follow up
health studies. Fifteen subjects had died due to natural
causes or been humanely euthanized for chronic health
problems. These subjects did not differ in the maternal
care scores they received, or, paradoxically, in 5-HTT
methylation. One might expect that if 5-HTT methylation predicted poor health outcomes, individuals that
had died due to chronic health problems should have
had higher DNA methylation. It is difficult to assess the
implications of this finding for our study, because some
animals had received humane euthanasia before natural
death, potentially obscuring epigenetic links with mortality. Future studies should examine the strength of
these links. An additional limitation of the study was
that our DNA sample was collected approximately 8 h
after a stressful separation of infants from mothers. It is
now known that some, but not all, DNA methylation
patterns in blood may be dynamically regulated during
stress, changing by as much as 1% in blood cells immediately following stress (Unternaehrer et al., 2012).
Thus, it is possible that our blood methylation patterns
reflect post-stress changes, rather than “basal” methylation patterns. A previous study associated post-stressor
5-HTT linked methylation with baseline 5-HTT expression (Kinnally et al., 2010a), which may suggest that
small or brief changes in methylation may not substantially affect gene expression itself. Further research in
this area is clearly warranted.
These findings may be of particular interest to the
fields of modern and ancient human biology. Understanding the importance of epigenetics in the adverse
health effects of early stress in human evolutionary history may be challenging in the absence of available
197
model tissues to extract from modern and ancient
humans. By characterizing links between stress, blood
DNA methylation patterns, and health in primates, this
study may provide a platform for human population biologists and bioarchaeologists to understand the role of
epigenetic plasticity in modern and ancient humans
using blood samples or ancient DNA (aDNA) from skeletal remains. Our work is consistent with a large body of
work demonstrating that epigenetic mechanisms may
play a role in the long-term effects of early stress on
stress-related outcomes (Weaver et al., 2004; Champagne
et al., 2006; Roth et al., 2009; McGowan et al., 2009). In
particular, our work is consistent with human studies
demonstrating that epigenetic marks may be one mechanism for the long term effects of early stress on health
related outcomes, including metabolism regulation and
inflammation (Mulligan, 2012; McDade et al., 2013). Collectively, these studies suggest that epigenetics may be
an important mechanism for the complex geneenvironment interactions known to impact ontogeny. A
future direction of this work is to apply these approaches
in human bioarchaeology to understand the role of stress
on health in our evolutionary ancestors. Previous studies
have developed a number of methods to assess variation
in childhood stress from skeletal remains, including
nutritional stress via linear enamel hypoplasia (Klaus
and Tam, 2009), growth impairments via Harris lines
(Larsen, 1987), and even physical abuse via skeletal
breakage (Wheeler et al., 2013). These stressors may
have impact health outcomes via epigenetic mechanisms,
but such techniques have not yet been widely validated
in bioarchaeology. The present data suggests that early
stress impacts PBMC methylation patterns, which predicted health outcomes. This may be of interest to bioarchaeologists because PBMC and bone DNA
methylation patterns may overlap somewhat because
PBMCs can transform into osteoclasts, which adhere to
and are resorbed by bone (Boyle et al., 2003). In particular, bone resorption bays, or Howship’s Lacunae, in
bone, show enriched numbers of osteoclasts, which may
mean that these sites of bone tissue are most likely to
overlap with blood epigenetic signatures. Further, the
detection of DNA methylation patterns from bone DNA
in ancient human and animal samples has been
described (Briggs et al., 2010). These methods capitalize
on the differential rates of deamination of methylated
vs. unmethylated cyotsines in degraded aDNA. Thus,
using DNA collected from regions of bone that include
osteoclasts, future studies may characterize the role of
DNA methylation in the link between stress and health
in ancient humans. It is possible that epigenetic profiles
in aDNA may be linked with childhood stress and predict health outcomes in much the same way blood epigenetic profiles linked the two in the present study. This is
an exciting avenue of research that will further our
understanding of the role of environment and epigenetics in health in human evolutionary history.
ACKNOWLEDGMENTS
The author thanks John Capitanio, Laura Del Rosso,
Laura Agostonelli, Erna Tarara, Rudy Leibel, J. John
Mann and the staff at the California National Primate
Research Center, all of whom who were essential for the
data collection in this study. The author has no conflicts
of interest to declare.
American Journal of Physical Anthropology
198
E. L. KINNALLY
LITERATURE CITED
Ainsworth MD. 1979. Infant–mother attachment. Am Psychologist 34:932–937.
Boyle WJ, Simonet WS, Lacey DL. 2003. Osteoclast differentiation and activation. Nature 423(6937):337–342.
Bardi M, Huffman MA. 2002. Effects of maternal style on infant
behavior in Japanese macaques (Macaca fuscata). Develop
Psychobiol 41:364–372.
Beach SR, Brody GH, Todorov AA, Gunter TD, Philibert RA.
2011. Methylation at 5HTT mediates the impact of child sex
abuse on women’s antisocial behavior: an examination of the
Iowa adoptee sample. Psychosom Med 73:83–87.
Bird A. 1986. CpG-rich islands and the function of DNA methylation. Nature, 321:209–213.
Boyle WJ, Simonet WS, Lacey DL 2003. Osteoclast differentiation and activation. Nature 423:337–342.
€bo S.
Briggs AW, Stenzel U, Meyer M, Krause J, Kircher M, P€
aa
2010. Removal of deaminated cytosines and detection of
in vivo methylation in ancient DNA. Nucl Acids Res 38(6):
e87.
Brummett BH, Siegler IC, Ashley-Koch A, Williams RB. 2011.
Effects of 5HTTLPR on cardiovascular response to an emotional stressor. Psychosomat Med 73:318–322.
Capitanio J, Mendoza S, Mason W, Maninger N. 2005. Rearing
environment and hypothalamic-pituitary-adrenal regulation
in young rhesus monkeys (Macaca mulatta). Develop Psychobiol 46:318–330.
Champagne FA, Weaver IC, Diorio J, Dymov S, Szyf M, Meaney
MJ. 2006. Maternal care associated with methylation of the
estrogen receptor-alpha1b promoter and estrogen receptoralpha expression in the medial preoptic area of female offspring. Endocrinology 147:2909–2915.
Chen X, Margolis KJ, Gershon MD, Schwartz GJ, Sze JY. 2012.
Reduced serotonin reuptake transporter (SERT) function
causes insulin resistance and hepatic steatosis independent of
food intake. PLoS One 7(3):e32511.
Conti G, Hansman C, Heckman JJ, Novak MF, Ruggiero A,
Suomi SJ. 2012. Primate evidence on the late health effects
of early-life adversity. PNAS U S A 109(23):8866–8871.
Danese A, Moffitt TE, Harrington H, Milne BJ, Polanczyk G,
Pariante CM, Poulton R, Caspi A. 2009. Adverse childhood
experiences and adult risk factors for age-related disease:
depression, inflammation, and clustering of metabolic risk
markers. Arch Pediatr Adolesc Med 163(12):1135–1143.
Essex MJ, Thomas Boyce W, Hertzman C, Lam LL, Armstrong
JM, Neumann S, Kobor MS. 2013. Epigenetic vestiges of
early developmental adversity: childhood stress exposure and
DNA methylation in adolescence. Child Develop 84:58–75.
Fairbanks L, McGuire M. 1988. Long-term effects of early
mothering behavior on responsiveness to the environment in
vervet monkeys. Develop Psychobiol 21:711–724.
Fairbanks LA, McGuire MT.1995. Maternal condition and the
quality of maternal care in vervet monkeys. Behaviour 132:
733–754.
Franklin TB, Russig H, Weiss IC, Gr€
aff J, Linder N, Michalon
A, Vizi S, Mansuy IM. 2010. Epigenetic transmission of the
impact of early stress across generations. Biol Psychiatry
68(5):408–415.
Giannaccini G, Betti L, Palego L, Marsili A, Santini F,
Pelosini C, Lucacchini A. 2013. The expression of platelet
serotonin transporter (SERT) in human obesity. BMC Neurosci 14:128.
Harlow H, Zimmerman RR. 1959. Affectional responses in the
infant monkey; orphaned baby monkeys develop a strong and
persistent attachment to inanimate surrogate mothers. Science 130:421–432.
Hofer MA. 1970. Environmental influences on the early development of autonomic cardiac regulation in the rat. Psychother
Psychosomat Med 18:243–247.
Ichise M, Vines D, Gura T, Anderson G, Suomi S, Higley J,
Innis RB. 2006. Effects of early life stress on [11C]DASB positron emission tomography imaging of serotonin transporters
American Journal of Physical Anthropology
in adolescent peer- and mother-reared rhesus monkeys. J
Neurosci 26:4638–4643.
Jahng J, Kim J, Kim H, Kim B, Kang D, Lee J. 2007. Chronic
food restriction in young rats results in depression- and
anxiety-like behaviors with decreased expression of serotonin
reuptake transporter. Brain Res 1150:100–107.
Kinnally E, Lyons L, Abel K, Mendoza S, Capitanio, J. 2008.
Effects of early experience and genotype on serotonin transporter regulation in infant rhesus macaques. Genes Brain
Behav 7:481–486.
Kinnally EL, Capitanio JP, Leibel R, Deng L, LeDuc C,
Haghighi F, Mann JJ. 2010a. Epigenetic regulation of serotonin transporter expression and behavior in infant rhesus
macaques. Genes Brain Behav 9:575–582.
Kinnally EL, Tarara ER, Abel K, Mendoza SP, Lyons LA,
Mason WA, Capitanio JP. 2010b. Serotonin transporter
expression is influenced by early life stress and predicts disinhibited behavior in infant rhesus macaques. Genes Brain
Behav 9:45–52.
Klaus, HD, Tam ME. 2009. Contact in the Andes: bioarchaeology of systemic stress in Colonial M
orrope, Peru. Am J Phys
Anthropol 138(3):356–368.
Larsen CS. 1987. Bioarchaeological interpretations of subsistence economy and behavior from human skeletal remains.
Advances in archaeological method and theory 339–445.
Lee JH, Kim HJ, Kim JG, Ryu V, Kim, BT, Kang DW, Jahng
JW. 2007. Depressive behaviors and decreased expression of
serotonin reuptake transporter in rats that experienced neonatal maternal separation. Neurosci Res 58:32–39.
Lyons D, Mendoza S, Mason W. 1992. Sexual segregation in
squirrel monkeys (Saimiri sciureus): a transactional analysis
of adult social dynamics. J Comparat Psychol 106:323–330.
Macchi F, Homberg JR, Calabrese F, Zecchillo C, Racagni G,
Riva MA, Molteni R. 2013. Altered inflammatory responsiveness in serotonin transporter mutant rats. J Neuroinflammation 10:116.
Mason W, Mendoza S. 1998. Generic aspects of primate attachments: parents, offspring and mates. Psychoneuroendocrinology 23:765–778.
McCormack K, Sanchez M, Bardi M, Maestripieri D. 2006.
Maternal care patterns and behavioral development of rhesus
macaque abused infants in the first 6 months of life. Develop
Psychobiol 48:537–550.
McDade TW, Hoke M, Borja JB, Adair LS, Kuzawa, C. 2013. Do
environments in infancy moderate the association between
stress and inflammation in adulthood? Initial evidence from a
birth cohort in the Philippines. Brain Behav Immun 31:23–
30.
McGowan PO, Sasaki AC, D’Alessio A, Dymov S, Labont
e B,
Szyf M, Turecki G, Meaney MJ. 2009. Epigenetic regulation
of the glucocorticoid receptor in human brain associates with
childhood abuse. Nat Neurosci 12(3):342–348.
Maestripieri D, Higley JD, Lindell S, Newman T, McCormack
K, Sanchez M. 2006. Early maternal rejection affects the
development of monoaminergic systems and adult abusive
parenting in rhesus macaques (Macaca mulatta). Behav Neurosci 120:1017–1024.
Maestripieri D, Wallen K, Carroll K. 1997. Infant abuse runs in
families of group-living pigtail macaques. Child Abuse
Neglect 21:465–471.
Meaney MJ. 2010. Epigenetics and the biological definition of
gene3 environment interactions. Child Develop 81:41–79.
Miller J, Kinnally E, Ogden R, Oquendo M, Mann JJ, Parsey R.
2009. Reported childhood abuse is associated with low serotonin transporter binding in vivo in major depressive disorder. Synapse 63:565–573.
Mulligan CJ. 2012. Methylation changes at NR3C1 in newborns
associate with maternal prenatal stress exposure and newborn birth weight. Epigenetics 7:853–857.
Oberlander T, Weinberg J, Papsdorf M, Grunau R, Misri S,
Devlin A. 2008. Prenatal exposure to maternal depression,
neonatal methylation of human glucocorticoid receptor gene
(NR3C1) and infant cortisol stress responses. Epigenetics 3:
97–106.
EARLY STRESS, EPIGENETICS, AND HEALTH
Philibert RA, Sandhu H, Hollenbeck N, Gunter T, Adams W,
Madan A. 2008. The relationship of 5HTT (SLC6A4) methylation and genotype on mRNA expression and liability to major
depression and alcohol dependence in subjects from the Iowa
Adoption Studies. Am J Med Genet B Neuropsychiatr Genetics 147:543–549.
Provençal N, Suderman MJ, Caramaschi D, Wang D, Hallett M,
Vitaro F, Tremblay RE, Szyf M. 2013. Differential DNA methylation regions in cytokine and transcription factor genomic
loci associate with childhood physical aggression. PLoS One
8(8):e71691.
Rosenblum L, Paully G. 1984. The effects of varying environmental demands on maternal and infant behavior. Child
Develop 55:305–314.
Roth TL, Lubin FD, Funk AJ, Sweatt JD. 2009. Lasting epigenetic influence of early-life adversity on the BDNF gene. Biol
Psychiatry 65:760–769.
Shinozaki G, Romanowicz M, Kung S, Rundell J, Mrazek D.
2012. Investigation of serotonin transporter gene (SLC6A4)
by child abuse history interaction with body mass index and
diabetes mellitus of White female depressed psychiatric inpatients. Psychiatr Genet 22:109–114.
Stevenson-Hinde J, Simpson M. 1986. Mothers’ characteristics,
interactions, and infants’ characteristics. Child Develop 52:
1246–1254.
199
Tost J, Gut I. 2007. DNA methylation analysis by pyrosequencing. Nature Protocols, 2(9), 2265–2275.
Unternaehrer E, Luers P, Mill J, Dempster E, Meyer AH,
Staehli S, Meinlschmidt G. 2012. Dynamic changes in DNA
methylation of stress-associated genes (OXTR, BDNF) after
acute psychosocial stress. Translational Psychiatry 2:e150.
Wang D, Szyf M, Benkelfat C, Provençal N, Turecki G,
Caramaschi D, Booij L. 2012. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain
serotonin synthesis and childhood physical aggression. PloS
One 7:e39501.
Weaver I, Cervoni N, Champagne F, D’Alessio A, Sharma S,
Seckl J, Dymov S, Szyf M, Meaney MJ. 2004. Epigenetic programming by maternal behavior. Nat Neurosci 7:847–854.
Wegman HL, Stetler C. 2009. A meta-analytic review of the
effects of childhood abuse on medical outcomes in adulthood.
Psychosomat Med 71:805–812.
Wendelbo I, Mazzawi T, El-Salhy M. 2014. Increased serotonin
transporter immunoreactivity intensity in the ileum of
patients with irritable bowel disease. Mol Med Rep 9(1):180–
184.
Wheeler SM, Williams L, Beauchesne P, Dupras TL. 2013. Shattered lives and broken childhoods: evidence of physical child
abuse in ancient Egypt. Int J Paleopathol 3:71–81.
American Journal of Physical Anthropology