Download Here is a DNA Sequence to be replicated by each member of the class

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Here is a DNA Sequence to be replicated by each member of the class.
Read the sequence at a constant pace to your neighbor while they write it
down on a sheet of paper. Please do not read DNA bases in groups and do
not stop or repeat any bases.
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Final DNA Sequence)
After the last person has finished writing down the DNA sequence, compare
it to the original Sequence shown above. What kind of changes do you
notice?
On the next page, compare the original and final sequences in terms of
transcription and translation. What is the effect of the differences between
these sequences?
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original RNA Sequence)
(Original Protein Sequence)
(Final DNA Sequence)
(Final RNA Sequence)
(Final Protein Sequence)
Write down the DNA sequence that you hear. Next, read the sequence at a
constant pace to your neighbor while they write it down on a sheet of paper.
Please do not read DNA bases in groups and do not stop or repeat any
bases. Afterwards, you will be given a copy of the original sequence.
Compare it to your sequence. What kind of changes do you notice?
(Your DNA Sequence)
On the next page, compare the original and your sequences in terms of
transcription and translation. What is the effect of the differences between
these sequences?
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original RNA Sequence)
(Original Protein Sequence)
(Your DNA Sequence)
(Your RNA Sequence)
(Your Protein Sequence)
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
(Original DNA Sequence)
CTTACTAGTTCAGGACACTGGTGATTAAAC
Related documents