Download Tissue and lineage-specific variation in inactive

 1996 Oxford University Press
Human Molecular Genetics, 1996, Vol. 5, No. 9 1361–1366
Tissue and lineage-specific variation in inactive X
chromosome expression of the murine Smcx gene
Laura Carrel, Patricia A. Hunt and Huntington F. Willard*
Department of Genetics and Center for Human Genetics, Case Western Reserve University School of Medicine
and University Hospitals of Cleveland, Cleveland, OH, 44106, USA
Received June 19, 1996; Revised and Accepted July 5, 1996
To understand how gene expression patterns are
established on the inactive X chromosome during
development, we have studied the murine gene Smcx,
which is expressed from both the active and inactive
mouse X chromosomes. In all tissues assayed, Smcx
only partially escapes X inactivation, with expression
levels from the inactive X allele ∼30–65% that of the
active X allele. Additionally, inactive X expression levels
differed between extraembryonic and embryonic
tissues and among different tissues from newborn and
adult mice. Imprinted extraembryonic tissue had the
lowest levels of inactive X Smcx expression, whereas
the highest levels were in heart. These data suggest that
the chromosomal basis of X inactivation differs among
tissues, perhaps reflecting differences in the timing or
regulation of inactivation in these cell lineages.
INTRODUCTION
X chromosome inactivation silences most genes on one X
chromosome in mammalian females to equalize dosage with males
who have only a single X chromosome (reviewed in 1,2). The
initiation of X inactivation early during development requires the
presence in cis of the X inactivation center (XIC); the XIST gene,
which maps to this region and is expressed exclusively from the
inactive X chromosome, is required for this process and demonstrates many, but perhaps not all, of the properties expected for the
XIC (3–7). Once inactivation has spread across the chromosome and
X-linked gene expression patterns are established, this chromosomal
state must be propagated and maintained throughout all subsequent
somatic cell divisions by an as yet poorly understood process. As one
approach to understand the chromosomal basis of X inactivation,
genes that ‘escape’ inactivation [i.e. those expressed from both the
active (Xa) and inactive X (Xi) chromosomes] have been studied to
determine whether they contain or lack specific elements or identify
regions involved in the process of X inactivation. At least in humans,
some genes that escape inactivation appear to be clustered (8,9).
Nonetheless, the developmental and chromosomal mechanism(s)
whereby these genes are expressed from the Xi chromosome remain
unknown.
To address these issues, we have studied a gene, Smcx, that is
expressed from the Xa and Xi chromosomes in mouse. Smcx (also
*To whom correspondence should be addressed
known as Xe169) (10,11) has a Y-linked homologue (12) that
functions as the H-Y minor histocompatability antigen (13).
Other X-linked genes that have ubiquitously expressed functional
Y-linked homologues (e.g. the human genes ZFX and RPS4X)
have been demonstrated to be fully expressed from the inactive
X chromosome (14,15). Thus, the X-linked Smcx gene would be
predicted to similarly escape inactivation (and be fully expressed
from the inactive X) to ensure proper dosage compensation
between males and females.
We have analyzed Smcx expression from the Xi in the context
of three different systems: non-random inactivation in different
tissues from an X;autosome translocation carrier, non-random X
inactivation in imprinted extraembryonic tissues, and embryonic
tissues from crosses in which X inactivation patterns are
determined by different alleles of the X controlling element (Xce)
(Fig. 1a). Unexpectedly, our results indicate that, despite having
an expressed Y-linked homologue, Smcx only partially escapes X
inactivation. Further, Xi expression levels differ among different
tissues and between extraembryonic and embryonic tissues, thus
suggesting that the chromosomal basis for X inactivation may
differ among tissues, perhaps reflecting the timing of inactivation
in these cell lineages.
RESULTS
Smcx partially escapes X inactivation
The mouse crosses in these studies are outlined in Figure 1a.
Expression of Smcx was first analyzed in inter-subspecies F1
female offspring resulting from the mating of a female carrying
Searle’s translocation, T(X;16)16H (T16H), and a Mus musculus
castaneus (CAST) male. T16H females demonstrate non-random
inactivation of the paternal X (Xp); in balanced translocation
females, although either X chromosome carrying the Xic (the
normal or the 16X) can be inactivated initially, cells with an
inactive 16X chromosome are dosage imbalanced and are
selected against (16–18). This interspecific cross provides
multiple polymorphisms to distinguish alleles on the active
maternal X (Xm) from the inactive Xp (e.g. Fig. 1b and refs
9,19,20). Two control genes, Hprt and Xist, were analyzed to
establish that all samples have complete non-random inactivation, since Xist is expressed exclusively from the Xi chromosome
(21,22) while Hprt is subject to inactivation (23) (Fig. 1b).
Therefore, in these experiments, any CAST Smcx expression
1362 Human Molecular Genetics, 1996, Vol. 5, No. 9
Figure 1. (a) Mouse crosses used in these experiments. The earliest X
inactivation non-randomly inactivates the Xp in extraembryonic membranes at
3.5 to 4.5 d.p.c. Non-random inactivation in T16H translocation carriers differs
from the primary non-random inactivation observed in extraembryonic tissues;
in balanced translocation females, although either X chromosome carrying the
Xi c (the normal X or the 16X) can be inactivated initially, cells with an inactive
16X chromosome are dosage imbalanced and are selected against (16–18). In
the cross on the right, Xce influences the initial choice of which chromosome
is inactivated (31,48). In this cross the CAST allele (Xp) is the Xa in a greater
proportion of cells than on the Xi (Xa > Xi), wheras the C57BL/6 allele (Xm)
is the Xi in the majority of cells (Xi > Xa). (b) Expression from a 12.5 d.p.c.
(T16H × CAST) F1 female embryo. Because primers for each gene amplify an
identically sized DNA and cDNA product, the absence of a PCR product in the
cDNA samples, in the lane marked –, indicates that there is no amplification
without reverse transcription, ensuring that the RNA is not contaminated with
DNA. For Hprt, a negative image of the ethidium bromide stained amplification
products is shown. To analyze Xist and Smcx, samples were amplified using a
32P end-labeled primer, products resolved on polyacrylamide gels, and
autoradiographs are shown. (c) Expression in a chromosomally normal female
heterozygous for different Xce alleles. Expression was analyzed in a liver
cDNA sample from a [C57BL/6J (Xce b) × CAST] F1 newborn female. For Xist
not only are inactivation ratios skewed, but levels of Xist expression are further
influenced by Xce effects (21,48), resulting in substantially higher levels of Xist
from chromosomes carrying the weaker Xce b allele than from those with the
strong Xce CAST allele.
detected must reflect expression from the Xi. RT–PCR of cDNA
from F1 female offspring indicates that both Smcx alleles are
transcribed, confirming that Smcx escapes X inactivation (bottom
panel, Fig. 1b) (10,11). However, the intensity of Xp and Xm
amplification products is unequal, suggesting that expression of
Smcx from the Xi is reduced relative to the Xa.
Levels of Smcx expression from the Xi
Relative levels of Smcx expression from the Xi were analyzed using
a quantitative RT–PCR assay, whereby the ratio of Smcx alleles
could be reproduced consistently. Levels were measured in both
embryonic and extraembryonic tissues. In mouse, the earliest X
inactivation is imprinted with Xp non-randomly inactivated in some
extraembryonic tissues at 3.5 to 4.5 days post coitum (d.p.c.)
(24–26). Inactivation of embryonic tissues initiates at ∼5.5 d.p.c.
(25,27), and recent data suggest that it may be completed in some
tissues as late as 10.5 d.p.c. (28). In all (T16H × CAST) F1 embryos
tested, Smcx partially escaped X inactivation even at the earliest
timepoint analyzed, 10.5 d.p.c. (Fig. 2). For the three embryos tested,
Smcx Xi levels were an average of 42% (± 1%) of Xa levels, with
no significant difference between embryos. Further, in a 12.5 d.p.c.
F1 embryo in which expression in yolk sac endoderm and in the
embryo proper were compared directly, the level of Xi expression in
extraembryonic yolk sac endoderm (31% of Xa) was significantly
lower (p <0.001) than levels measured in embryonic tissues. Similar
levels of Xi expression in yolk sac endoderm are also reported by
Sheardown et al. in the accompanying paper (29). These data
suggest that Xi expression of Smcx is different in imprinted
(non-randomly inactivated) extraembryonic tissues and in randomly
inactivated embryonic tissues (Fig. 1a), although whether these
differences have a temporal or an ontological basis remains
unknown.
Newborn and adult (T16H × CAST) F1 female mice were
assayed to determine whether Smcx is always expressed at low
levels from the Xi chromosome. Figure 2 compares the results
from differrent tissues from five such females. For the animals
assayed, levels of Xi Smcx expression in heart were significantly
higher than other tissues tested (p <0.01). Expression levels
among other tissues tested were not significantly different and
were similar to those measured in embryonic samples.
To confirm these observations, Smcx expression was tested in
females heterozygous for alleles at the X controlling element
(Xce) locus (Fig. 1a). Females that are homozygous at the Xce
locus have essentially random inactivation of either X
chromosome (except in extraembryonic tissues). However, in
heterozygotes, these alleles influence the percentage of cells
inactivating a particular parental allele (30,31). The C57BL/6
Xce b allele (31) is ‘weaker’ than the allele on the CAST X (32).
Therefore, (C57BL/6 × CAST) F1 females have a higher
percentage of cells with the CAST X active, as seen by analyzing
the Hprt gene (Fig. 1c). If Smcx completely escaped inactivation,
the Xp/Xm ratio (reflecting the entire cell population) would be
1:1 because each allele is expressed identically whether it is on the
Xa or Xi. However, for Smcx (bottom panel, Fig. 1c), as for Hprt,
amplification of Xp is greater than Xm. These data suggest that Xa
and Xi Smcx expression are not equal and that the skewed ratio
reflects the higher population of cells with the CAST X active.
Because Smcx was not fully expressed from the Xi chromosome
in any tissue assayed from (T16H × CAST) F1 females, and
because a skewed ratio, reflecting an Xce effect, was seen even in
a liver sample from a 6 month (C57BL/6 × CAST) F1 female
(data not shown), we conclude that the gene never fully escapes
X inactivation within the range of timepoints studied.
Smcx Xi expression was also severely repressed in yolk sac
endoderm from (C57BL/6 × CAST) F1 females. Controls
confirmed that each yolk sac endoderm sample expressed
exclusively Xp Xist and was not contaminated with underlying
randomly-inactivated yolk sac mesoderm (data not shown).
Similar results were seen for eight yolk sacs analyzed, with no
apparent difference between samples from embryos at 11.5, 12.5,
or 14.5 d.p.c. Expression levels in (C57BL/6 × CAST) F1 females
provide an essential control, because the high ratio of Xp:Xm
Smcx products (1.75 ± 0.08) in embryonic tissues establishes that
the very low ratio in non-randomly inactivated yolk sac endoderm
(0.28 ± 0.06) is due to Xa and Xi expression differences and not
simply to Smcx allelic differences between parental mouse
strains.
1363
Human Acids
Molecular
Genetics,
Vol.No.
5, No.
Nucleic
Research,
1994,1996,
Vol. 22,
1 9 1363
Figure 2. Smcx expression in tissues from (T16H × CAST) F1 females. The level of Xi expression is expressed as a fraction relative to Xa expression in the same sample.
cDNA samples were prepared from yolk sac and embryo proper from three embryos (patterned bars). While paired samples were examined for only a single (T16H
× CAST) F1 embryo, additional yolk sacs from different crosses showed the same low level of Xi expression (see text). Different tissues were examined from three
newborns (patterned bars) and two adults at 2 months (solid bars). The standard deviations for each set of measurements are indicated. The number in parentheses
above each sample indicates the number of independent PCR reactions that were performed for each sample. Each embryo was divided in half, and either sample gave
similar results. As a control, genomic DNA samples demonstrated an Xi/Xa ratio of ∼1 (open bar)
DISCUSSION
Figure 3. Expression in five independent single-cell subclones isolated from a
fibroblast cell line from a (C57BL/6 × CAST) F1 female. Amplification of Hprt
establishes that each subclone studied carries the CAST X on the Xa
chromsome. The difference in Xi Smcx expression levels between each clone
were not significant.
Smcx expression in single-cell clones
The low levels of Smcx Xi expression in embryos and in tissues
from newborn and adult mice could represent partial expression
in each cell within these tissues or complete reactivation in a small
subset of cells. To distinguish these possibilities, a cell line was
established from tail fibroblasts from a (C57BL/6 × CAST) F1
newborn female and expression was tested in independent
single-cell subclones. Hprt expression data indicate that the
CAST X chromosome was the active X in each of the five
subclones analyzed in detail (Fig. 3), although the C57BL/6 was
the active X in one of four other clones not shown in Figure 3. If
Smcx was active in only a subset of cells, subclone expression
levels would be predicted to vary. However, the Smcx Xi allele
was expressed at similar levels in each clone (notably less than the
Xa allele) (Fig. 3), suggesting (as the simplest hypothesis) that Xi
levels within tissues reflect the reduced expression from each cell
within that tissue, rather than cellular heterogeneity.
Smcx was previously reported to escape X inactivation based on
expression studies in F1 interspecific female mice carrying the
T16H translocation (10,11). However, neither of these earlier
studies examined levels of Xi expression. In our work, Smcx
expression has been analyzed in translocation females with
non-random X inactivation, in extraembryonic tissues in which
X inactivation is subject to regulation by imprinting, and in
embryos in which the initiation of X inactivation is influenced by
the Xce locus. Although Smcx has a constitutively expressed
Y-linked homologue, in each of these contexts and at all
timepoints tested, the data indicate that Smcx expression from the
Xi is reduced significantly relative to Xa levels. Additionally,
levels of Xi Smcx expression in different tissues and/or lineages
were not equivalent. This suggests that either complete dosage
compensation is not necessary or that complete escape from
inactivation is not necessary for dosage compensation. If the Y
homologue is expressed at similar levels as the X-linked gene, our
studies would predict higher levels of Smcx in male cells than in
female cells.
The initiation of inactivation in extraembryonic membranes is
clearly different than in embryonic tissues, occurring at an earlier
timepoint and involving exclusively the Xp chromosome.
However, the chromosomal basis of X inactivation in both
lineages has been generally assumed to be identical.
Extraembryonic tissues show less DNA methylation than
embryonic tissues (33), a finding that might have predicted
relaxed regulation of genes on the inactive X, rather than the more
stringent control or silencing that is reported here for Smcx. In
mouse, only one other gene, an α-fetoprotein transgene integrated
on the X chromosome, has shown inactivation differences
between extraembryonic and embryonic tissues (34). However,
this effect is opposite to what was seen for Smcx, since the
transgene was subject to X inactivation in fetal liver, yet escaped
inactivation in extraembryonic tissues.
1364 Human Molecular Genetics, 1996, Vol. 5, No. 9
Tissue-specific variation and age-related reactivation in
inactive X expression has been reported for the G6pd gene in the
Virginia opossum (35). X inactivation in marsupials
preferentially silences the Xp chromosome, yet this inactivation
has been thought to be less stable than eutherian X inactivation
(reviewed in 36). While its homologous loci in mouse and human
are subject to inactivation, the tissue-variable expression pattern
observed for G6pd in this marsupial is similar to that reported here
for Smcx. This may suggest that the developmental and/or
chromosomal mechanisms of inactivation in marsupials and
eutherian mammals are more similar than previously thought and
that it is the differences for particular genes in their chromosomal
location, heterochromatin context, or other gene-specific features
that explain variability in expression levels and in their stability.
The analysis of many more genes in marsupials, mice, and in
humans will be required to examine this hypothesis.
These results add complexity to the study of X inactivation by
demonstrating that Xi expression, at least at the Smcx locus, is
influenced in a tissue-specific manner (see model, Fig. 4).
Although more complex models involving stochastic control of
gene expression are formally possible (37), the lack of variability
among single-cell subclones argues that the observed
tissue-specific differences reflect the early establishment of
inactivation patterns within each tissue, and not long-term
maintenance of these patterns. Such heterochromatin-induced
differences could reflect the local chromatin context at Smcx,
established during development as a function of the timing of X
inactivation in specific tissues. Extraembryonic tissues, which
initiate inactivation early, have the lowest levels of Xi Smcx
expression. Studies of an X-linked lacZ trangene indicate that X
inactivation is completed at different times in different embryonic
tissues (28). Of the tissues reported to complete inactivation late,
only heart has been examined for Smcx expression and has the
highest levels of Xi expression reported here. A temporal model
posits that the establishment of inactive chromatin differs
between tissues in a time-dependent fashion and is more complete
the earlier inactivation occurs. Such a model need not apply to all
genes and/or all regions on the chromosome; indeed, a recent
study (38) demonstrated that two X-linked genes do not show
differences in inactivation rates. Alternatively, tissue-specific
control elements may influence the extent of X inactivation
independent of the timing of inactivation by altering
heterochromatin formation in specific tissues or by regulating the
ability to activate Smcx transcription within heterochromatin.
Such a putative effect might be specific to Smcx or might relate
to X inactivation generally.
The Smcx data we describe are similar to that reported by
Sheardown et al. using a different quantitative approach and
different mouse crosses (29). Our data, in addition, suggest
significant differences between embryonic and extraembryonic
lineages. Taken together, the combined data, in conjunction with
the earlier studies by Penny et al. in embryonic stem cells (7),
indicate that Smcx shows progressive escape from X inactivation
during early development; this conclusion suggests that Smcx Xi
expression levels may be determined both by the age of the
animal and by the timing of inactivation in different cell lineages.
Thus, Smcx Xi expression may represent reactivation with age, as
reported for other mouse genes (39,40), but occurring at a much
earlier timepoint in a higher percentage of cells.
It will be important to determine whether the expression
differences seen for Smcx are characteristic of other genes that
Figure 4. Model for regulation of Smcx from the Xi chromosome. At the top,
prior to X inactivation, all expressed genes are indicated as ON. At the time X
inactivation initiates, inactivation may spread throughout the whole chromosome and shut off all genes (left). Alternatively, it is possible that some genes
are always expressed from the Xi chromosome (right). The low levels of Smcx
expression from the Xi might represent, therefore, either a receding (left) or
spreading (right) of the Xi heterochromatin over time, which would establish
a stable state of partial Xi expression. The heterochromatin-induced reduction
in Xi expression may be dependent on the time of inactivation in a particular
tissue or cell lineage. Alternatively (or additionally), these differences could be
due to tissue-specific binding factors, that influence the extent that inactive
chromatin spreads or the ability to activate transcription within a heterochromatic environment.
escape inactivation, such as the recently cloned Sts gene (41).
Such data are important for understanding the developmental
consequences of X inactivation and the possible clinical or
phenotypic effects of genes that escape inactivation, both in
normal development and in individuals with numerical or
structural abnormalities of the X chromosome.
MATERIALS AND METHODS
Mice
Females carrying the T16H translocation and CAST males were
obtained from the Jackson Laboratory (Bar Harbor, ME).
Additional T16H females, C57BL/6 females and F1 interspecific
animals were bred in house. For timed matings plug day was
counted as day 0. Yolk sac endoderm was isolated by dissociation
with pancreatin/ trypsin or glycine (42). Embryos were separated
into two parts, and all samples were snap frozen in liquid nitrogen
prior to RNA and DNA isolation. Embryos in this study were
analyzed at 10.5 and 12.5 d.p.c., timepoints when X inactivation
is complete (27,28) as well as cell selection in T16H females
(16–18). One 12.5 d.p.c. embryo was the progeny of a T16H
female mated to a second generation backcross [or N(2)] male
derived from the backcross of a (C57BL/6 × CAST) F1 female to
a C57BL/6 male. This N(2) male carries the CAST alleles of
Hprt, Xist and Smcx.
Balanced T16H female embryos were distinguished from
unbalanced and normal littermates by fluorescence in situ
hybridization (43) using probes proximal (DXWas70) and distal
(YAC B2–4, that includes Xist) to the T16H breakpoint, together
with a chromosome count [to exclude the few animals with an
unbalanced karyotype that may survive to 10.5 d.p.c. (44)].
Alternatively, embryos were scored as females if DNA analysis
showed two Hprt and Xist alleles and translocation carriers were
1365
Human Acids
Molecular
Genetics,
Vol.No.
5, No.
Nucleic
Research,
1994,1996,
Vol. 22,
1 9 1365
further identified by complete non-random paternal Xist and
maternal Hprt expression.
RNA purification
RNA and DNA were isolated using TRIzol (GibcoBRL)
according to the manufacturer’s recommendations except that
RNA samples were extracted twice with TRIzol to remove
residual DNA. Yolk sac endoderm samples were isopropanol
precipitated overnight at –80C in the presence of 1 µg of yeast
tRNA as a carrier. RNA from yolk sac endoderm samples was
dissolved in 10 µl H2O, and 3 µl used for subsequent reverse
transcription steps. For embryos or tissues, 1–5 µg of RNA was
used. Reverse transcription was essentially as described (45),
except that 10 pg of oligo dT was added in addition to an
equivalent concentration of random hexamers. From a final
reverse transcription reaction volume of 20 µl, 1 µl or 1 µl of a
1:10 dilution was used for subsequent PCR analysis.
PCR
Standard PCR conditions have been described (45) and all
primers were annealed at 55C. For Hprt, a G→C change at
nucleotide 1143 was identified in CAST (sequence from ref. 46).
Alleles were differentiated by HinfI digestion of amplification
products generated with Hprt-a: GCCTAAGATGAGCGCAAGTT and b: GTGGGAAAATACAGCCAACACT. The
highly polymorphic 5′ repeat region of Xist (47) revealed several
sequence changes and a net 3 bp size difference in CAST. The
entire 503 bp repeat region was amplified with primers Xist mp2:
GTGTGTATGGTGGACTTACCT and mp7: ACACGCAAATTAGAGGCATAG (47), and the products were digested with
NcoI, which recognizes a single non-polymorphic restriction site.
Using the end-labeled primer Xist-mp2, the smaller 227 and 230
bp labeled products could easily be separated on 5% polyacrylamide sequencing gels. Sequence from a Smcx cDNA clone (43)
in different mouse strains identified several polymorphisms,
including a stretch of ten cytosines in the 3′ UTR in M. domesticus
strains that is reduced to eight cytosines in CAST. A 446 bp
product was amplified with primers Smcx 1: CAAGCCTGCTTCTTAGAGGTG and 7: GGACAGCTATGTGAAGTTTCCT,
and subsequently all products were digested with the non-polymorphic restriction enzyme EcoO109. Amplification with the
labeled primer Smcx-1 generates labeled 182 and 180 bp
fragments in the different mouse strains.
Quantitative PCR analysis
Dried acrylamide gels were exposed to phosphor screens and
radioactivity was directly measured with a PhosphorImager 445
SI (Molecular Dynamics). Band intensity was determined by
measuring counts for each band within a fixed area and
subtracting lane background across that same area. Because the
polymorphic size difference is small, Smcx alleles that are present
in equimolar ratios should amplify equally. Any deviation from
this 1:1 (Xp:Xm) ratio should reflect differences in the starting
concentration (i.e., in cDNA samples, expression differences) of
either allele. Further, since both alleles are co-amplified and
compared in relation to each other, samples are internally
controlled and the ratios will not be affected by possible variation
in sample loading or initial concentration differences. A series of
control experiments was performed to establish the number of
amplification cycles within linear range of the amplification
profile conditions in which the relative ratio of Smcx alleles could
be reproduced consistently. For each sample tested, the Xp/Xm
ratio was constant (data not shown). In subsequent experiments,
26 or 28 cycles of amplification were performed and each sample
was repeated multiple times as a measure of consistency.
Single cell subclones
A polyclonal cell line was established from tail fibroblasts from
a (C57BL/6 × CAST) F1 newborn female. This line was
maintained in culture and then plated at very low density (no more
than 5 cells/ 100 mm dish) to isolate independent single cells,
which were subsequently expanded. FISH with an X
chromosome probe, DXWas70, indicated that although all
subcloned lines were tetraploid, each line demonstrated the
presence of four X chromosomes in each cell (>20 cells counted).
Exclusive expression of the C57BL/6 allele of Xist and the CAST
allele of Hprt demonstrated that in each cell line shown in Figure
3 the CAST X chromosomes were active and C57BL/6 X
chromosomes were inactive.
ACKNOWLEDGEMENTS
We thank C. Brown for helpful discussions and are grateful to K.
Gustashaw, K. Mroz, and R. LeMaire for technical assistance.
This work was supported by NIH research grants GM45441 (to
HFW) and HD27393 (to PAH).
REFERENCES
1. Brown, C. J. and Willard, H. F. (1993) Molecular and genetic studies of
human X chromosome inactivation. Adv. Dev. Biol., 2, 37–72.
2. Willard, H. F. (1995) Sex chromosomes and X chromosome inactivation. In
C. R. Scriver, A. L. Beaudet, W. S. Sly and D. Valle (eds.), The Metabolic
Basis of Inherited Disease. McGraw-Hill Publishing Co., New York, pp
719–735.
3. Brown, C. J., Ballabio, A., Rupert, J. L., Lafreniere, R. G., Grompe, M.,
Tonlorenzi, R. and Willard, H. F. (1991) A gene from the region of the human
X inactivation centre is expressed exclusively from the inactive X chromosome. Nature, 349, 38–44.
4. Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., Xing, Y.,
Lawrence, J. and Willard, H. F. (1992) The human XIST gene: analysis of a 17
kb inactive X-specific RNA that contains conserved repeats and is highly
localized within the nucleus. Cell, 71, 527–542.
5. Kay, G. F., Penny, G. D., Patel, D., Ashworth, A., Brockdorff, N. and Rastan,
S. (1993) Expression of Xist during mouse development suggests a role in the
initiation of X chromosome inactivation. Cell, 72, 171–182.
6. Kay, G. F., Barton, S. C., Surani, M. A. and Rastan, S. (1994) Imprinting and
X chromosome counting mechanisms determine Xist expression in early
mouse development. Cell, 77, 639–650.
7. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S. and Brockdorff, N.
(1996) The Xist gene is required in cis for X chromosome inactivation.
Nature, 379, 131–137.
8. Miller, A. P., Gustashaw, K., Wolff, D. J., Rider, S. H., Monaco, A. P., Eble, B.,
Schlessinger, D., Gorski, J. L., van Ommen, G. J., Weissenbach, J. and
Willard, H. F. (1995) Three genes that escape X chromosome inactivation are
clustered within a 6 Mb YAC contig and STS map in Xp11.21-p11.22. Hum.
Mol. Genet., 4, 731–739.
9. Carrel, L., Clemson, C. M., Dunn, J. M., Miller, A. P., Hunt, P. A., Lawrence,
J. B. and Willard, H. F. (1996) X inactivation analysis and DNA methylation
studies of the ubiquitin activating enzyme E1 and PCTAIRE-1 genes in
human and mouse. Hum. Mol. Genet., 5, 391–401.
10. Wu, J., Salido, E. C., Yen, P. H., Mohandas, T. K., Heng, H. H. Q., Tsui, L.-C.,
Park, J., Chapman, V. M. and Shapiro, L. J. (1994) The murine Xe169 gene
escapes X-inactivation like its human homologue. Nature Genet., 7,
491–496.
1366 Human Molecular Genetics, 1996, Vol. 5, No. 9
11. Agulnik, A. I., Mitchell, M. J., Mattei, M.-G., Borsani, G., Avner, P. A.,
Lerner, J. L. and Bishop, C. E. (1994) A novel X gene with a widely
transcribed Y-linked homologue escapes X-inactivation in mouse and
human. Hum. Mol. Genet., 3, 879–884.
12. Agulnik, A. I., Mitchell, M. J., Lerner, J. L., Woods, D. R. and Bishop, C. E.
(1994) A mouse Y chromosome gene encoded by a region essential for
spermatogenesis and expression of male-specific minor histocompatibility
antigens. Hum. Mol. Genet., 3, 873–878.
13. Wang, W., Meadows, L. R., den Haan, J. M. M., Sherman, N. E., Chen, Y.,
Blokland, E., Hendrickson, R. C., Bishop, C. E., Hunt, D. F., Goulmy, E. and
Engelhard, V. H. (1995) Human H-Y: A male-specific histocompatibility
antigen derived from the SMCY protein. Science, 269, 1588–1590.
14. Fisher, E. M. C., Beer-Romero, P., Brown, L. G., Ridley, A., McNeil, J. A.,
Lawrence, J. B., Willard, H. F., Bieber, F. R. and Page, D. C. (1990)
Homologous ribosomal protein genes on the human X and Y chromosomes:
escape from X inactivation and implications for Turner syndrome. Cell, 63,
1205–1218.
15. Schneider-Gadicke, A., Beer-Romero, P., Brown, L. G., Nussbaum, R. and
Page, D. C. (1989) The ZFX gene on the human X chromosome escapes X
inactivation and is closely related to ZFY, the putative sex determinant on the
Y chromosome. Cell, 57, 1247–1258.
16. Takagi, N. (1980) Primary and secondary nonrandom X chromosome
inactivation in early female mouse embryos carrying Searle’s translocation
T(X;16)16H. Chromosoma, 81, 439-459.
17. Disteche, C. M., Eicher, E. M. and Latt, S. A. (1981) Late replication patterns
in adult and embryonic mice carrying Searle’s X-autosome translocation.
Exp. Cell Res., 133, 357–362.
18. McMahon, A. and Monk, M. (1983) X-chromosome activity in female mouse
embryos heterozygous for PGK-1 and Searles translocation, T(X;16) 16H.
Genet. Res., Cambridge., 41, 69–83.
19. Ashworth, A., Rastan, S., Lovell-Badge, R. and Kay, G. (1991) X-chromosome inactivation may explain the difference in viability of XO humans and
mice. Nature, 351, 406–408.
20. Adler, D. A., Bressler, S. L., Chapman, V. M., Page, D. C. and Disteche, C. M.
(1991) Inactivation of the Zfx gene on the mouse X chromosome. Proc. Natl
Acad. Sci. USA, 88, 4592–4595.
21. Brockdorff, N., Ashworth, A., Kay, G. F., Cooper, P., Smith, S., McCabe, V.
M., Norris, D. P., Penny, G. D., Patel, D. and Rastan, S. (1991) Conservation
of position and exclusive expression of mouse Xist from the inactive X
chromosome. Nature, 351, 329–331.
22. Borsani, G., Tonlorenzi, R., Simmler, M. C., Dandalo, L., Arnaud, D., Capra,
V., Grompe, M., Pizzati, A., Muzay, D., Lawrence, C., Willard, H. F., Avner, P.
and Ballabio, A. (1991) Characterisation of a murine gene expressed from the
inactive X chromosome. Nature, 351, 325–329.
23. Chapman, V. M. and Shows, T. B. (1976) Somatic cell genetic evidence for
X-chromosome linkage of three enzymes in the mouse. Nature, 259,
665–667.
24. Takagi, N. and Sasaki, M. (1975) Preferential inactivation of the paternally
derived X chromosome in the extraembryonic membranes of the mouse.
Nature, 256, 640–642.
25. Monk, M. and Harper, M. I. (1979) Sequential X chromosome inactivation
coupled with cellular differentiation in early mouse embryos. Nature, 281,
311–313.
26. Harper, M. I., Fosten, M. and Monk, M. (1982) Preferential paternal X
inactivation in extraembryonic tissues of early mouse embryos. J. Embryol.
Exp. Morph., 67, 127–135.
27. Rastan, S. (1982) Timing of X-chromosome inactivation in postimplantation
mouse embryos. J. Embryol. Exp. Morph., 71, 11–24.
28. Tan, S.-S., Williams, E. A. and Tam, P. P. L. (1993) X-chromosome
inactivation occurs at different times in different tissues of the post-implantation mouse embryo. Nature Genet., 3, 170–174.
29. Sheardown, S., Norris, D., Fisher, A. and Brockdorff, N. (1996) The Smcx
gene shows progressive escape from inactivation through ontogeny. Hum.
Mol. Genet., 5, 1355–1360.
30. Cattanach, B. M., Pollard, C. E. and Perez, J. N. (1969) Controlling elements
in the mouse X-chromosome 1. Interaction with the X-linked genes. Genet.
Res., 14, 223–235.
31. Johnston, P. G. and Cattanach, B. M. (1981) Controlling elements in the
mouse IV. Evidence of non-random X-inactivation. Genet. Res., 37, 151–160.
32. Cattanach, B. (1993) ‘News out of Harwell’ Identification of the Mus
castaneus Xce allele. Mouse Genome, 91
33. Kratzer, P. G., Chapman, V. M., Lambert, H., Evans, R. E. and Liskay, R. M.
(1983) Differences in the DNA of the inactive X chromosomes of fetal and
extraembryonic tissues of mice. Cell, 33, 37–42.
34. Krumlauf, R., Chapman, V. M., Hammer, R. E., Brinster, R. L. and Tilghman,
S. M. (1986) Differential expression of α-fetoprotein genes on the inactive X
chromosome in extraembryonic and somatic tissues of a transgenic mouse
line. Nature, 319, 224–226.
35. Samollow, P. B., Robinson, E. S., Ford, A. L. and Vandenberg, J. L. (1995)
Developmental progression of Gpd expression from the inactive X chromosome of the Virginia opossum. Dev. Genet., 16, 367–378.
36. Cooper, D. W., Johnston, P. G., Watson, J. M. and Graves, J. A. M. (1993)
X-inactivation in marsupials and monotremes. Sem. Dev. Biol., 4, 117–128.
37. Walters, M. C., Fiering, S., Eidemiller, J., Magis, W., Groudine, M. and
Martin, D. I. K. (1995) Enhancers increase the probability but not the level of
gene expression. Proc. Natl Acad. Sci. USA, 92, 7125–7129.
38. LeBon, J. M., Tam, P. P. L., Singer-Sam, J., Riggs, A. D. and Tan, S. S. (1995)
Mouse endogenous X-linked genes do not show lineage-specific delayed
inactivation during development. Genet. Res., 65, 223–227.
39. Wareham, K. A., Lyon, M. F., Glenister, P. H. and Williams, E. D. (1987) Age
related reactivation of an X-linked gene. Nature, 327, 725–727.
40. Brown, S. and Rastan, S. (1988) Age-related reactivation of an X-linked gene
close to the inactivation centre in the mouse. Genet. Res., 52, 151–154.
41. Salido, E. C., Li, X. M., Yen, P. H., Martin, N., Mohandas, T. K. and Shapiro,
L. J. (1996) Cloning and expression of the mouse pseudoautosomal steroid
sulphatase gene (Sts). Nature Genet., 13, 83–86.
42. Hogan, B., Costantini, F. and Lacy, E. (1986) Manipulating the mouse
embryo. Cold Spring Harbor Laboratory.
43. Sultana, R., Adler, D. A., Edelhoff, S., Carrel, L., Lee, K., Chapman, V. C.,
Willard, H. F. and Disteche, C. M. (1995) The mouse Sb1.8 gene located at the
distal end of the X chromosome is subject to X inactivation. Hum. Mol.
Genet., 4, 257–263.
44. Takagi, N. and Abe, K. (1990) Detrimental effects of two active X
chromosomes on early mouse development. Development, 109, 189–201.
45. Brown, C. J., Flenniken, A. M., Williams, B. R. G. and Willard, H. F. (1990) X
chromosome inactivation of the human TIMP gene. Nucleic Acids Res., 18,
4191–4195.
46. Melton, D. W., Konecki, D. S., Brennand, J. and Caskey, C. T. (1984)
Structure, expression and mutation of the hypoxanthine phosphoribosyltransferase gene. Proc. Natl Acad. Sci. USA, 81, 2147–2151.
47. Hendrich, B., Brown, C. and Willard, H. (1993) Evolutionary conservation of
possible functional domains of the human and murine XIST genes. Hum. Mol.
Genet., 2, 663–672.
48. Buzin, C. H., Mann, J. R. and Singer-Sam, J. (1994) Quantitative RT-PCR
assays show Xist RNA levels are low in mouse female adult tissue, embryos,
and embryoid bodies. Development, 120, 3529–3536.