Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DEPARTMENT for ENVIRONMENT, FOOD and RURAL AFFAIRS Research and Development CSG 15 Final Project Report (Not to be used for LINK projects) Two hard copies of this form should be returned to: Research Policy and International Division, Final Reports Unit DEFRA, Area 301 Cromwell House, Dean Stanley Street, London, SW1P 3JH. An electronic version should be e-mailed to [email protected] Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Contractor organisation and location Veterinary Laboratories Agency, New Haw, Addlestone, Surrey, KT15 3NB Total DEFRA project costs Project start date £ £384,341 01/07/00 Project end date 30/06/03 Executive summary (maximum 2 sides A4) Sheep scab is a highly contagious parasitic disease of sheep caused by the mite Psoroptes ovis. Infection causes intense itching and wool loss with high morbidity and occasional mortality in severely affected animals. The disease has considerable welfare implications. Control has traditionally involved the application of chemical pesticides by plunge dipping, although injectable endectocides are now in widespread use. There exists considerable public concern over the toxicity and safety of sheep dips and chemical control methods generally. There is therefore an urgent need to investigate alternative methods of sheep scab control. Whilst the pathophysiology of the sheep scab mite and methods of chemotherapy have been well researched, there is little information on the basic physiology and biochemistry of P. ovis. The size of the mite has usually precluded physiological studies on mite organ systems, as conducted on insects. However, digestive enzymes from P. ovis have been described at the biochemical and gene levels, and assays established for routine detection of activities. Furthermore, until recently, there was a similar paucity of information on mite feeding habits. Lack of such fundamental data has prohibited the development of specific targeting drugs, research into vaccine-based control, and biological alternatives to chemicals. An important handicap to the generation and application of basic physiological data on P. ovis is the inability to grow the organism in vitro. Thus, studies so far, have had to use mites grown in vivo on infected sheep or closelyrelated species, such as P. cuniculi from rabbits. This project was designed to investigate the digestive physiology and nutritional biology of the mite with the aim of targeting inhibitors of mite digestion. The project also set out to investigate the role of digestive enzymes in modifying the mite’s immediate environment and thereby causing pathology (n common with medically important mites such as house dust mite, scabies mites), and the role of bacteria, already identified as part of the gut microflora of the mite, to ascertain their role in nutrition and digestion. It was obvious that such studies would require, to some extent, the development of an in vitro culture system for P. ovis. The obligatory parasitic existence of the mite made this a key and challenging objective. CSG 15 (Rev. 6/02) 1 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 One of the major outputs of the project was a review article on the digestive physiology of the sheep scab mite, Psoroptes ovis, and other, related astigmatic mites entitled ‘A physiological and Biochemical Model for Digestion in the Ectoparasitic Mite, Psoroptes ovis (Acari: Psoroptidae) published in the International Journal for Parasitology. The review covered the structure of mite digestion systems and the various digestive enzyme types characterised from mite extracts. It also attempts to relate these enzymes to diet utilisation, allergenicity of mites, and the relationship between symbiotic micro-organisms, pathogenic bacteria and digestion in arthropods and relevance to mite digestive physiology. The digestive processes in Psoroptes spp are believed to involve intracellular digestion by lysosomal endopeptidases (cathepsin-like aspartic and cysteine proteinases) followed by further processing by intra and/or extracellular exopeptidases including aminopeptidases. Soluble and membrane-bound aminopeptidase activities have been demonstrated in extracts of P. cuniculi and P.ovis. A 329bp fragment of DNA, amplified from P. cuniculi genomic DNA, was shown to have a high homology with human cytosol aminopeptidase. The activity and gene was characterised, and shown to be a typical cytosolic leucine aminopeptidase in the M17 group of metalloproteinases. It was not possible to produce sufficient recombinant protein in bacterial expression systems, but it may be possible to express the sequences in different eukaryotic and prokaryotic systems. A γ-Glutamyl transpeptidase in P. ovis was also identified, but attempts to clone the gene and obtain usable sequence data were not convincing. Previous work has identified lipase-producing, or lipophilic bacteria, in the gut microflora of the sheep scab mite but it was unclear what role they played in mite nutrition and digestion. Lipase activity was detected in the soluble fraction of P. ovis, but despite screening the cDNA library using nested PCR, no lipase gene could be detected in this material. It remains unclear whether the lipase enzymes present are specifically of mite origin, part of the pathology response, or produced by bacteria associated with the lesion. The bacteria flora present on the skin of uninfested sheep includes Shphingomonas mali, Afipia genosp., and Alpha proteobacterium. Examination of lesion material and mites revealed nine different bacterial species identified as being associated with the P. ovis mite and the corresponding skin area. These are Acinetobacter spp., Burkholderia spp. Beta Proteobacterium, Bradyrhizobium spp., Escherichia coli, Corynebacterium confusum, Psychrobacter sp., Pseudomonas sp., Nesterenkonia sp, Shigella flexnari, Jeotgalibacillus halotolerans, and Staphylococcus aureus. In all cases, one pathogenic bacterium species appears always to be associated with the mite and the corresponding scab material. Burkholderia sp. and Corynebacterium confusum are both pathogenic to humans. Whether the mites are releasing these bacteria onto the surface of the skin and initiating an immune response is still unclear. It is however apparent that the mites are not utilising the bacteria as a food source. It is thought therefore, that gram-negative lipase producing bacteria do not appear to be associated with the mites. Data from this project have been used to characterise the optimal nutrient requirements for P. ovis. The model described in the review article strongly suggests that the optimal nutritional state is achieved by the mite causing massive modification of the skin environment, such knowledge is important in enhancing the potential for in vitro mite culture. In vitro culture studies were conducted in mite feeders that kept the mites in contact with the test substrate whilst allowing ventilation and observation. The temperature was maintained at 33C, equivalent to the fleece and skin surface temperature. A variety of media were tested, mainly bacterial, in order to establish whether the mites were grazing on skin-surface dwelling bacteria. Results indicated that the mites do not use bacteria as a food source. There was a significant decline in the survival rates of the mites when the nutritional supplement was Burkholderia sp. However there was a significant rise in survival with nutritional supplementation with artificial blood meal that was 20% protein based. Assays for enrichment of enzyme activities within protective mite sub-cellular fractions from the sheep immunology project, OD0537, were conducted. Whilst aminopeptidase and aspartic peptidase activities were present in mite fractions and enriched in some, these could not be correlated with a protective effect in sheep. CSG 15 (Rev. 6/02) 2 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 A role for bacteria in the scab lesion pathology has been previously advocated, and as such, a trial testing antibacterial compounds for their role in lesion development was completed. The trial was conducted to determine if disinfectants could reduce bacterial numbers on the skin of live sheep and assess the duration of any bactericidal activity. It was shown that the bacterial flora of ovine sheep skin comprised of a number of species with the diversity of species and numbers of bacteria varying between individual sheep and sampling sites. Some sheep presented relatively low bacterial numbers of poor species diversity. Under the conditions of this study the disinfectants assessed failed to render sheep skin totally sterile. For ethical reasons, further research involving use of disinfectants on mite-infested sheep was not pursued. An understanding of the physiology of mite digestion is an essential component of the research into potential and alternative methods of control. The results of this project provide a model for the digestion in P. ovis and the potential for targeted therapies. The mite digestion model can be summarised as follows. The mite when first established on the host probably feeds on the loose stratum corneum and on lipid secretions present. As the mites wander across the surface of the skin, allergenic and enzymatically active material is deposited on the skin causing an inflammatory response. Damage to the skin results in release of serum exudates and bacterial infection and the mites feed on the ensuing nutrient “soup” present. The food is ingested and digested in the midgut by a process of pinocytosis into type II digestive cells where proteolysis is initiated by lysosomally derived endopeptidases (aspartyl and cysteine proteinases, possibly metalloproteinases) and is followed by lysosomal and and cytosolic exopeptidases (cysteine proteinases and aminopeptidases). Proteolysis may also involve luminal enzymes derived from secretory Type I cells and membrane bound enzymes. Within the entire digestive system of the mite are large populations of luminal bacteria, which may play a dietary role yet to be determined. CSG 15 (Rev. 6/02) 3 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Scientific report (maximum 20 sides A4) Objective 1: Review existing knowledge on mite digestive physiology A thorough review of the literature concerning the digestive physiology of the sheep scab mite, Psoroptes ovis, and other, related astigmatic mites was conducted leading to the publication of a review article entitled ‘A physiological and Biochemical Model for Digestion in the Ectoparasitic Mite, Psoroptes ovis (Acari: Psoroptidae) by Hamilton, K. A., Nisbet, A. J., Lehane, M. J., Taylor, M.A., Billingsley, P. F. in the International Journal for Parasitology (see reference list below). In the review, the structure of mite digestion systems is reviewed, with cross-references to tick physiology for comparison, with the aim of identifying specific cell types within the gut wall of the mite. Various digestive enzyme types characterised from mite extracts (and where relevant, insects) e.g. Der p 1 (a cysteine proteinase), and substrates, digestive inhibitors, sub-cellular sites, physiological roles have all been reviewed. Where possible, these enzymes have been related to diet utilisation and allergenicity of mites. The role of peptidase activities in modulating their allergenicity was of particular relevance to the research work conducted. The relationship between symbiotic micro-organisms, pathogenic bacteria and digestion in arthropods was also reviewed and its relevance to mite digestive physiology examined. (114 references cited). Objective 2: Characterisation of the biochemical and enzymatic activity of mite digestion. The digestive processes in Psoroptes spp are believed to involve intracellular digestion by lysosomal endopeptidases (cathepsin-like aspartic and cysteine proteinases) followed by further processing by intra and/or extracellular exopeptidases including aminopeptidases. Soluble and membrane-bound aminopeptidase activities have been demonstrated in extracts of P. cuniculi and P.ovis. Aminopeptidase activity was eluted as a single peak (85-116kDa) from soluble extracts of P. cuniculi by gel filtration FPLC. Native electrophoresis of the concentrated eluates from FPLC demonstrated a single band of aminopeptidase activity. Degenerate, oligonucleotide primers were designed using conserved areas of amino acid sequence and a 329bp fragment of DNA was amplified from P. cuniculi genomic DNA. Analysis of this fragment revealed a nucleotide sequence coding for a protein sequence with high homology (63% amino acid identity) with human cytosol aminopeptidase. The activity and gene has now been characterised, and is a typical cytosolic leucine aminopeptidase in the M17 group of metalloproteinases. It has a preference for leucine and methionine substrates, is inhibited by leucinethiol, bestatin, Arphamenine A and 1,10-phenanthroline, Zn2+, Cu2+ Ni2+, Co2+ and activated by Mn2+ and Mg2+. Activity was detected as a single major band on native gels; and as a single peak in size exclusion chromatography of 85-116kDa. Using primers to conserved regions around the active and zinc-binding sites, the molecular sequence of the same gene (Fig. 1) has been characterised, and in preparation for possible vaccination trials, the mite LAP sequence in E. coli has been expressed (Figure 2). Producing sufficient recombinant protein in the absence of bacterial protein background has so far proven impossible, but attempts will be made to express the sequences in different eukaryotic and prokaryotic systems. Both soluble and membrane-bound aminopeptidase activities were present in P. cuniculi and part of this activity was attributable to a M1 leucine aminopeptidase. For this enzyme, clones were available containing full length P. ovis M1 LAP amplified from the P. ovis cDNA library, but the 3' end contained an inverted poly-T sequence. This was thought to be a result of codon bias in the library, causing differential amplification during the PCR steps of the library construction. Degenerate primers to conserved motifs of rat, Drosophila, C. elegans, and Aedes amino acid sequences were used to amplify a P. ovis M1 LAP fragment, but attempts to gain full-length sequence from the P. ovis cDNA library have proven unsuccessful. A γ-Glutamyl transpeptidase in P. ovis has also been identified, but attempts to clone the gene and obtain usable sequence data were not convincing. -Glutamyl transpeptidase is involved in the degradation of glutathione, and that an important role in cysteine metabolism. CSG 15 (Rev. 6/02) 4 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Objective 3: Role of mite enzymes and bacteria in extra-oral digestion and pathology defined. Lipase activity was detected in the soluble fraction of P. ovis; but whether this activity was of bacterial or mite originis unclear. The cDNA library was screened using nested PCR for a lipase gene, using primers designed from Drosophila melanogaster, but no lipase gene could be detected in this material. The cDNA libraries were screened for the lysozyme gene, using degenerate primers designed from the silkworm Bombyx mori and the tick lysozyme sequence. Lysozyme is important in antibacterial activity and is a typical enzyme from insect salivary glands. On the skin surface, four different areas were removed from five P. ovis infected sheep. These four areas were the initial site of infection, a mid-lesion sample, a sample from the leading edge of the lesion, and an area of skin unaffected by mites. The samples were assayed for changes in lipase, lysosome (Figure 3), aminopeptidase (Figure 4), aspartic peptidase (Figure 5) and esterase, and the amount of protein was determined. Each piece of skin was measured, weighed and the different physical characteristics recorded. A general observation was that total enzyme activity was lower in the areas of skin that had not been infected with mites. The analysis of these data sets is being completed as part of a PhD thesis. The relative activities across each lesion will be further assessed, and a profile of the enzyme ‘ecology’ across a P. ovis infected lesion established. Further work is required to determine if the enzymes present are specifically of mite origin rather than part of the pathology response or produced by bacteria associated with the lesion. Many enzymes of possible gut origin are also allergens (see review article), and one major allergen from Dermatophagoides pteronyssinus (Der P 1), is a cysteine proteinase common to other mite species (Dermatophagoides farinae, Lepidoglyphus destructor, Dermatophagoides microceras, and Euroglyphus maynei). Objective 4: Investigate the role played by lipase producing bacteria in the mite midgut on the digestive physiology of the parasite. A part of this objective was to characterise bacterial populations from mites in field outbreaks of disease, but due to logistical problems, and the intervention of FMD, this prove difficult. Efforts were therefore focused on trying to identify the role these bacteria may play in mite pathogenicity. Lesion material and associated mites were sampled and the relationship between the bacteria on the surface of the skin and the P. ovis mite investigated. Each lesion was arbitrarily cut in to 3 pieces, and each area was designated 1) initial site of infection, 2) mid-lesion and 3) leading edge. P. ovis associated bacterial and sheep skin 16s DNA was amplified by PCR using universal bacterial 16s primers. The PCR products were cloned into a TOPO TA vector and screened by PCR amplification using M13 primers. Novel sequences were detected by RFLP using HAE III and MSP I restriction enzymes (Figure 6) and the corresponding plasmids were sequenced. 16s sequences were matched to their closest neighbours in existing databases using BLAST and RDP software. The most closely related species to the ones identified are listed in Table 1. From this work, a novel RFLP profiling by identifying differences of one or more bands after digestion with both restriction enzymes has been developed. The bacteria flora present on the skin of uninfested sheep includes Shphingomonas mali, Afipia genosp. and Alpha proteobacterium. To date, nine different species of bacteria have been identified as being associated with the P. ovis mite and the corresponding skin scrape. These are Acinetobacter spp., Burkholderia spp. Beta Proteobacterium, Bradyrhizobium spp., Escherichia coli, Corynebacterium confusum, Psychrobacter sp., Pseudomonas sp., Nesterenkonia sp, Shigella flexnari, Jeotgalibacillus halotolerans, and Staphylococcus aureus. In all cases, one pathogenic bacterium species appears always to be associated with the mite and the corresponding scab material. Burkholderia sp. and Corynebacterium confusum are both pathogenic to humans. Whether the mites are releasing these bacteria onto the surface of the skin and initiating an immune response is still unclear. It is however apparent that the mites are not utilising the bacteria as a food source (see below). As far as can be ascertained, gramnegative lipase producing bacteria do not appear to be associated with the mites. CSG 15 (1/00) 5 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Burkholderia (previously known as Pseudomonas) cepacia is a gram-negative bacteria that is resistant to many antibiotics, and is able to metabolise many substrates. It is generall y found in soil and other moist environments. It has emerged as an important opportunistic pathogen to humans affected by cystic fibrosis and immunocomprimised patients and interestingly causes ovine mastitis. B. cepacia has an unusual metabolism and is able to degrade chlorinated aromatic substances for use as a carbon source. B. cepacia is able to prevent leaf and stem blight caused by the fungus Alternaria, by inhibiting spore germination. A few Corynebacterium species are part of the natural flora of humans, but they are occasionally isolated as opportunistic pathogens in patients who are immunocomprimised. Corynebacterium confusum has been isolated from two patients with foot infections and from a blood culture of a third patient. Corynebacterium capitovis sp. is a gram-positive bacterium and was isolated from skin scrapings from an infected head of a sheep. Whether any of these bacteria species is able to cause the pathology associated with sheep scab is still to be ascertained. Objective 5: Establishment of optimal nutritional requirement of the sheep scab mite The data from this project have been used to characterise the optimal nutrient requirements for P. ovis. The enzyme complement described will enable modelling of its potential effect on both the sheep-derived molecules and bacteria associated with the lesion. The model described in the review article strongly suggests that the optimal nutritional state is achieved by the mite causing massive modification of the skin environment, and these data will be used to enhance the potential for in vitro mite culture. Objective 6: Identification and development of techniques for improving the in vitro culture of the sheep scab mite. Mite feeders were designed based upon previous preliminary studies (Figure 7). The feeder keeps the mites in contact with the test substrate whilst allowing ventilation and observation. The temperature was maintained at 33C, equivalent to the fleece and skin surface temperature. A variety of media were tested, mainly bacterial, in order to establish whether the mites were grazing on the skin surface dwelling bacteria. Mites for the trials were washed prior to being placed in the chamber. Each chamber contained 20 mites of mixed sex and age and each trial was repeated 5 times. Analysis of the results was performed using Kaplan-Meier survival analysis to test the probability of a mite surviving for a given time after the start of the experiment. The following nutritional supplements were tested. Live and dead E. coli and M. luteus, Serratia marcessens, Burkholderia sp. mixed with and without lipase, Foetal calf serum, Blood mixed with live bacteria and lipase, Yeast An artificial blood meal containing 20% protein. The results indicated that the mites do not use bacteria as a food source. There was a significant decline in the survival rates of the mites when the nutritional supplement was Burkholderia sp. However there was a significant rise in survival with the nutritional supplement of the artificial blood meal that was 20% protein based (Figures 8 and 9). Objective 7: Evaluation of selected potential targets for immune, chemical and biological control strategies. The central approach from the parallel project (OD0537) has been the gradual refinement of mite sub-cellular fractions as immunogens. Assays for enrichment of enzyme activities in the protective fractions have been conducted. Aminopeptidase and aspartic peptidase activities were present in mite fractions (Figure 9), and enriched in some but could not be correlated with a protective effect in sheep. CSG 15 (1/00) 6 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 A role for bacteria in the scab lesion pathology has been previously advocated, and as such, a trial testing antibacterial compounds for their role in lesion development was completed. Four veterinary/medical disinfectants (Virkon S, Hibiscrub, Dettol and Fresh-shield) were assessed regarding their efficacy to reduce bacterial numbers on the skin of live sheep and assess the duration of any bactericidal activity. This study was carried out prior to future studies involving mite challenge assessing the relationship between sheep skin bacteria and the pathogenesis of Psoroptes ovis. Each disinfectant was diluted according to the manufacturers instructions and massaged into the withers of two sheep (where the fleece had been clipped to 2.0 cm), ensuring that disinfection occurred at least 5.0cm into the unclipped fleece at the periphery of the area. Two sheep remained as untreated controls. Skin washings (2.0ml sterile phosphate buffered saline) were collected from two sites within the disinfected area from all sheep on Days 0, +1,+2, +3 and +4 post disinfection, diluted 1/10 and 1/100 in sterile PBS and immediately cultured (including the undiluted washing) onto 10% SBA and incubated aerobically at 37C for 24hrs. After this time the total number of colonies was counted for each dilution together with differential counts for all colony types present. Representatives of each colony were also gram stained and deep frozen in NA for future identification. The numbers of colony forming units (CFUs), assumed to be the result of a single bacterial cell were counted for each dilution of skin washing. Numbers of CFUs were multiplied by the dilution factor and the mean of the numbers of CFUs for three dilutions calculated. In order to compare the results between disinfectants, individual sheep and skin washing sites numbers of CFUs were scored (Table 2). Results are shown in Table 3. The bacterial flora of sheepskin comprised a number of species with the diversity of species and numbers of bacteria varying between individual sheep and sampling sites. Some sheep presented relatively low bacterial numbers of poor species diversity. Yet others presented relatively high populations with a relatively greater number of species. If the skin bacterial flora is essential for the pathogenesis of scab such variation in bacterial numbers may reflect an individual‘s susceptibility to scab. Under the conditions of this study the disinfectants assessed failed to render sheep skin totally sterile. The above preliminary study was undertaken at the request of an Ethics committee and in accordance with Home Office regulations as a prelude to any scab mite infection studies. Due to the outcome of the preliminary results from this trial and possible animal welfare implications from proposed mite-disinfectant studies, a further possilbe follow up study was not allowed to proceed for welfare reasons. Publications/Presentations arising from project Billingsley, P. F. Digestion in the sheep scab mite, Psoroptes ovis and targets for immune control. Invited seminar to the Medical and Veterinary Special Interest Group of the Royal Entomological Society. 2001. Hamilton, K. A., Nisbet, A. J., Lehane, M. J., Taylor, M.A., Billingsley, P. F. A physiological and biochemical model for digestion in the ectoparasitic mite, Psoroptes ovis (Acari, Psoroptidae). International Journal for Parasitology 33:773-785. Hamilton, K.A., A.J. Nisbet, M.J.Lehane, M.A.Taylor, P.F. Billingsley. A model for digestion in the sheep scab mite P. ovis. Royal Entomological Society University of Aberdeen September 9th – 12th 2001. Hamilton, K.A., A.J. Nisbet, M.J. Lehane, M.A. Taylor, P.F. Billingsley. A model for digestion in the sheep scab mite P. ovis. Scottish Universities Molecular Parasitology meeting, Kindrogan15-17th May 2001. Hamilton, K.A., A.J. Nisbet, M.J. Lehane, M.A. Taylor, P.F. Billingsley. A model for digestion in the sheep scab mite P. ovis. British Society for Parasitology meeting Manchester UMIST 7-9th April 2003. Nisbet, A. J., Billingsley P. F. 2002. Characterisation of aminopeptidase activity in scab mites, Psoroptes spp. Insect Biochemistry and Molecular Biology 32:1123-1131 CSG 15 (1/00) 7 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis Figure 1. Sequence of the mite M17 aminopeptidase gene and inferred protein. Primer sequences are highlighted in yellow, zinc-binding and active sites in purple. GGGAAGCAGTGGTATCAACGCAGTGTGGCCATTATGGCCGGGGAAATTTAATTCATTTATTAGTCAAAATT CATTTGAATATAACCAACACACATTGACATTTTTTACCAATAATCGTCAATTAAATACATCATCAATTATA 1 ATG AAT AAA AAT AAA GCC ACA CTT ATC GGT GTA TTT GAG AAT AGT ACG AAT 1 M N K N K A T L I G V F E N S T N 61 TTC ATC TTT ACA CCG ACT GGT GAG AAA ATC AAT TCT TCA ATC GGT GGT GTC 21 F I F T P T G E K I N S S I G G V 121 CAA TTA AAT ATC GTT GGT CCA GTG AAA AAA TGT AAA GTT CGA ATA TTA TAT 41 Q L N I V G P V K K C K V R I L Y 181 CCA GAA TAT CCA ATT GTA GGT GTT GTT GGT CTT GGT CCT GAT AAT GCA ACA 61 P E Y P I V G V V G L G P D N A T 241 CTG GAA GAA TTG GAT GAA AAA TCG GAA AAT ATT CGT TCA GCC GTT GCT ACC 81 L E E L D E K S E N I R S A V A T 301 GCA TTA CGT GAT CTT GGA TCA ATT GAA GAA ATC AAT GTT GAT GGA TGC TTG 101 A L R D L G S I E E I N V D G C L 361 GCA GCA TCT GAA GGT GCT AAT CTT GGT TTA TAT TAT TTT GAT GAA TTG AAA 121 A A S E G A N L G L Y Y F D E L K 421 CTC AAA AAG AAT TTG GTT AAA GTT AAT TTG TTA TCA AAC GAA GAA TCA GAT 141 L K K N L V K V N L L S N E E S D 481 TGG AAT GCC GGC GTT GTA TTG TCA AAT GGA CAA AAT TTT TGC CGT ACA CTG 161 W N A G V V L S N G Q N F C R T L 541 CCG GCT AAT TTA ATG ACT CCA ACT AAA TTT GCT GAA ATC GCC AGT GCC ACT 181 P A N L M T P T K F A E I A S A T 601 TTG GAT GTC ACG GTA AAT GTT CGT GAT AAA GCA TGG GCT GAA TCA ATG AAA 201 L D V T V N V R D K A W A E S M K 661 TTT TTG AGT GTT GCT AAA GGT TCA GAT GAA CCA CCA GTT TTT CTC GAA ATT 221 F L S V A K G S D E P P V F L E I 721 AAT GCA CCT GAC ACA AAA CCA TTG GTG TTT GTT GGC AAA GGA ATA ACA TTT 241 N A P D T K P L V F V G K G I T F 781 GGA ATT TCA TTG AAA CCA TCA TCC AAT ATG GAT AAA ATG CGT GCC GAT ATG 261 G I S L K P S S N M D K M R A D M 841 GCT AAT GTT GTC AGT ACA ATT TAT ACG TTG GCC ACA AAA AAA TCT CCA GTC 281 A N V V S T I Y T L A T K K S P V 901 GGA TTG ATA CCG TTG TGT GAA AAT TTG CCA AGC GGA AAA GCC AAT AAA CCT 301 G L I P L C E N L P S G K A N K P 961 GTC ACT GCA ATG AAT GGA AAA ACT ATT CAA GTT GAT AAC ACT GAT GCT GAA 321 V T A M N G K T I Q V D N T D A E 1021 ATT TTG GCC GAT GCT CTC TGT TAC GCA CAT CAA TTT AAC CCA TTT TTA ATT 341 I L A D A L C Y A H Q F N P F L I 1081 GCC ACA TTG ACA GGT GCT ATT AAT GTT GCG CTA GGC TCA GCC GCT ACC GGT 361 A T L T G A I N V A L G S A A T G 1141 ACT ACG AGC AAA TAT TGG ACT ATG TTG CAA AAA TGT GGT GTA GAA ACT GGT 381 T T S K Y W T M L Q K C G V E T G 1201 TGG CGT ATG CCT TTG TTT AAT CAT TAC ACT AAA CAG ACC ACT GAT AGC CAA 401 W R M P L F N H Y T K Q T T D S Q 1261 CTC TGT AAT ATT GGT AAA TAT GCA GGG CAA GGT GGA AGC TGC ATA GCA GCC 421 L C N I G K Y A G Q G G S C I A A 1321 CGC GAA TTC GTC ACC TGC AAT AAT TGG ATC CAT TTT GAT ATT GCT GGT GTG 441 R E F V T C N N W I H F D I A G V 1381 AAA ACT GAA ATA GTT TAT CTC TCC AAA GGA ATG GCT GGC CGA CCA TTA CGC 461 K T E I V Y L S K G M A G R P L R 1441 AAA TTC GTT GAA GAG ATT TTC GAA AAC AAA GCC TTC TAA GCA ATA AAT TTA 481 K F V E E I F E N K A F * 1501 CAT TAT CAA ACG ATA ATT TTA GAG AAG ATG AAT TGA AAT AAA AAA TTT TAT 1561 AAA AAA AAA AAA AA CSG 15 (1/00) DEFRA project code 8 AAA K ATT I GAT D TAT Y GGT G GAC D GCG A GAA E ATG M TTG L ATG M CAT H GAT D GGT G AAT N GGT G GGG G ATG M GTA V GAT D TTG L GCT A ATG M ACA T TTT GAT D GAA E GTA V AAT N GTA V CCT P CCA P AGC S GAA E TCC S GGT G TAT Y AGC S GGT G ATC I GAT D CGT R GAC D TTT F CGC R GCT A TTC F GAA E TTG L ATT TCT S AAA K AGT S GAA E CGA R AAA K GCA A CTT L AAT N AAG K TCA S AAT N GGT G GCT A ATA I GTT V CTA L ATC I TGC C ATG M GAT D CTC L AAC N GTG V TCA TGA CTT AAA OD0536 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Figure 2. Expression of mite M17 aminopeptidase in E. coli. Top – coomassie-stained SDS-PAGE gel showing induced protein expression with a band at the expected position (~55-60 kDa; red arrows). Bottom – Western blot showing the 55-60 kDa band (red arrow) detected using an anti-His antibody. Induced Uninduced MW (kDa) 75 50 30 15 Induce d Uninduced MW (kDa) 50 30 15 CSG 15 (1/00) 9 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis Figure 3: DEFRA project code OD0536 Lysozyme activity in skin and lesion samples from three sheep (a-c). Samples 1-5 are described above. Lysozyme activity in skin of sheep not infected with mites was below the level of the detection. 1 Enzyme Unit is defined as the activity that will produce at A450nm of 0.001 per min at pH 6.24 @25C using Mirococcus luteus as a substrate. EU of lysozyme per mg of protein 400 350 300 250 A B 200 C 1 50 1 00 50 0 1 2 3 4 5 Sam ple num ber Figure 4: Aminopeptidase activity in skin and lesion samples from three sheep (a-c). Samples 1-5 are described above. Activity is plotted as a percentage of sample 1 (uninfected area). 2.5mM LpNA was used as substrate. Sheep 1 had no piece of skin that acted as a control. % of control skin activity 2500 2000 1500 A B 1000 C 500 0 site1 1 site2 site1 2 site2 site1 3 site2 Sam ple num ber CSG 15 (1/00) 10 site1 4 site2 site1 5 site2 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis Figure 5: DEFRA project code Aspartic peptidase activity in skin and lesion samples from three sheep (a-c). Samples 1-5 are described above. H-Pro-Thr-Glu-Phe-Phe(NO2)-Arg-Leu-OH was used as substrate. 0.08 0.07 0.06 Change in OD 0.05 0.04 A B 0.03 C D 0.02 0.01 0 -0.01 1 2 3 -0.02 Sheep number and site CSG 15 (1/00) OD0536 11 4 Project title Figure 6. Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code OD0536 Genotyping and species identification of bacteria associated with the lesion and with Psoroptes ovis using the restriction enzymes HAE III and MSP I. Gel 1 displays 4 novel sequences. Samples C and D display identical banding patterns. However A, B and C show different banding patterns. Gel 2 indicates only 2 novel sequences, F-H present identical banding patterns compared to I. MW (bp) CSG 15 (1/00) A B C GEL 1 D E MW MW 12 F G GEL 2 H I MW (bp) Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code Table 1. Bacterial flora present on the skin and lesion surfaces of two sheep infected with Psoroptes ovis*. Site 1 Common to skin & mite Burkholderia sp. Mite Staphylococcus aureus uncultured rape rhizosphere Skin Acinetobacter Site 2 Burkholderia sp Bradyrhizobium sp Sphingomonas sp. Site 3 Burkholderia sp. Beta proteobacterium Site 4 Site 5 Not applicable Not applicable Nesterenkonia sp Escherichia coli Shigella flexnari Not applicable Not applicable Nesterenkonia sp Acinetobacter sp. Jeotgalibacillushalotolerans Staphylococcus aureus sp. Paracoccus sp. Staphylococcus aureus Site 1 Common to skin & mite None Site 2 Staphylococcus sp Site 3 Nesterenkonia sp Psychrobacter sp. Site 4 Not applicable Mite Escherichia coli Pseudomonas syringae Escherichia coli Burkholderia sp. Shigella sp. Staphylococcus aureus Psychrobacter sp. Staphylococcus sp. Corynebacterium confusum Not applicable Site 5 Not applicable Not applicable * Pseudomonas sp. Pseudomonas sp. Skin Corynebacterium confusum Psychrobacter glacincola Acinetobacter Staphyloccous vitulus Nesterenkonia sp Pesudomonas sp. Psychrobacter sp. Staphylococcus aureus Pesudomonas sp. Psychrobacter sp. Acinetobacter sp. The bacterial flora was also examined from the skin of a sheep not infected with P. ovis. The species identified in this control included Shphingomonas mali, Afipia genosp and Alpha proteobacterium. CSG 15 (1/00) 13 OD0536 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis Figure 7. Plexi-Glass Feeding Device for in vitro culture of mites CSG 15 (1/00) 14 DEFRA project code OD0536 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code Figure 8. Survival curves of Psoroptes ovis fed on an artificial blood meal (blue) and supplied with no nutritional supplement (orange). Results show a significant prolongation of survival when mites are provided with the artificial blood meal (Chi sq= 12.5, df =1, p= 0.000396). 1.0 0.8 entage alive 0.6 0.4 0.2 0.0 0 2 4 6 8 Time (days) CSG 15 (1/00) 15 OD0536 Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis Figure 9. Survival curves of Psoroptes ovis fed on a diet containing Burkholderia spp. bacteria (orange) supplied with no nutritional supplement (blue). Results show a significant decline in survival when mites are provided with Burkholderia spp. bacteria (Chi sq= 11.2, df =1, p= p=0.00083). 0.6 0.8 1.0 Project title 0.0 0.2 0.4 Percentage alive 0 CSG 15 (1/00) 2 4 Time (days) 16 6 8 DEFRA project code OD0536 Project title Biochemical and physiological studies to identify potential targets for the control of Psoroptes ovis DEFRA project code Table 2: Colony Forming Units (CFU) Scoring System Score 0 + ++ +++ ++++ +++++ CFU Range 0 1-10 11-100 101-1000 1001-10,000 10,001-100,000 Table 3 : Colony Forming Units CFU Scores for Four Disinfectants with Time. Disinfectant Sample Days after Treatment 0 1 2 3 4 Control 5321 /A 5321/B 5449/A 5449/B ++ ++ ++++ ++++ ++++ + +++++ +++++ + ++ ++++ +++++ +++++ ++ ++++ +++ +++ + +++++ +++++ Virkon 5368/A 5368/B 5373/A 5373/B +++ ++++ +++ +++ + 0 ++ ++ + + ++++ +++ +++ ++ +++ + + ++ ++++ ++++ Hibiscrub 5571 /A 5571/B 5360/A 5360/B + ++++ ++ ++ ++++ ++ 0 ++++ ++ +++ 0 0 +++ ++ ++ 0 ++ +++ 0 0 Dettol 5313/A 5313/B 5394/A 5394/B ++++ +++ + 0 +++ +++++ ++ +++ +++ +++++ +++ ++ +++++ +++++ +++ ++++ ++++ ++++ ++++ +++ FreshShield 5355/A +++++ + + + ++ 5355/B 5387/A 5387/B ++++ ++++ ++ + +++ ++ + ++++ +++ +++ ++ ++ ++ +++ +++ CSG 15 (1/00) 17 OD0536