Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Regulation of gene expression Lecture plan about 40 min to be given during digestion of plasmids Concepts of DNA genes etc Structure of a gene Details of transcription Transcription factors Environment and transcription factors Examples in the ear Organ of Corti Endolymph Tectorial membrane Inner hair cells Stria Vascularis Outer hair cells Spiral Limbus Supporting cells Basilar membrane Cell diversity Different shapes Different function Different protein content Inner hair cells Outer hair cells Supporting cells Nuclei DNA: same in all cells of an organism (with a few exceptions) How can cells that have the same DNA express different proteins? Differences in protein content • The human DNA consist of approximately 3x109 bases and contain about 100,000 genes. • Any one cells may contain 5-10,000 different proteins. • Within a cell a protein may be present in about 10 copies while another protein may be present in 100,000 copies (even if there is only one DNA sequence for each of these proteins). • Within the same cell some proteins are present throughout the life of the cell, while others are present for only very limited periods. • How can all this be possible? Cooking a cell Proteins DNA Proteins Italian Cuisine Italian Cuisine Regulation of Gene Expression • The cell can select: – which genes to express – when to express them – how much to express them Gene Promoter Exons DNA Introns Transcription gene Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 ACGTCTAGTACTGCATTAGCGATGCATACGATGCATGCAAAGGCATAC TGCAGATCATGACGTAATCGCTACGTATGCTACGTACGTTTCCGTATG DNA ACGTCTAGTACTGCATTAGCGATGCATACGATGCATGCAAAGGCATAC RNA polymerase RNA GUAC TGCAGATCATGACGTAATCGCTACGTATGCTACGTACGTTTCCGTATG nuclear factors hRNA GUACUGCAUUAGCGAUGCAUACGAUGCAUGCAAAGGCAUAC (heteronuclear) splicing mRNA (messenger) GUACUGCAUUCAUACGGGCAUACAAAAAAAAAAAA polyA tail Alternative splicing hRNA GUAGAUGAUUAGCGAUGCAUACGAUGCAUGCAAAGGCUAAC GUAGAUGAUUCAUACGGGCUAAC Met Ile His Thr Gly Stop GUAGAUGAUUGGCUAAC Met Ile Gly Stop The Promoter nuclear factors elongation factors complex RNA pol. exon1 TAAATA Responsive elements RNA polymerase binding site DNA The Promoter nuclear factors RNA pol. TAAATA DNA RNA The Promoter RNA DNA Nuclear Factors • proteins that bind to specific DNA sequences and that influence gene expression • also known as: transcription factors regulatory factors • the DNA sequences that they bind to are known as: transcription element regulatory elements regulatory consensus sequences • the regulation of expression and activity of nuclear factors determines which proteins will be expressed in the cell selective gene expression GeneA GeneA Exon1 Exon1 GeneB Exon1 Exon1 GeneB selective gene expression RNA Pol. GeneA Exon1 Exon1 GeneB RNA Pol. GeneA Exon1 GeneB Exon1 Signal transduction to the nucleus G adenylate cyclase cAMP nucleus PKA CREB P P CREB CREB CREB = cAMP responsive element binding protein RNA Gene expression Signals can induce gene expression in specific cells P CREB GeneA GeneA RNA Pol. Exon1 Exon1 GeneB Exon1 Exon1 GeneB Time scale of gene expression Gene C Gene B Gene A Time Birth Death Gene gene interaction Precursor Cell type A Differentiated Cell type A Precursor Cell Type B Differentiated Cell type B Time Gene expression assays Western Blot Protein levels Immunocytochemstry ACGTA Northern Blots RNA levels UGCAU PCR InSitu Hybridization ACGTA UGCAU Probe hybridisation A-T C-G G A T C G Probe C T T A T C Probe hybridisation A T C A G G A C C C T T G T T A C T G Probe hybridisation T C G T G G T T C T G C T G T A C G C T A T C C C T A T C T G T T A C T G T A C A C T A hybridisations C G A T G C G T C T A T A G C In situ hybridisation • fix tissue T • Cut thin sections (10-50 um) • hybridise with probe • wash unbound probe • visualize probe C T T T A Northern Blot • RNA extraction • gel electrophoresis • blot to nitrocellulose • hybridise with probe • wash unbound probe • visualize probe C RT-PCR reverse transcriptase-polymerase chain reaction UGGGUACAAUGGGUACAAUGGGUAC Reverse trancriptase TGGGTACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG RT-PCR Denaturation 94°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG RT-PCR Annealing 55-60°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC TACCC TACAA ACCCATGTTACCCATGTTACCCATG RT-PCR Elongation ( Taq DNA polymerase) 72°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG RT-PCR-2nd cycle 94°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG RT-PCR (2nd cycle) 55-60°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC TACCC TACAA ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC TACCC TACAA ACCCATGTTACCCATGTTACCCATG RT-PCR (2nd cycle) 72°C 1007550250-25- TGGGTACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGG ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG RT-PCR 3rd cycle TGGGTACAATGGGTACAATGGGTAC 94°C ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGG ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC ACCCATGTTACCCATGTTACCCATG 1007550250-25- RT-PCR 3rd cycle TGGGTACAATGGGTACAATGGGTAC TACCC TACAA ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGG TACCC TACAA ACCCATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC TACCC TACAA ATGTTACCCATGTTACCC TACAATGGGTACAATGGGTAC TACCC TACAA ACCCATGTTACCCATGTTACCCATG 55-60°C 1007550250-25- 4th cycle Summary of gene expression detection techniques Technique Sensitivity Specificity Anatomical information Northern Blot Medium High Adjustable Limited RT-PCR Very High Very High Limited InSitu Hybridisation High High High Study of gene expression • the regulation of expression and activity of nuclear factors determines which proteins will be expressed in the cell • nuclear factors can be modulated by external and/or internal signals • the expression of one gene often affects the expression of other genes, both in the same cell and in other cells. • the characterisation of the ”signal to gene” and “gene to gene talk” is one of the key focus of molecular biology.