Download Supplemental Tables 1 through 3

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Supplementary Table S1. Primer pairs used for quantitative real-time PCR analysis.
Gene
Sequences of primer pairs
LOX
(R) 5’-TTGGTCGGCTGGCTAAGAAAT-3’ and (F) 5’- GGATACGGCACTGGCTACTTC -3’
LOXL1
(R) 5’-TGGCAGTCGATGTAAGAAAT-3’ and (F) 5’- GCACCTCTCATACCAGGGC -3’
LOXL2
(R) 5’-GCTTGCGGTAGGTGAG-3’ and (F) 5’- CGGAGGATGTCGGTGTGGT -3’
LOXL3
(R) 5’-GTTGGCACACTATACCGCTTG-3’ and (F) 5’- ACCACAGCATGGACATCTTCACTC -3’
LOXL4
(R) 5’-AGCGGCACTGCAGCATATTG-3’ and (F) 5’- ACACCTACCGGCATGACATTGA -3’
TWIST1
(R) 5’-TCTGGAGGACCTGGTAGAGG-3’ and (F) 5’-GGAGTCCGCAGTCTTACGAG-3’
SNAI1
(R) 5’-CCAGGCTGAGGTATTCCTT-3’ and (F) 5’-CCTCCCTGTCAGATGAGGAC-3’
VIM
(R) 5’-GCTTCCTGTAGGTGGCAATC-3’ and (F) 5’-GAGAACTTTGCCGTTGAAGC-3’
CDH-1
(R) 5’-CATTCTGATCGGTTACCGTGATC-3’ and (F) 5’-AGAACGCATTGCCACATACACTC-3’
18S
(R) 5’-CCATCCAATCGGTAGTAGCG-3’ and (F) 5’-GTAACCCGTTGAACCCCATT-3’
L32
(R) 5’-CAGCTCTTTCCACGATGGCT-3’ and (F) 5’-CAAGGAGCTGGAAGTGCTGC-3’
RT-PCR experiments were conducted on cells under >20 day treatment with dox. For all the samples, total RNA was extracted using Trizol reagent
(Invitrogen) according to the manufacturer’s instructions. Results were normalised to 18S and are expressed as fold induction ± SD (n > 3). In some
experiments, relative LOX expression levels were normalised according to the Ct value of the gene encoding the ribosomal protein L32 and results
were expressed as fold differences equal to 2-CT. LOs primers were purchased from Invitrogen. All other primers were purchased from Eurofin
MWG Operon.
Supplementary Table S2. Summary of the gene expression datasets used for meta-analysis
Dataset
Platform
Samples (N)
Details
Reference
Cancer Genome Atlas
RNAseq
147
Colorectal adenocarcinoma
Cancer Genome Atlas
Network (2015)
32
Sporadic colon cancer
samples
Reid et al (2009)
89
AJCC stage II CRC patients
de Sousa (2011)
159
Colorectal cancer
Sheffer 2009
145
Colorectal cancer patients
Smith (2010)
GSE16125
GSE33113
Affymetrix Human Exon 1.0 ST
Array
Affymetrix Human Genome U133
Plus 2.0 Array
Affymetrix U133A arrays
GSE41258
GSE17536
GSE31595
GSE12945
Affymetrix Human Genome U133
Plus 2.0 Array
Affymetrix Human Genome U133
Plus 2.0 Array
Affymetrix Human Genome
U133A Array
37
51
Patients with stage II and III
colorectal cancer
Microdissected colorectal
cancer
Thorsteinsson (2012)
Staub (2009)
References:
 Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012;487:330-337.
 de Sousa E Melo F, Colak S, Buikhuisen J, Koster J, de Jong JH et al. Methylation of cancer-stem-cell-associated Wnt target genes predicts poor prognosis in colorectal cancer
patients. Cell Stem Cell 2011;9:476-485.
 Reid JF, Gariboldi M, Sokolova V, Capobianco P, Lampis A, Perrone F et al. Integrative approach for prioritizing cancer genes in sporadic colon cancer. Genes Chromosomes Cancer
2009;48:953-962.
 Smith JJ, Deane NG, Wu F, Merchant NB, Zhang B, Jiang A, et al. Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon
cancer. Gastroenterology 2010;138:958-968.
 Staub E, Groene J, Heinze M, Mennerich D, Roepcke S, Klaman I et al. An expression module of WIPF1-coexpressed genes identifies patients with favorable prognosis in three tumor
types. J Mol Med 2009;87:633-644.
 Thorsteinsson M1, Kirkeby LT, Hansen R, Lund LR, Sørensen LT, Gerds TA, et al. Gene expression profiles in stages II and III colon cancers: application of a 128-gene signature. Int J
Colorectal Dis 2012;27:1579-1586.
 Sheffer M, Bacolod MD, Zuk O, Giardina SF, Pincas H, Barany F, et al. Association of survival and disease progression with chromosomal instability: a genomic exploration of colorectal
cancer. Proc Natl Acad Sci U S A 2009;106:7131-7136.
Supplementary Table S3. Expression levels of LOX-like mRNAs in Hct116 cells transduced for LOX overexpression (LOX+) or silencing
(LOX-), compared to mock-transduced Hct116 cells (Ctrl).
Cells
LOX
LOXL1
LOXL2
LOXL3
LOXL4
2-Ct
Ct
2-Ct
Ct
2-Ct
Ct
2-Ct
Ct
2-Ct
Ct
Ctrl
1±0.14
26..6
1.03±0.3
25.17
1±0.55
25.7
1±0.006
26.33
1±0.008
26.33
LOX-
0.3±0.001
31.8
1.33±0.2
24.6
0.7±0.06
26.5
1.17±0.1
26.28
1.35±0.01
25.83
LOX+
371.2±71
19.63
1.71±0.3
25.02
1.4±0.11
25.64
0.78±0.06
27.21
0.8±0.3
26.85
2-Ct: results were normalized according to LOX and LOX-like mRNA expression levels in Ctrl cells.
Ct: cycle threshold.
Related documents