Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Name _______________________________ Genetics Worksheet: Practice Transcription & Translation Shown below are 5 DNA sequences. In each DNA sequence, the template strand is on the bottom. Transcribe the entire template strand to mRNA. Then start translation at the first start codon in the mRNA. Write out the amino acid sequence that results. Each polypeptide, if converted to the single letter amino acid code, will spell an English word (so you will know if you did everything correctly). 5’ GCGTATGGCTGGGAACGAGACCTAAGCG 3’ 3’ CGCATACCGACCCT TGCT CTGGATT CGC 5’ 5’ T GCGTATGGCAATCC TTGAAGACT GAGCG 3’ 3’ ACGCATACCGT TAGGAACT TCT GACT CGC 5’ 5’ AGCTGATGGAGGCCT CTCTAGAATGAGCG 3’ 3’ TCGACTACC TCCGGAGAGATCT TACTCGC 5’ 5’ GCGTATGGAAAACGACGAACTGT AAGCG 3’ 3’ CGCATACCT T TT GCTGCTT GACATTCGC 5’ 5’ GTGATGATACT CGACGAATGGT GAGCG 3’ 3’ CACTACTAT GAGCTGC TT ACCACT CGC 5’ The Single-Letter Amino Acid Code G - Glycine (Gly) P - Proline (Pro) A - Alanine (Ala) V - Valine (Val) L - Leucine (Leu) I - Isoleucine (Ile) M - Methionine (Met) C - Cysteine (Cys) F - Phenylalanine (Phe) Y - Tyrosine (Tyr) W - Tryptophan (Trp) H - Histidine (His) K - Lysine (Lys) R - Arginine (Arg) Q - Glutamine (Gln) N - Asparagine (Asn) E - Glutamic Acid (Glu) D - Aspartic Acid (Asp) S - Serine (Ser) T - Threonine (Thr)