Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplementary Table S1. Primer pairs used for quantitative real-time PCR analysis. Gene Sequences of primer pairs LOX (R) 5’-TTGGTCGGCTGGCTAAGAAAT-3’ and (F) 5’- GGATACGGCACTGGCTACTTC -3’ LOXL1 (R) 5’-TGGCAGTCGATGTAAGAAAT-3’ and (F) 5’- GCACCTCTCATACCAGGGC -3’ LOXL2 (R) 5’-GCTTGCGGTAGGTGAG-3’ and (F) 5’- CGGAGGATGTCGGTGTGGT -3’ LOXL3 (R) 5’-GTTGGCACACTATACCGCTTG-3’ and (F) 5’- ACCACAGCATGGACATCTTCACTC -3’ LOXL4 (R) 5’-AGCGGCACTGCAGCATATTG-3’ and (F) 5’- ACACCTACCGGCATGACATTGA -3’ TWIST1 (R) 5’-TCTGGAGGACCTGGTAGAGG-3’ and (F) 5’-GGAGTCCGCAGTCTTACGAG-3’ SNAI1 (R) 5’-CCAGGCTGAGGTATTCCTT-3’ and (F) 5’-CCTCCCTGTCAGATGAGGAC-3’ VIM (R) 5’-GCTTCCTGTAGGTGGCAATC-3’ and (F) 5’-GAGAACTTTGCCGTTGAAGC-3’ CDH-1 (R) 5’-CATTCTGATCGGTTACCGTGATC-3’ and (F) 5’-AGAACGCATTGCCACATACACTC-3’ 18S (R) 5’-CCATCCAATCGGTAGTAGCG-3’ and (F) 5’-GTAACCCGTTGAACCCCATT-3’ L32 (R) 5’-CAGCTCTTTCCACGATGGCT-3’ and (F) 5’-CAAGGAGCTGGAAGTGCTGC-3’ RT-PCR experiments were conducted on cells under >20 day treatment with dox. For all the samples, total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Results were normalised to 18S and are expressed as fold induction ± SD (n > 3). In some experiments, relative LOX expression levels were normalised according to the Ct value of the gene encoding the ribosomal protein L32 and results were expressed as fold differences equal to 2-CT. LOs primers were purchased from Invitrogen. All other primers were purchased from Eurofin MWG Operon. Supplementary Table S2. Summary of the gene expression datasets used for meta-analysis Dataset Platform Samples (N) Details Reference Cancer Genome Atlas RNAseq 147 Colorectal adenocarcinoma Cancer Genome Atlas Network (2015) 32 Sporadic colon cancer samples Reid et al (2009) 89 AJCC stage II CRC patients de Sousa (2011) 159 Colorectal cancer Sheffer 2009 145 Colorectal cancer patients Smith (2010) GSE16125 GSE33113 Affymetrix Human Exon 1.0 ST Array Affymetrix Human Genome U133 Plus 2.0 Array Affymetrix U133A arrays GSE41258 GSE17536 GSE31595 GSE12945 Affymetrix Human Genome U133 Plus 2.0 Array Affymetrix Human Genome U133 Plus 2.0 Array Affymetrix Human Genome U133A Array 37 51 Patients with stage II and III colorectal cancer Microdissected colorectal cancer Thorsteinsson (2012) Staub (2009) References: Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012;487:330-337. de Sousa E Melo F, Colak S, Buikhuisen J, Koster J, de Jong JH et al. Methylation of cancer-stem-cell-associated Wnt target genes predicts poor prognosis in colorectal cancer patients. Cell Stem Cell 2011;9:476-485. Reid JF, Gariboldi M, Sokolova V, Capobianco P, Lampis A, Perrone F et al. Integrative approach for prioritizing cancer genes in sporadic colon cancer. Genes Chromosomes Cancer 2009;48:953-962. Smith JJ, Deane NG, Wu F, Merchant NB, Zhang B, Jiang A, et al. Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer. Gastroenterology 2010;138:958-968. Staub E, Groene J, Heinze M, Mennerich D, Roepcke S, Klaman I et al. An expression module of WIPF1-coexpressed genes identifies patients with favorable prognosis in three tumor types. J Mol Med 2009;87:633-644. Thorsteinsson M1, Kirkeby LT, Hansen R, Lund LR, Sørensen LT, Gerds TA, et al. Gene expression profiles in stages II and III colon cancers: application of a 128-gene signature. Int J Colorectal Dis 2012;27:1579-1586. Sheffer M, Bacolod MD, Zuk O, Giardina SF, Pincas H, Barany F, et al. Association of survival and disease progression with chromosomal instability: a genomic exploration of colorectal cancer. Proc Natl Acad Sci U S A 2009;106:7131-7136. Supplementary Table S3. Expression levels of LOX-like mRNAs in Hct116 cells transduced for LOX overexpression (LOX+) or silencing (LOX-), compared to mock-transduced Hct116 cells (Ctrl). Cells LOX LOXL1 LOXL2 LOXL3 LOXL4 2-Ct Ct 2-Ct Ct 2-Ct Ct 2-Ct Ct 2-Ct Ct Ctrl 1±0.14 26..6 1.03±0.3 25.17 1±0.55 25.7 1±0.006 26.33 1±0.008 26.33 LOX- 0.3±0.001 31.8 1.33±0.2 24.6 0.7±0.06 26.5 1.17±0.1 26.28 1.35±0.01 25.83 LOX+ 371.2±71 19.63 1.71±0.3 25.02 1.4±0.11 25.64 0.78±0.06 27.21 0.8±0.3 26.85 2-Ct: results were normalized according to LOX and LOX-like mRNA expression levels in Ctrl cells. Ct: cycle threshold.