Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplementary Table S1. E. coli strains and plasmids used. Kanamycin (KmR) was used at 50 µg ml-1 for culturing the E. coli BW25113 isogenic mutants and at 100 µg ml-1 to maintain the pBS(Kan)-derived plasmids. Chloramphenicol (CmR) at 30 µg ml-1 was used for the pCA24N-derived plasmids and 50 µg ml-1 was used for pMMB206 or pMMB277. Strains and plasmids Strain E. coli K-12 BW25113 Genotype/relevant characteristics lacIq rrnBT14 lacZWJ16 hsdR514 araBA-DAH33 rhaBADLD78 (Baba et al. 2006) E. coli K-12 BW25113 ydeI E. coli K-12 BW25113 ydhM E. coli K-12 BW25113 K-12 BW25113 ydeI KmR (Baba et al. 2006) yeaQ E. coli K-12 BW25113 yoaG E. coli K-12 BW25113 yeaR E. coli K-12 BW25113 yebV E. coli K-12 BW25113 yodD E. coli K-12 BW25113 yegP E. coli K-12 BW25113 ygiW E. coli K-12 BW25113 rpmG E. coli K-12 BW25113 rpmE E. coli K-12 BW25113 ybdB E. coli K-12 BW25113 ybiI E. coli K-12 BW25113 ybiX E. coli K-12 BW25113 feaR E. coli K-12 BW25113 nhoA E. coli K-12 BW25113 sufE E. coli K-12 BW25113 sufS E. coli K-12 BW25113 sufC E. coli K-12 BW25113 tap E. coli K-12 BW25113 fliD E. coli K-12 BW25113 fliS E. coli K-12 BW25113 yedF E. coli K-12 BW25113 yeeF E. coli K-12 BW25113 mglC E. coli K-12 BW25113 mglA E. coli K-12 BW25113 mglB E. coli K-12 BW25113 galS E. coli K-12 BW25113 hcaR E. coli K-12 BW25113 luxS E. coli K-12 BW25113 yhcN E. coli K-12 BW25113 ibpB E. coli K-12 BW25113 ibpA Source R K-12 BW25113 ydhM Km (Baba et al. 2006) R K-12 BW25113 yeaQ Km (Baba et al. 2006) R K-12 BW25113 yoaG Km (Baba et al. 2006) R K-12 BW25113 yeaR Km (Baba et al. 2006) K-12 BW25113 yebV Km R (Baba et al. 2006) R K-12 BW25113 yodD Km (Baba et al. 2006) R K-12 BW25113 yegP Km (Baba et al. 2006) K-12 BW25113 ygiW Km R (Baba et al. 2006) K-12 BW25113 rpmG Km (Baba et al. 2006) K-12 BW25113 rpmE Km (Baba et al. 2006) R R K-12 BW25113 ybdB Km (Baba et al. 2006) R K-12 BW25113 ybiI Km (Baba et al. 2006) K-12 BW25113 ybiX Km (Baba et al. 2006) R R K-12 BW25113 feaR Km R (Baba et al. 2006) K-12 BW25113 nhoA Km (Baba et al. 2006) R K-12 BW25113 sufE Km (Baba et al. 2006) R K-12 BW25113 sufS Km (Baba et al. 2006) K-12 BW25113 sufC KmR (Baba et al. 2006) R K-12 BW25113 tap Km (Baba et al. 2006) K-12 BW25113 fliD Km (Baba et al. 2006) R R K-12 BW25113 fliS Km R (Baba et al. 2006) K-12 BW25113 yedF Km R (Baba et al. 2006) R (Baba et al. 2006) K-12 BW25113 yeeF Km K-12 BW25113 mglC Km (Baba et al. 2006) K-12 BW25113 mglA Km (Baba et al. 2006) R R K-12 BW25113 mglB Km (Baba et al. 2006) R K-12 BW25113 galS Km (Baba et al. 2006) K-12 BW25113 hcaR Km (Baba et al. 2006) R K-12 BW25113 luxS Km (Baba et al. 2006) R K-12 BW25113 yhcN Km (Baba et al. 2006) R K-12 BW25113 ibpB Km (Baba et al. 2006) K-12 BW25113 ibpA Km (Baba et al. 2006) R R R E. coli K-12 BW25113 tnaA E. coli K-12 BW25113 tnaB E. coli K-12 BW25113 glnG E. coli K-12 BW25113 yjaA E. coli K-12 BW25113 yjcB E. coli TG1 Plasmids pBS(Kan) pBS(Kan) -TOM-Green K-12 BW25113 tnaA KmR (Baba et al. 2006) K-12 BW25113 tnaB Km (Baba et al. 2006) R R K-12 BW25113 glnG Km (Baba et al. 2006) R K-12 BW25113 yjaA Km (Baba et al. 2006) K-12 BW25113 yjcB Km R (Baba et al. 2006) supE hsdΔ5 thi Δ(lac-proAB) F' [traD36 proAB lacI lacZΔM15] + q (Sambrook et al. 1989) pMMB206 Empty vector; KmR pBS(Kan) plac::TOM-Green; expresses the evolved TOMGreen from Burkholderia cepacia G4 Empty vector, AmpR pMMB206-TOMGreen pMMB277 pMMB206 ptac-lacUV5::TOM-Green; expresses the evolved TOM-Green from Burkholderia cepacia G4 Empty vector; CmR pMMB277-IsoILR1GSHI* pBS(Kan)-EchA F108L/I219L/C248I pCA24N pMMB277 ptac:: IsoILR1-GSHI*; expresses IsoILR1 from Rhodococcus AD45 and GSHI* from E. coli pBS(Kan) plac::EchA F108L/I219L/C248I; expresses the evolved EchA F108L/I219L/C248I from Agrobacterium radiobacter AD1 Empty vector; CmR (Kitagawa et al. 2005) pCA24N-ygiW pCA24N pT5-lac::ygiW; expresses YgiW derived from E. coli (Kitagawa et al. 2005) pCA24N-ychH pCA24N-yhcN pCA24N-galS pCA24N pT5-lac::ychH; expresses YchH derived from E. coli pCA24N pT5-lac::yhcN; expresses YhcN derived from E. coli pCA24N pT5-lac::galS; expresses GalS derived from E. coli (Kitagawa et al. 2005) (Kitagawa et al. 2005) (Kitagawa et al. 2005) (Canada et al. 2002) (Canada et al. 2002) (Rui et al. 2004a) (Rui et al. 2004a) (Morales et al. 1991) (Rui et al. 2004b) (Rui et al. 2004a) Additional reference: Morales, V.M., Bäckman, A. and Bagdasarian, M. (1991) A series of wide-host-range low-copy-number vectors that allow direct screening for recombinants. Gene 97, 39-47. Supplementary Table S2. Primers used for qRT-PCR and verification of isogenic mutants. Gene Forward Primer Reverse Primer rpoA 5’-CGCGGTCGTGGTTATGTG-3’ 5’-GCGCTCATCTTCTTCCGAAT-3’ gshA 5’-AAAACCGAGTGCGGTATGTATTA-3’ 5’-AGCCTCTTACCGTCTTTCTCAAT-3’ tauA 5’-GTTTATCTCCACCACCCACTACA-3’ 5’-GTTCAGAATCGGTCAACACCTT-3’ ibpB 5’-CGTAACTTCGATTTATCCCCACT-3’ 5’-CTAAATCTTCCTGACGGAAACCT-3’ yfiD 5’-CAGTAAGCAAACTGGGTGACATT-3’ 5’-CAGAGAGTTAAAGCGAACTGCAT-3’ sufS 5’-ATTACTCATGTCTCCAACGTGCT-3’ 5’-TTCACATAAAGAATGCCAATTCC-3’ mglA 5’-TACTTGTTGGAAATGAGCGGTAT-3’ 5’-AAATCGATCTCTTTACCCTGGAA-3’ tnaB 5’-TAATTGGTGGAGGTATGTTTGCT-3’ 5’- TAATGTTCCAGGTGTTACCGATT -3’ ydeI 5'-GTCTTTGACTCAACGCGGATGTCAGGT-3’ 5'-AGTTCCTTGTGCGCGCTATTCTAACGA-‘3 yhcN 5'-TGATATGGGTCACGAAACAAAGGCCCA-3’ 5'-TGTTCATCTGGGAGAGAAAACGCGTCG-3’ yjaA 5'-GACCCCATGCCGAACTCAGAAGTGAAA-3’ 5'-GGCGGTTGGGTTCTATAAGAAGGTGGG-3’ yodD 5'-CTCCTGTGGCTTTGTGCCAGTGTAGAA-3’ 5'-GGAACATTTGCTTCGCGTAAACGGGTG-3’ R Km 5’-CAGTCATAGCCGAATAGCCT-3’ Supplementary Table S3. E. coli genes significantly induced or repressed (P < 0.05) with 1 mmol l-1 cis-DCE mineralization for 2 h by whole E. coli cells expressing (i) eight genes encoding evolved toluene ortho-monooxygenase, glutathione S-transferase, and -glutamylcysteine synthetase vs. no cloned genes (two independent experiments were performed using two independent biological replicates) and (ii) six genes encoding evolved toluene ortho-monooxygenase and evolved epoxide hydrolase vs. evolved toluene ortho-monooxygenase (no evolved EH). Raw data for the four DNA microarrays are available using GEO series accession number GSE 13698. Primarily, genes differentially-expressed above 3-fold for the 8-gene microarrays and above 2-fold for the EH microarrays are shown although some related genes are shown for completeness. N/D: not detected. Asterisks (*) indicate the selection of possible stress related genes for further phenotypic study. Gene b# Fold changes GST/GSH vs. no EH vs. gene no EH 1st 2nd Sulfate metabolism tauA b0365 10.6 tauB b0366 9.2 tauC b0367 3.7 tauD b0368 4.0 cbl b1987 5.3 cysK b2414 cysA b2422 cysP b2425 cysN b2751 cysD b2752 iscS b2530 gshA b2688 sbp b3917 Stress-related genes bolA b0435 glxA2 b0505 glxA3 b0506 gloA b1651 dps b0812 grxA b0849 sulA b0958 8.6 7.0 2.5 3.0 6.1 1.0 1.1 1.1 1.1 1.1 3.2 2.6 2.8 2.6 4.0 2.3 13.9 4.0 6.5 2.8 7.0 3.5 8.0 5.3 21.1 7.0 2.0 -1.1 1.3 -1.1 1.1 1.2 1.4 1.1 3.0 -1.1 1.1 1.3 3.2 2.5 1.1 2.6 -1.4 1.4 1.1 2.8 3.5 3.7 1.4 2.8 2.0 2.1 1.4 3.0 2.3 msyB b1051 6.5 2.6 1.7 bshA ariR osmB marR marA b1112 b1166 b1283 b1530 b1531 4.0 -1.9 8.6 2.0 1.9 7.5 -2.0 7.5 2.5 2.1 2.3 2.3 -1.7 2.8 3.7 slyB slyA nemA b1641 b1642 b1650 2.0 1.6 2.1 2.5 2.1 1.2 2.0 1.9 3.5 Lee et al., Texas A & M Gene Taurine transport system periplasmic protein Taurine ATP-binding component of a transport system Taurine transport system permease protein Alpha-ketoglutarate-dependent taurine dioxygenase Transcriptional regulator cys regulon, accessory circuit affecting cysM Cysteine synthase A, O-acetylserine sulfhydrolase A ATP-binding component of sulfate permease A protein Thiosulfate binding protein ATP-sulfurylase, subunit 1, probably a GTPase ATP:sulfurylase (ATP:sulfate adenylyltransferase), subunit 2 Cysteine desulfurase Gamma-glutamate-cysteine ligase Periplasmic sulfate-binding protein Possible regulator of murein genes Ureidoglycolate hydrolase, conversion of glyoxylate Repressor of allantoin and glyoxylate utilization operons Glyoxalase I, nickel isomerase Global regulator, starvation conditions Glutaredoxin1 redox coenzyme for ribonucleotide reductase Suppressor of lon, inhibitor of cell division and FtsZ ring formation Acidic protein suppresses mutants lacking function of protein export YcfR, stress response protein, biofilm related. Indole inducing acid resistance gene Osmotically inducible lipoprotein Multiple antibiotic resistance protein; repressor of mar operon Multiple antibiotic resistance; transcriptional activator of defense systems Putative outer membrane lipoprotein Transcriptional activator for hemolysin (MarR family) N-ethylmaleimide reductase, induced due to lipid peroxidation 4 osmE yfiD mdaB glgS slyD dnaK b1739 b2579 b3028 b3049 b3349 b0014 3.7 1.6 3.5 4.3 1.1 6.1 2.0 3.5 4.9 3.0 2.0 5.3 1.3 4.6 1.7 1.6 2.1 1.1 dnaJ clpB grpE hspQ hsp15 hslJ hslO hslV b0015 b2592 b2614 b0966 b3400 b1379 b3401 b3932 3.2 4.9 3.5 3.5 7.5 3.5 4.0 3.2 2.6 4.6 6.1 4.9 6.1 3.5 3.0 2.6 1.1 1.0 1.6 1.6 2.1 1.3 1.9 1.1 htpG htpX ibpB* ibpA* groS groL b0473 b1829 b3686 b3687 b4142 b4143 5.3 3.0 8.6 9.8 8.0 5.3 2.8 7.5 9.8 9.8 6.1 4.6 -1.2 2.1 2.0 2.3 1.5 -1.1 cpxP b3914 ytfE b3913 b3914 b4209 3.2 3.0 2.1 7.0 6.5 2.0 2.6 2.6 3.2 chpS osmY csrA b4224 b4376 b2696 3.2 3.2 2.5 2.8 2.6 2.8 1.4 1.7 2.1 3.2 2.8 9.8 5.3 4.3 3.5 13.0 6.1 N/D N/D N/D N/D Activator of ntrL gene Stress-induced alternate pyruvate formate-lyase subunit Modulator of drug activity B Glycogen biosynthesis, rpoS dependent FKBP-type peptidyl prolyl cis-trans isomerase (rotamase) Chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins Chaperone with DnaK; heat shock protein Heat shock protein Heat shock protein; protein repair Heat shock protein Heat shock protein Heat shock protein HslJ Hsp33; redox regulated chaperone, heat shock locus Heat shock protein HslVU, proteasome-related peptidase subunit Chaperone Hsp90, heat shock protein Heat shock protein, integral membrane protein Heat shock protein Heat shock protein Chaperone protein GroEL (Hsp60) GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein Periplasmic protein combats stress Periplasmic protein combats stress Hypothetical protein, ytfE mRNA are increased in cells treated with NO Component of a toxin-antitoxin system Hyperosmotically inducible periplasmic protein Carbon storage regulator, post-translational activator of flhDC expression CsrB regulatory RNA CsrC regulatory RNA Small RNA regulates as an antisense RNA for ompA mRNA Global regulatory RNA OxyS 1.9 1.0 1.4 3.0 3.0 1.9 5.7 2.3 4.3 1.5 2.5 4.9 4.9 1.4 1.0 3.0 1.4 1.5 2.8 4.3 3.5 4.3 3.2 1.6 1.2 4.6 2.8 8.0 1.7 2.1 2.0 2.0 2.1 -1.2 1.6 2.0 1.3 2.3 1.9 2.3 1.6 1.1 1.3 2.1 2.5 Aspartate 1-decarboxylase Repressor of frmRAB Component of Sec-independent translocase ATPase of high-affinity potassium transport system, B chain ATPase of high-affinity potassium transport system, A chain Outer membrane protease, receptor for phage OX2 Macrolide-specific ABC-type efflux carrier Putative carrier/transport protein Quinone oxidoreductase Fermentative D-lactate dehydrogenase, NAD-dependent Murein lipoprotein L-serine deaminase Putative periplasmic binding transport protein dTDP-glucose 4,6 dehydratase Phosphohistidine phosphatase csrB b4408 csrC b4457 sraD b4442 oxyS b4458 Other metabolism panD b0131 yaiN b0357 ybeC b0627 kdpB b0697 kdpA b0698 ompX b0814 macB b0879 yccA b0970 wrbA b1004 ldhA b1380 lpp b1677 sdaA b1814 fliY b1920 rfbB b2041 sixA b2340 Lee et al., Texas A & M 5 smpA b2617 -1.1 pstS b3728 1.9 miaA b4171 2.5 RNA and ribosomal genes rrsH b0201 2.8 rrsG b2591 2.8 rrfH b0205 3.0 rmf b0953 4.3 rpsV b1480 8.6 rplY b2185 2.1 raiA b2597 3.2 1.6 4.6 4.6 2.0 1.6 1.3 Small membrane protein A Periplasmic phosphate-binding protein Isopentenylpyrophosphate tRNA-adenosine transferase 4.9 4.6 5.3 5.3 3.2 3.5 6.1 1.1 1.2 1.4 1.5 2.0 1.9 2.1 rnpB b3123 yhbY b3180 rplU b3186 rplO b3301 rpmF b1089 rpmA b3185 rpmD b3302 rpmG* b3636 rpmB b3637 rpmE* b3936 gcvB b4443 Unknown function ybbN b0492 ybgC b0736 yccV b0966 yccJ b1003 ycfJ b1110 ycfQ b1111 ycgZ b1164 ymgA b1165 ymgC b1167 ychH* b1205 yciN b1273 ycjX b1321 yedI b1586 ydhM* b1649 ydhD b1654 yeaQ* b1795 yoaG* b1796 b1797 yeaR* b1836 yebV* dsrB b1952 3.0 1.1 2.5 2.5 1.1 1.7 2.1 2.3 2.1 2.3 1.4 5.3 2.5 3.7 4.3 2.1 3.5 3.5 4.3 4.6 4.0 4.9 1.0 2.5 2.0 1.1 1.9 2.0 -1.2 2.6 2.8 2.0 N/D 16S rRNA 16S rRNA 5S rRNA Ribosome modulation factor 30S ribosomal subunit protein S22, stationary-phase-induced 50S ribosomal subunit protein L25 Stationary phase translation inhibitor and ribosome stability factor RNase P, RNA component; M1 RNA Possible RNA-binding protein 50S ribosomal subunit protein L21 50S ribosomal subunit protein L15 50S ribosomal subunit protein L32 50S ribosomal subunit protein L27 50S ribosomal subunit protein L30 50S ribosomal subunit protein L33 50S ribosomal subunit protein L28 50S ribosomal subunit protein L31 Regulatory RNA 3.0 1.5 3.5 3.2 4.3 3.0 -1.3 -1.3 -2.3 5.3 2.1 3.2 4.6 3.5 2.1 3.5 -1.1 1.3 3.0 3.5 2.6 2.3 4.9 1.7 4.0 3.0 -1.3 -1.2 -2.0 2.3 2.6 1.5 3.5 2.8 3.7 2.0 1.3 1.9 1.6 1.9 1.1 2.1 1.6 1.2 1.1 1.6 2.3 2.1 2.0 1.3 2.0 1.3 1.6 3.5 2.6 2.8 3.0 3.5 2.0 1.7 5.7 4.6 1.6 4.0 3.0 2.1 1.9 2.1 1.9 2.0 1.5 1.3 2.0 1.4 1.7 yodD* yodC yeeX yegP* elaB b1953 b1957 b2007 b2080 b2266 Lee et al., Texas A & M Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein in ariR (ymgB) operon Hypothetical protein in ariR (ymgB) operon Hypothetical protein in ariR (ymgB) operon Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein; responds to nitric oxide hypothetical protein hypothetical protein; transcription is regulated by RpoS and DsrA RNA Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein 6 ypeC b2390 yfhL b2562 b3024 ygiW* yqjC b3097 yhbY b3180 yhgI b3414 b4250 b4250 Repressed genes b0309 b0309 ybcU b0557 ycjT b1316 manZ b1819 yeeF b2014 b2857 b2857 ygeW b2870 malK b4035 soxS b4062 Indole-related genes trpE b1264 trpL b1265 tnaC b3707 tnaA b3708 3.5 1.1 4.9 2.5 1.1 2.3 -1.1 4.9 1.9 3.0 2.3 2.5 4.0 -1.1 N/D 2.0 1.7 2.0 2.5 2.1 2.3 Hypothetical protein Hypothetical protein Hypothetical protein (b3024) Hypothetical protein Possible RNA-binding protein Hypothetical protein Hypothetical protein -1.1 -3.0 -1.4 1.0 -1.2 1.1 -1.4 -1.9 2.1 -1.3 -1.4 -1.9 -1.3 -1.9 -2.5 -1.7 -1.4 2.6 -2.1 -1.2 -2.6 -4.6 -2.5 -2.3 -3.0 -2.0 -2.0 Hypothetical protein Hypothetical protein Hypothetical protein PTS enzyme IID, mannose-specific Putative amino acid/amine transport protein Hypothetical protein Putative carbamoyl transferase ATP-binding component of transport system for maltose Regulation of superoxide response regulon -2.0 -8.0 -1.5 -1.5 -1.6 -1.9 1.3 -1.1 -1.3 -1.9 -2.0 -1.7 Anthranilate synthase component I trp operon leader peptide Tryptophanase leader peptide Tryptophanase Lee et al., Texas A & M 7 Supplementary Table S4. E. coli genes induced in exponentially-growing cells (turbidity at 600 nm of 1) upon addition of 2 mmol l-1 H2O2 for 10 min to K12 BW25113 (more than 4 fold), to BW25113 ygiW (more than 10 fold), and to BW25113 ychH (more than 10 fold) in LB medium at 37°C. Some genes with less significant fold changes are shown for completeness. +H2O2 represents treatment with H2O2. Raw data for the six DNA microarrays are available using GEO series accession number GSE 13698. Pounds (#) indicate newly identified induced stress genes with H2O2 treatment. Triangles () indicate the selection of possible stress related genes for further phenotypic study. Fold changes WT+ H2O2 ygiW+H2O2 ychH+H2O2 vs. WT vs. ygiW vs. ychH stress, metabolism, transport entF b0586 8.0 9.2 13.0 entD b0583 6.5 6.5 4.0 entC b0593 5.3 7.5 21.1 entE b0594 8.6 9.2 27.9 entB b0595 8.0 5.7 18.4 entA b0596 8.0 7.0 18.4 grxA b0849 5.3 11.3 27.9 poxB b0871 7.5 22.6 11.3 # b0958 6.5 3.2 6.1 sulA # b0231 7.5 5.3 9.2 dinP b1061 4.3 2.8 10.6 dinI# 7.5 1.9 5.3 dinD# b3645 4.0 4.0 4.3 dinF# b4044 fhuE b1102 9.2 12.1 32.0 bshA b1112 1.9 13.9 32.0 ariR b1166 5.3 9.2 9.8 8.6 8.6 18.4 umuD# b1183 11.3 8.0 12.1 umuC# b1184 b1463 12.1 14.9 17.1 nhoA b1679 13.0 34.3 36.8 sufE b1680 8.0 18.4 19.7 sufS sufD b1681 8.0 13.0 12.1 b1682 8.6 13.9 13.9 sufC sufB b1683 7.0 8.0 7.0 sufA b1684 4.9 9.2 11.3 7.5 1.6 4.0 sbmC# b2009 cirA b2155 6.1 4.6 16.0 9.2 8.0 13.9 recN# b2616 # b2698 4.6 4.9 5.7 recX # b4458 7.0 4.9 14.9 oxyS Unknown function 7.5 6.5 18.4 ybdB b0597 ybiJ b0802 4.6 8.0 16.0 b0803 5.3 4.6 6.5 ybiI b0804 8.6 5.7 18.4 ybiX ymgC b1167 5.3 13.0 12.1 yedR b1963 1.1 21.1 10.6 b3238 6.5 8.6 13.0 yhcN yjcB b4060 -1.9 34.3 9.2 Gene b# Lee et al., Texas A & M Description ATP-dependent serine activating enzyme 4'-phosphopantetheinyl transferase EntD Isochorismate synthase EntC 2,3-dihydroxybenzoate-AMP ligase Isochorismatase 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase Glutaredoxin 1 Pyruvate dehydrogenase/oxidase SOS cell division inhibitor DNA polymerase IV, stress inducible DNA-damage-inducible protein I DNA-damage-inducible protein DNA-damage-inducible protein F FhuE receptor precursor YcfR, stress response biofilm regulator Indole inducing acid resistance gene DNA repair protein UmuD DNA repair protein UmuC N-hydroxyarylamine O-acetyltransferase SufE protein Selenocysteine lyase, PLP-dependent SufD protein Probable ATP-dependent transporter SufC SufB protein SufA protein DNA gyrase inhibitory protein, SOS inducible Colicin I receptor precursor DNA repair protein RecN Regulatory protein RecX, DNA repair protein Global regulatory RNA OxyS Hypothetical protein YbdB Hypothetical protein YbiJ precursor Hypothetical protein Hypothetical protein YbiX Hypothetical protein in ariR (ymgB) operon Hypothetical protein YedR Hypothetical protein YhcN precursor Hypothetical protein YjcB 8 Supplementary Table S5. E. coli genes repressed in exponentially-growing cells (turbidity at 600 nm of 1) upon addition of 2 mmol l-1 H2O2 for 10 min to BW25113 (more than 4 fold), to BW25113 ygiW (more than 10 fold), and to BW25113 ychH (more than 10 fold) in LB medium at 37°C. Some genes with less significant fold changes are shown for completeness. +H2O2 represents treatment with H2O2. Raw data for the six DNA microarrays are available using GEO series accession number GSE13698. Triangles ( ) indicate the selection of possible stress related genes for further phenotypic study. Gene b# +H2O2 WT vs. WT Metabolism and transport aldA b1415 1.0 mglC b2148 -2.1 mglA b2149 -1.1 mglB b2150 -1.1 galS b2151 2.6 yhaO b3110 -1.6 tdcB b3117 -1.3 garP b3127 1.5 garD b3128 -1.2 agaY b3137 -6.5 dctA b3528 -1.1 lldP b3603 -2.5 tnaC b3707 -2.3 tnaB b3709 -1.7 rbsA b3749 -1.3 rbsC b3750 -1.6 malG b4032 -4.6 malF b4033 -4.0 malE b4034 -2.6 malK b4035 -3.2 malM b4037 -10.6 actP b4067 -3.2 Unknown function ykgE b0306 -1.4 ykgF b0307 -1.9 ykgG b0308 -2.1 ychS b1228 -6.5 yedE b1929 -1.4 yedF b1930 -1.7 yeiN b2165 -1.4 yeiC b2166 1.4 yqeF b2844 1.2 yqeC b2876 1.9 yhaM b3109 -2.5 yihL b3872 1.7 yihM b3873 1.2 yihN b3874 1.0 -4.0 yjaA b4011 yjcH b4068 -1.9 yjjM b4357 1.9 Lee et al., Texas A & M Fold changes ygiW+H2O2 ychH+H2O2 vs. ygiW vs. ychH Description -19.7 -21.1 -34.3 -26.0 -12.1 -18.4 -10.6 -21.1 -16.0 -1.4 -16.0 -13.0 -14.9 -36.8 -21.1 -10.6 -2.1 -4.6 -6.5 -11.3 -2.1 -2.5 -2.0 -39.4 -19.7 -4.6 -3.7 3.2 -14.9 -2.3 -5.3 -2.8 -3.2 -11.3 -3.2 -13.9 -2.1 -4.3 -17.1 -24.3 -13.9 -27.9 -14.9 -19.7 Aldehyde dehydrogenase A Methyl-galactoside transport and galactose taxis Galactoside transport ATP-binding protein MglA D-galactose-binding periplasmic protein precursor Mgl repressor and galactose ultrainduction factor Putative transport protein (HAAAP family) Threonine dehydratase catabolic Probable galactarate transporter D-galactarate dehydratase Tagatose-bisphosphate aldolase AgaY Aerobic C4-dicarboxylate transport protein L-lactate permease Tryptophanase leader peptide Low affinity tryptophan permease Ribose transport ATP-binding protein RbsA Ribose transport system permease protein RbsC Maltose transport system permease protein MalG Maltose transport system permease protein MalF maltose transport protein, chemotaxis Maltose/maltodextrin transport ATP-binding protein MalK Maltose operon periplasmic protein precursor Acetate permease -14.9 -7.5 -4.9 -3.5 -14.9 -12.1 -10.6 -12.1 -12.1 -6.1 -12.1 -13.0 -12.1 -10.6 -1.1 -4.3 -10.6 -16.0 -16.0 -11.3 2.5 -13.0 -9.2 -7.5 -9.8 -2.1 -10.6 1.6 -3.2 -7.0 -8.6 -1.5 -16.0 -2.1 Hypothetical protein YkgE Putative electron transport protein YkgF Hypothetical protein YkgG Hypothetical protein Hypothetical protein YedE Hypothetical protein YedF Hypothetical protein Putative kinase Probable acetyl-CoA acetyltransferase Hypothetical protein YqeC Hypothetical protein Hypothetical transcriptional regulator YihL Hypothetical protein YihM Hypothetical protein YihN Hypothetical protein YjaA Hypothetical protein YjcH Putative transcriptional regulator 9 Supplementary Table S6. E. coli genes induced more than 10 fold (P < 0.05) in exponentially-growing cells (turbidity at 600 nm of 1) upon addition of 2 mmol l-1 H2O2 for 10 min in BW25113 vs. BW25113 ygiW and BW25113 vs. BW25113 ychH in LB medium at 37°C. Some genes with less significant fold changes are shown for completeness. +H2O2 represents treatment with H2O2. Raw data for the six DNA microarrays are available using GEO series accession number GSE 13698. Deltas ( ) indicate the selection of possible stress related genes for further phenotypic study. Fold changes Gene b# WT WT+H2O2 vs. vs. ygiW+H2O2 ychH+H2O2 Transcription, metabolism, and transport fepE b0587 1.3 13.0 b1384 11.3 1.7 feaR aldA b1415 21.1 1.7 16.0 12.1 mglC b2148 29.9 10.6 mglA b2149 b2150 24.3 3.7 mglB b2151 10.6 4.3 galS fruB b2169 13.9 4.3 b2537 10.6 1.6 hcaR srlA b2702 11.3 3.0 srlE b2703 9.2 2.6 dctA b3528 13.0 2.8 dppD b3541 4.0 9.2 dppC b3542 4.9 9.2 tnaC b3707 12.1 1.6 b3708 4.3 1.6 tnaA 24.3 6.1 tnaB b3709 rbsA b3749 13.0 1.1 fadB b3846 17.1 1.9 malK b4035 10.6 6.5 acs b4069 9.8 3.2 treC b4239 12.1 6.1 gntP b4321 13.0 3.2 Unknown function b0268 14.9 4.0 yagE b0380 9.8 2.5 yaiZ 5.7 168.9 ychH b1205 9.2 13.9 yedE b1929 7.0 9.8 yedF b1930 B2014 -1.9 7.0 yeeF b2166 9.2 11.3 yeiC 11.3 2.5 yqeF b2844 477.7 1.2 ygiW b3024 b3081 12.1 2.3 ygjL b4047 -1.3 11.3 yjbL +H2O2 Lee et al., Texas A & M Description Ferric enterobactin (enterochelin) transport Regulatory protein for 2-phenylethylamine catabolism Aldehyde dehydrogenase A Methyl-galactoside transport and galactose taxis Galactoside transport ATP-binding protein MglA D-galactose-binding periplasmic protein precursor Mgl repressor and galactose ultrainduction factor PTS system, fructose-specific IIA/FPr component Bifunctional: transcriptional activator of Hca cluster (LysR family) PTS family enzyme IIC, glucitol/sorbitol-specific PTS system, glucitol/sorbitol-specific IIBC component Aerobic C4-dicarboxylate transport protein Dipeptide transport ATP-binding protein DppD Dipeptide transport system permease protein DppC Tryptophanase leader peptide Tryptophanase Low affinity tryptophan permease Ribose transport ATP-binding protein RbsA 3-Hydroxyacyl-CoA dehydrogenase Maltose/maltodextrin transport ATP-binding protein malK Acetyl-coenzyme A synthetase Trehalose-6-phosphate hydrolase Gluconate transport protein, GNT III system (GntP family) CP4-6 prophage; putative synthase Hypothetical protein YaiZ Hypothetical protein YchH Hypothetical protein YedE Hypothetical protein YedF Hypothetical protein YeeF Putative kinase Probable acetyl-CoA acetyltransferase Protein YgiW precursor 2,4-Dienoyl-CoA reductase [NADPH] Hypothetical protein 10 Supplementary Table S7. E. coli genes repressed more than 10 fold (P < 0.05) in exponentiallygrowing cells (turbidity at 600 nm of 1) upon 2 mmol l-1 H2O2 for 10 min in BW25113 vs. BW25113 ygiW and BW25113 vs. BW25113 ychH in LB medium at 37°C. Some genes with less significant fold changes are shown for completeness. +H2O2 represents treatment with H2O2. Raw data for the six DNA microarrays are available using GEO series accession number GSE 13698. Deltas ( ) indicate the selection of possible stress related genes for further phenotypic study. Fold changes Gene b# WT WT+H2O2 vs. vs. ygiW+H2O2 ychH+H2O2 metabolism and others sotB b1528 -12.1 -2.8 flxA b1566 -1.7 -52.0 aer b3072 -1.1 -18.4 glpD b3426 -10.6 -6.5 b3868 -5.7 2.6 glnG tsr b4355 -2.5 -32.0 Flagella and chemotaxis flgB b1073 -3.7 -104.0 flgC b1074 -3.5 -68.6 flgD b1075 -4.6 -111.4 flgE b1076 -3.5 -42.2 flgF b1077 -3.5 -84.4 flgG b1078 -3.5 -59.7 flgK b1082 -3.0 -111.4 b1885 -3.5 -222.9 tap tar b1886 -3.2 -128.0 cheW b1887 -3.2 -78.8 cheA b1888 -3.2 -68.6 motB b1889 -2.1 -90.5 motA b1890 -3.0 -181.0 fliZ b1921 -2.8 -84.4 fliA b1922 -4.6 -128.0 fliC b1923 -3.0 -73.5 b1924 -3.0 -168.9 fliD b1925 -3.0 -137.2 fliS fliT b1926 -3.2 -104.0 fliE b1937 -2.8 -119.4 Unknown function ymdA b1044 -1.4 -34.3 ycgR b1194 -1.9 -111.4 ydjR b1742 -1.1 -32.0 ynjH b1760 -1.1 -26.0 ypdD b2383 -2.1 -11.3 yhjH b3525 -2.3 -119.4 b4060 -84.4 -9.2 yjcB yjcZ b4110 -3.5 -64.0 +H2O2 Lee et al., Texas A & M Description Sugar efflux transporter Qin prophage Aerotaxis receptor sn-Glycerol-3-phosphate dehydrogenase (aerobic) Response regulator for glutamine Methyl-accepting chemotaxis protein I Flagellar basal-body rod protein FlgB Flagellar basal-body rod protein FlgC Basal-body rod modification protein FlgD Flagellar biosynthesis, hook protein Flagellar biosynthesis, cell-proximal portion of basal-body rod Flagellar basal-body rod protein FlgG Flagellar hook-associated protein 1 Methyl-accepting chemotaxis protein IV Methyl-accepting chemotaxis protein II Chemotaxis protein CheW Chemotaxis protein CheA Chemotaxis MotB protein Chemotaxis MotA protein FliZ protein RNA polymerase sigma factor for flagellar operon Flagellar biosynthesis; flagellin, filament structural protein Flagellar hook-associated protein 2 Flagellar protein FliS Flagellar protein Flit Flagellar hook-basal body complex protein FliE Hypothetical protein YmdA precursor Hypothetical protein YcgR Hypothetical protein YdjR Hypothetical protein YnjH precursor Putative PTS family Hpr component (N-terminal) Hypothetical protein YhjH Hypothetical protein YjcB Hypothetical protein YjcZ 11