Download Protein Synthesis Lab 37

Name:______________________________________________Date:___________Period:___
Protein Synthesis ANSWER SHEET
1. Write the sequence of bases in the complementary mRNA strand below.
________________________________________________________________________________
2. no answer required
3.
a. UUA____________________________________________________________________
b. GAG___________________________________________________________________
c. UAUCUA_______________________________________________________________
d. AAAUUUGGG___________________________________________________________
e. CCAGCUAGAGGGUGG_______________________________________________________________
________________________________________________________________________
4.
a. GGU_____________________________________________________________________
b. CGC_____________________________________________________________________
c. AUG_____________________________________________________________________
d. AAA_____________________________________________________________________
Analysis and Interpretations
1. Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:
GTATACCAGTCATTTGTCAUU
Then list in order the amino acids coded by this sequence. (use abbreviations and hyphens)
mRNA: _____________________________________________________________________________
amino acids: _____________________________________________________________________________
2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of the mRNA strand
in Question 1 began by mistake, at the second nucleotide instead of the first. The first codon would be AUA.
Write the sequence of amino acids that would be formed.
_______________________________________________________________________________
3. Keep in mind that there is only one start codon. Use your textbook to identify what it is:____________
4. Now that you’ve identified the start codon, look back at the amino acid sequence in analysis question 1. How
many amino acids would actually be present in the resulting strand?_____________
5. Suppose the bases of the DNA strand in question 1 were not transcribed correctly and the mRNA read:
CACAUGGUUAGUAAGCAGAUU
How many mistakes were made in transcription?___________
6. Write the abbreviations for the amino acids that would be formed by translation of the mRNA.
________________________________________________________________________________
7. How many amino acids would be present in the resulting strand from question 6?__________________
8. Compare and contrast the strings of amino acids in question 1 and question 3:______________________________
______________________________________________________________________________________________