Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Draw the pedigree of a color blind father and an unaffected mother! CC C Cc c C Cc 2 Chromosomes Basic terminology: Genome - chromosomes - genes - DNA histon DNA 30 nm bacteria Haploid chromosome set: 3 1 frog 26 cat human 38 46 4 kromoszOma more DNA History DNA History 1955: 46 human chromosomes 1961: mRNA 1975: DNA-sequencing 1982: gene bank databases 1983: PCR (polymerase chain reaction) J. D. Watson J. D. Watson F. H. C. Crick 1953 DNA stucture 1953 5 F. H. C. Crick 2008 Watson’s genom 2003 Finished Human Genom Project 6 1 DNA – the genetic information „Size does matter” ☺ 2 nm P A O T O P P O C G O 3,4 nm 10 bp P P G O C O P P O T A O P base pairs „the total length” = 1 m 7 What is the inherited information: „the code” 15601 15661 15721 15781 15841 15901 15961 16021 16081 16141 16201 16261 16321 16381 ACTCGCTCGT TCATCGTGAG TCTACTCCGA CGTCCCTGTC GCTGGGGCGG CTCGCGACCT CCGTCTGTCT AACAGGCGAC AGCTGGACAG ACACACTGCC GAAGGAGGCT GTGTGTGGGG GATGGAGCCC CCTCTGCGGC GTGCGTGAGC CCTGGCGGCC GGTGAGCCGC CCTACGGAGG CGGCAGGGGC TCCACCCGCT TGGCGTCTGT TTTGTCAAGC ACAGGCAGAT ACAGCCACTG CACAGCTCGC ACCAGGCCCC ACACTCCACA CAGAGAAAAG GTGGCCACCG GCCGACCTCC GTCCGGCCGC ACCCGGCGCG GCTGCGCCTT GCGCTGTCTG TATCCAGGAG CCAGTCCCCT GCAGGCTCAG CCCACCACAC AGGGGAGACC TGCTGAGAAC CCAGGTCTGG CAGCTTAGGG AGCGCGCCCT TCCTCGCTCT ACGAGCATCC ACCCGGCCCC GTCCCTCGGC TCCCCCGACC ATGCCCGTCC CCGTAGCTGG CCCCCTGGCT ACACCTAGTG TGGGCTGGAC CCTGGGGGGA CCCTCGAGTG CTGAGCTGGA GCAGACGCCC CCTGGTGCTG TCACCTGCTC TTTCTGGTGC GATACACCCA CTCGTTCCTC TTCTATCCAG ATTTCACCTC GCCGTGGGAC CAGATGCTGG AAAACCCAGG AGCCTGAGGG GGTCGGCCTT GACGCGGTGT ACCAACTCCT CCGCTCTTCG CTCGGTTCCC GGAGCTTCCA CCGCCGCCAC TTCTCCTTCC GGACCCCGGA CAGGGCAGCC ACACACACAC CACACCCCCA GGAGGGGAGG GGAATTGGGG GGTGCCAGCC CCCCGACTGT 8 Basic functions of the DNA: replication and directing protein synthesis the nucleotide sequence The genomic information „Post-genomic era” 9 DNA replication during the process of cell division 10 The „Central Dogma” of Molecular Biology DNA Gene expression 1. double helix unzips, separating the paired bases 2. each strand serves as template for the production of the complementary strand 3. Two identical copies of the original DNA 11 mRNA (exons) protein 12 2 The genetic code 3 letters (base-pairs) = 1 codon = 1 amino acid The genetic code TGCGTGAGCGTGGCCACCGAG Cys Val Ser Val Ala Thr Glu The code for protein synthesis (exons) is hidden among other letters (introns). Second letter C A G Third letter First letter U U C A G TGCGTGAGCGTGGCCACCGAG Phe Tyr Cys U C Ser Cys Val Ser Val Stop Ala ThrStop Glu A Leu Stop Trp G U His Leu Pro Arg C A Gln G Asn Ser U Ile C Thr Lys Arg A Met Start G U Asp Val Ala Gly C A Glu G The information is: - not overlapping, - does not have coma - universal - determined - but redundant MDIOEQLAYAGTHEIWHFIEO WLDHRZUQOALKOCOSTWLOU QNDOGQURUEUAHFKEEPSMN DPRWTHEELIAMNHOUSEQRT AHQILKAKHERDIXYYTRAEQ JASAFEUNZATOKOGETHERU 13 14 alternative splicing The genetic code MDIOEQLAYAGTHEIWHFIEO WLDHRZUQOALKOCOSTWLOU QNDOGQURUEUAHFKEEPSMN DPRWTHEELIAMNHOUSEQRT AHQILKAKHERDIXYYTRAEQ JASAFEUNZATOKOGETHERU Exons carry the information necessary for protein synthesis. Introns are spliced out before the RNA leaves the nuclus. Only exonal regions exit the nucleus to be translated into amino acid sequences. Genes have an exon-intron structure: MDIOEQLAYAGTHEIWHFIEO WLDHRZUQOALKOCOSTWLOU QNDOGQURUEUAHFKEEPSMN DPRWTHEELIAMNHOUSEQRT AHQILKAKHERDIXYYTRAEQ JASAFEUNZATOKOGETHERU 15 16 Regulation of gene expression Genetic polymorphisms : Promoter (regulatory) region –521CT SNP Transcribable - Coding region (e.g. exons I, II and III) I. II. III. DNA G CA C TAC C C GTGATGG G CATTAC C C G TAAT G G Transcription factors Single Nucleotide Polymorphism Quantity Quality 17 VNTR 2 repeat 3 repeat 4 repeat 5 repeat Variable Number of Tandem Repeats 18 3 Determining polimorphisms 3. PCR (polimerase chain reaction) 1. DNA sampling PCR blod buccal swabs Whole Human genome 2 x 3x109 bp 2 x 23 chomosomes 2. DNA isolation (2 x ) 102-103 bp PCR product From a DNA fragment 19 20 Selected readings Textbook: Ch 4 page 41-49. • DNA – the basis of heredity (chromosomes, nucleotide, basepair, genome, genes, alleles) • Basic functions of the DNA: reproduction and coding proteines The outline from this lecture presentation will be available at the course website! • The "Central Dogma" of Molecular Biology, DNA, mRNA, exon, intron, splicing) • Gene expression (promoter and coding region) • Polimorphic regions (SNP and VNTR) and their determination by PCR method 21 22 • The genetic code might change in any of the followings. Which change would most probably cause a mutation which would cause a disease? • Intron • Exon • Promoter • mRNA • Genome 23 4