Download Genomic imprinting of a placental lactogen gene in Peromyscus

Dev Genes Evol (2001) 211:523–532
DOI 10.1007/s00427-001-0188-x
O R I G I N A L A RT I C L E
Paul B. Vrana · Paul G. Matteson · Jennifer V. Schmidt
Robert S. Ingram · Andrew Joyce · Kelly L. Prince
Michael J. Dewey · Shirley M. Tilghman
Genomic imprinting of a placental lactogen gene in Peromyscus
Received: 24 April 2001 / Accepted: 4 September 2001 / Published online: 17 November 2001
© Springer-Verlag 2001
Abstract The mammalian genome contains over 30 genes
whose expression is dependent upon their parent-of-origin. Of these imprinted genes the majority are involved
in regulating the rate of fetal growth. In this report we
show that in the deer mouse Peromyscus the placental
lactogen-1-variant (pPl1-v) gene is paternally expressed
throughout fetal development, whereas the linked and
closely related pPl1 gene is expressed in a biallelic manner. Neither the more distantly related pPl2A gene, nor
the Mus Pl1 gene displays any preferential expression of
the paternal allele, suggesting that the acquisition of imprinting of pPl1-v is a relatively recent event in evolution. Although pPl1 expression is temporally mis-regulated in the dysplastic placentae of hybrids between two
Peromyscus species, its over-expression cannot account
for the aberrant phenotypes of these placentae. We argue
that the species-specific imprinting of pPl1-v, encoding
a growth factor that regulates nutrient transfer from
Edited by R. Balling
P.B. Vrana and P.G. Matteson contributed equally to this work
P.B. Vrana (✉) · P.G. Matteson · J.V. Schmidt · R.S. Ingram
A. Joyce · S.M. Tilghman
Howard Hughes Medical Institute
and Department of Molecular Biology, Princeton University,
Princeton, NJ 08544, USA
K.L. Prince · M.J. Dewey
Peromyscus Genetic Stock Center,
Department of Biological Sciences, University of South Carolina,
Columbia, SC 29208, USA
Present addresses:
P.B. Vrana, Department of Biological Chemistry,
Medical Sciences I, D233, College of Medicine,
University of California Irvine, Irvine, CA 92799–1700, USA
e-mail: [email protected]
Tel.: +1-949-8249464, Fax: +1-949-8242688
P.G. Matteson, Laboratory of Developmental Neurobiology,
Rockefeller University, New York, NY 10021, USA
J.V. Schmidt, Laboratory for Molecular Biology,
Department of Biological Sciences University of Illinois at Chicago,
Chicago, IL 60607, USA
mothers to their offspring, is consistent with the parentoffspring conflict model that has been proposed to explain the evolution of genomic imprinting.
Keywords Genomic imprinting · Placental lactogen ·
Peromyscus · Growth control · Placenta
Introduction
Genomic imprinting is the non-equivalent expression of
the parental alleles of a gene based on parent-of-origin
(Bartolomei and Tilghman 1997). By rendering all imprinted loci functionally hemizygous, the evolution of
imprinting in mammals imposes a survival cost to the
organism. For this reason there has been intense debate
about the function of imprinting (Moore and Haig 1991;
Hurst 1997). While the more than 30 imprinted genes
discovered to date have a variety of biochemical functions and many are widely expressed, mutations in the
genes disproportionately affect the rate of prenatal
growth (Tilghman 1999). The placenta, the fetal-derived
organ responsible for regulating nutrient transfer between mother and fetus, is often affected as well.
Chief among the hormones used by the placenta to
regulate nutrient transfer are the placental lactogens
(PLs). In primates these genes arose from tandem duplications of the growth hormone gene (Owerbach et al.
1980; Chen et al. 1989), while in rodents and bovids the
PLs arose from duplications of the prolactin gene (Prl)
that encodes a secreted protein involved in lactation
(Soares et al. 1991; Dietz et al. 1992). In rodents, the
PL genes have remained tightly linked to Prl and to
other prolactin-related genes (Jackson-Grusby et al.
1988; Shah et al. 1998). In rat (Rattus), there are three
PL genes, rPl1 and rPl1-v, which are closely related to
one another, and rPl2. In mouse (Mus), only mPl1 and
mPl2 have been reported to date (Goffin et al. 1996).
Given the role of these hormones in the placenta, it was
predicted by Haig (1993) that they would be ideal targets
of genomic imprinting.
524
To identify new imprinted genes, we used an allelic
differential display strategy (Hagiwara et al. 1997;
Schmidt et al. 2000) in which we compared placental
mRNAs from two closely related species of North American deer mice, Peromyscus maniculatus (BW) and P. polionotus (PO). These mice display a high degree of polymorphism (Vrana et al. 1998, 2000), making them useful
for screens that depend upon allelic differences. We report the identification of a paternally expressed gene encoding a member of the PL gene family. Additionally we
show that while the Peromyscus genome contains multiple PL genes, only one of them, pPl1-v, is imprinted.
Materials and methods
DNA and RNA analysis
The differential display screen was conducted as described in
Schmidt et al (Schmidt et al. 2000). RNA for northern analysis
was prepared by lithium chloride-urea extraction (Auffray and
Rougeon 1980). Total RNAs were separated on formaldehydeMes or MOPS agarose gels, transferred to Hybond N+ and hybridized with radiolabeled DNA probes in Express-Hyb (Clontech) or
in Church buffer (Church and Gilbert 1984). For Southern blotting
genomic DNAs were separated on TAE agarose gels and washed
in 2X SSC/0.1% SDS, followed by 2×15 min in 0.1X SSC/0.1%
SDS. Primers used for pPl1 genotyping were 5’GAAGACACWCRCCTTTTTGCCT 3′ and 5′TGCAGTCAGCACTCAGTCATG 3′. The products were digested with Cac8I, which detects a
polymorphism between the PO and BW alleles.
RT-PCR imprinting assays
In all RT-PCR assays to detect allelic expression of genes control
reactions in the absence of reverse transcriptase were performed.
Artificial mixtures of the parental RNAs were also analyzed to ensure that there was no amplification bias between the two alleles.
Primers designed to simultaneously amplify pPl1-v and pPl1I
cDNA
are
5′CTGAGRTGCCGAGAGSTC
3′
and
5′CTTATGGTTCAAGGCTC 3′. Primers used to amplify pPl1-v
cDNA selectively were 5′CTGAGRTGCCGAGAGSTC 3′ and
5′CTTATGGTTCAAGGCTC 3′. Primers for the selective amplification of pPl1 cDNA were 5′CCTCTTGGATCAAGAACTGGAG
3′ and 5′TGCAGTCAGCACTCAGTCATG 3′. Primers used for
the pPl2A imprinting assay were 5′TTCTCAGAGATGCAGCTGTCG 3′ and 5′GGCACTTCAAGACTTTGAC 3′. BsaJI and
MseI were used to detect pPl2A polymorphisms between PO and
BW alleles. Primers to amplify an 844-bp fragment of mPl1
cDNA were 5′TCACTTGGAGCCTACATTGTGGTG 3′ and 5′CATAACTGAGGAGGGGAAAGCAT 3′. The products were digested with EarI to reveal a polymorphism in the products between
C57BL/6 and Cast/Ei strains.
Histology/in situ hybridization
Placentae were fixed, paraffin embedded and in situ hybridization
was performed according to Wilkinson and Nieto (1993). A 240-bp
region from exon 5 of both pPl1 and pPl1-v and a 495-bp cDNA
fragment from exons 1–2 of the H19 gene were cloned into the
Topo TA dual promoter cloning vector (Invitrogen). Sp6- and
T7-derived RNA probes were generated from linearized plasmids
in the presence of digoxygenin to generate both sense and antisense hybridization probes.
Peromyscus cDNA library screening
A cDNA library was constructed by Stratagene from three PO and
three BW late gestation placentae in the Uni-Zap XR vector.
One million phage were screened at 50,000 plaques/plate with a
240-bp region of exon 5 of pPl1-v. Positively hybridizing clones
were plaque purified, rescued and sequenced on an ABI 310 capillary sequencer.
DNA sequence analysis
The five Peromyscus PL cDNA sequences were used in a phylogenetic analysis with other rodent PLs. Alignments were performed
with the alignment packages Clustal (as implemented in MacVector 6.5.1) and MALIGN 2.7. The latter program utilizes insertion/deletion events as phylogenetic characters, rather than just
bases which can be aligned in all sequences. Multiple parameters
were tested during alignment, as phylogenetic hypotheses utilizing
DNA sequence data have been shown to be more sensitive to
alignment variation than the methodology of tree construction
(Morrison and Ellis 1997; Phillips et al. 2000). The PAUP 3.1.1
software package was used for phylogenetic tree construction.
Several different transversion to transition weightings were employed including equal weights, transversions 2× that of transitions, and 5× that of transitions. These trees retained all the major
groupings shown in the representative tree.
Radiation hybrid mapping
For development of a Peromyscus radiation hybrid map a set of
approximately 108 whole genome radiation hybrids were produced and characterized as will be described in detail later
(Thames et al., unpublished results) using the protocol described
by Womack et al. (1997). Primary fibroblasts were harvested from
mid-gestation PO embryos and expanded in culture. The cells
were irradiated with 5000 rad and were fused with a thymidine kinase-deficient Chinese hamster cell line, A23, provided by WJ
Murphy (NCI). Cell fusion was induced by polyethylene glycol
and subsequent selection was in HAT medium. Colonies appearing
after 2 weeks were picked and subcloned in larger flasks. One aliquot of each was frozen for future expansion and another aliquot
subjected to DNA extraction for further characterization. DNA
from a small portion of the radiation hybrid panel was subjected to
a preliminary PCR characterization with five randomly cloned
Peromyscus microsatellites (PO-9, -16, -21, -25, and -35; Prince
2001) as well as primers that selectively amplify Peromyscus
pPl1, pPl1-v and pPl2. The overall retention frequency of these
seven markers in 14–24 hybrids was 44%.
Results
A PL gene is imprinted in Peromyscus
We used multiple sets of RT-PCR primers to amplify
RNAs from late gestation placentae of the two Peromyscus parental strains and reciprocal crosses (PO×BW)F1
and (BW×PO)F1 (Schmidt et al. 2000). We observed two
bands that were selectively amplified in both BW and
(PO×BW)F1 RNAs, suggesting that the primer(s) uncovered a polymorphism between the two species, and consistent with the detection of a paternally expressed RNA
(Fig. 1a). We amplified, cloned and sequenced these
bands, which revealed high sequence similarity to rodent
PL genes. Sequence comparisons with all the rodent PL
genes showed that the Peromyscus transcript most close-
525
their relative expression during placental development
by using RT-PCR primers that amplified both genes, and
exploiting a restriction fragment length polymorphism
between them. We observed that the imprinted transcript
was only detected after E12, similar to the rat rPl1-v
gene (Fig. 3). For this reason we have designated the imprinted transcript as pPl1-v. The other Peromyscus Pl1
gene was expressed during mid-gestation, but its transcript was greatly reduced by E18, and it was thereby
named pPl1. Of the three Pl2-like genes identified in the
cDNA screen, one was more highly expressed than the
others throughout placental development, and we called
this gene pPl2A (data not shown). The other two transcripts were named pPl2B and pPl2C. Northern and
RT-PCR analysis showed that both Peromyscus Pl1-like
genes and Pl2A are expressed at very low levels in the
embryo proper, but very highly in the placenta (data not
shown).
Phylogenetic analysis of Peromyscus PLs
Fig. 1a, b Imprinting of the placental lactogen-1-variant (pPl1-v)
gene in Peromyscus. a Differential display gel showing the presence of an RT-PCR product in placental RNAs from Peromyscus
maniculatus (BW) and (PO×BW)F1 offspring, but not in P. polionotus (PO) and the reciprocal cross (BW×PO)F1. b Direct sequencing of pPl1-v -specific RT-PCR products amplified from placental RNAs of the two parental strains and reciprocal F1 hybrids.
The polymorphic base is underlined
ly resembled the rodent Pl1 family of hormones (pPl1-v
in Fig. 2).
We verified that the Peromyscus transcript was imprinted by using a single strand conformation polymorphism assay that exploits the polymorphism between the
PO and BW alleles identified in the allelic display screen
(data not shown). This finding was confirmed by direct
sequencing of RT-PCR products from the reciprocal F1
hybrids, which showed that only the paternal allele of
the gene was expressed (Fig. 1b).
The sequences of five PL genes that we identified in the
cDNA screen were compared with other rodent PL
genes using a variety of parameters. Several features
stand out in all trees examined; a representative tree
with relative support for each node is shown in Fig. 2c.
First, pPl1 and pPl1-v group together very strongly. If
these genes had direct orthologs in other species, this
would not be expected; rather one of them would have
another rodent Pl1-like gene as its nearest relative. Instead, the grouping of the two Peromyscus Pl1-like
genes suggests one of two things: either there has been a
separate gene duplication in both Peromyscus and rat or
there has been concerted evolution. Given that mouse
appears to have only one Pl1-like gene, we favor the
former possibility.
All three Peromyscus Pl2-like genes also form a
strongly supported group to the exclusion of Pl2 in other
species. Given that no other rodent has been shown to
have more than one Pl2-like gene, this again suggests independent Peromyscus duplications, and raises the possibility that the entire cluster has been duplicated after
Peromyscus diverged from other rodents.
Identification of multiple PL genes in Peromyscus
To characterize the PL gene family in Peromyscus and to
determine whether other members were imprinted, we
screened a mid-to-late gestation Peromyscus placental
cDNA library. Sequencing of clones identified two
Pl1-like genes, one of which was identical to the imprinted transcript, and three Pl2-like genes (Fig. 2). In
rats, which also contain two Pl1 genes, the genes are differentially expressed (Deb et al. 1991). rPl1 is most
highly expressed in mid-gestation placentae and is repressed thereafter, while expression of rPl1-v increases
during late gestation. To find whether the Peromyscus
genes display temporal specificity as well, we examined
Imprinting status of the PL genes in Peromyscus
and mouse
We tested the imprinting status of the other highly expressed Pl genes, pPl1 and pPl2A, in Peromyscus placenta. In contrast to pPl1-v, both genes were expressed
biallelically in reciprocal crosses between PO and BW
(Fig. 4a, b). Thus the only PL gene that displays imprinting in Peromyscus is the late gestation-specific pPl1-v
gene.
The PL-encoding genes in mouse and rat are tightly
linked to one another, reflecting the relatively recent tandem duplication that generated them (Jackson-Grusby
526
Fig. 2a, b
527
Fig. 2c
Fig. 2a–c Sequence comparisons of rodent placental lactogens
(PLs). a The amino acid sequences of the two Peromyscus PL-I
proteins are compared to those of mouse (mPL-1) and rat (rPL-1
and rPL-1v). b The amino acid sequences of the three Peromyscus
PL-II proteins are compared to those of mouse (mPL-II) and rat
(rPL-II). Identical residues are highlighted in shaded boxes.
c Shortest tree found by PAUP from nucleotide alignments that
weighted all changes equally (utilizing an initial gap change
cost of 10:1). Trees were rooted between the Pl1 and Pl2 groups.
Lower case prefix before each sequence indicates species: p Peromyscus, r rat, h hamster (Mesocricetus), m mouse. Tree length is
859 steps, with a Consistency Index of 0.788, and a Retention
Index of 0.853. Branch Support values (Bremer 1994) are shown
to the left of each node. These values reflect the number of extra
steps required to break up the indicated grouping. Gaps are not included as characters in this particular tree. When they are included, the grouping of the two Peromyscus Pl1-like genes is significantly strengthened, as is the group containing the two rat Pl1-like
genes and mouse Pl1. Relatively weak branches, as indicated by
the Branch Support values and variation among trees constructed
using different parameters are: the placement of the three Peromyscus Pl2-like genes relative to one another, and the placement
of hamster Pl2 relative to the other Pl2 sequences
Fig. 3 Expression of pPl1-v
and pPl1 in the Peromyscus
placenta. Placenta RNAs prepared from embryos at the
stages indicated were amplified
by RT-PCR using primers that
amplify both pPl1 genes. The
products were digested with
AluI, which differentially cuts
the two gene products. Arrows
indicate the specific bands for
each gene. For E18 placentae
parentals and both F1 hybrids
were analyzed. Amplification
of genomic DNA (DNA) with
the same primers is shown
(BW Peromyscus maniculatus,
PO P. polionotus)
et al. 1988; Shah et al. 1998). To discover whether the
Peromyscus genes are also linked, we screened a radiation hybrid panel in which Peromyscus chromosome
fragments are distributed randomly in hamster cell lines.
Using primers that distinguish the hamster and Peromyscus Pl1 genes, we detected complete co-segregation
of pPl1,pPl1-v, and pPL2A genes (0.005> P <0.001).
Among 24 hybrids, 9 hybrids retained all three genes and
the rest retained none. In contrast, the concordance between the PL genes and five randomly chosen microsatellites ranged between 42% and 64%. We also detected
co-segregation of a proliferin-like cDNA that is part of
the family of prolactin-like genes in mice (Linzer and
Nathans 1985) in 21 of 22 cell lines tested (data not
shown). Thus we conclude that the family of prolactinrelated genes are also linked in Peromyscus.
We then asked whether mPl1 is imprinted. We used
RT-PCR to amplify mPl1 from placental RNAs of
C57BL/6 and M. castaneus (CAST/Ei) at day E12.5 and
identified a single base difference in the 3′ UTR. Using
crosses between the two strains, we demonstrated that
the mPl1 gene is not imprinted in Mouse (Fig. 4c).
The temporal mis-expression of pPl1 during late gestation
in Peromyscus hybrids
We had previously demonstrated that a majority of paternally expressed imprinted genes showed inappropriate
biallelic expression in (PO×BW)F1 hybrid fetuses, and
that the failure to silence these genes contributes to dramatic placental overgrowth and dysplasia in these hybrids (Vrana et al. 1998, 2000). The one exception was
insulin-like growth factor 2 (Igf2), which maintained its
normal imprinted expression. As shown in Fig. 1, pPl1-v
is a second example of such a gene. We were surprised,
therefore, to note using a pan-Pl1 probe on northern
blots that the levels of pPl1 in the oversized (PO×BW)F1
hybrids was greater than expected, while the undersized
(BW×PO)F1 late-stage placentae showed lower expres-
528
Fig. 4a–c Allelic expression of
pPl1, pPl2A and mPl1 genes.
a RT-PCR of pPl1 mRNA from
E12.5 placentae of PO (P. polionotus), BW (Peromyscus maniculatus) and F1 reciprocal hybrids. The products were cleaved with Cac8I to detect a polymorphism between the species.
1:1 and 2:1 lanes contain
RT-PCR products of artificial
mixtures of PO:BW RNAs.
b RT-PCR of pPl2A mRNA
from E12.5 placentae of BW,
PO and F1 reciprocal hybrids.
The products were cleaved
with BsaJI to detect a polymorphism between the species.
c RT-PCR of Mouse Pl1
mRNA from E12.5 placentae
of C57BL/6 (B), Cast/Ei (C)
and F1 reciprocal hybrids. The
products were cleaved with
EarI to detect a polymorphism
between the two strains.
M pBR322 DNA digested with
MspI. The arrows at the right
indicate the products for each
species
sion than the parentals (data not shown). Using primers
that amplify both pPl1-v and pPl1, we detected pPl1 expression in late-gestation (PO×BW)F1 placentae, but not
in those of the reciprocal cross nor in either parental
strain (Fig. 3). Thus the increase in the total pPl1 mRNA
is not due to loss of pPl1-v imprinting, but to the persistent expression of the biallelic pPl1 gene in late-stage
placentae.
Prior studies had shown that a subset of PO×
(BW×PO)F1 backcross animals were severely over-sized
(Vrana et al. 2000). Furthermore a number of imprinted
genes, including H19, Pw1/Peg3, Snrpn and Mest/Peg1
were biallelically expressed, as in the large (PO×BW)F1
hybrids. To find whether the persistent expression of
pPl1 plays a role in the placental dysplasia, we examined
its expression in a PO× (BW×PO)F1 backcross in which
placentae varied from normal to over-sized. Although
the mis-regulation of pPl1 was observed exclusively in
the largest placentae, some large placentae had repressed
pPl1 appropriately by E18 (Fig. 5a). Furthermore the
genotype of pPl1 in these animals did not correlate with
the size of the placenta or pPl1 mis-expression. Thus the
dysplasia cannot be directly linked to the inappropriate
Fig. 5a, b pPl1 mis-expression in Peromyscus crosses. a pPl1 and
pPl1-v mRNAs were amplified by RT-PCR in progeny of a PO×
(BW×PO)F1 backcross. The lanes are ordered in decreasing placental size, from 0.55 to 0.24 g (left to right). The last two on the
right are within the normal size range. The genotype of each fetus
at pPl1 is indicated. b pPl1 and pPl1-v mRNAs were amplified by
RT-PCR in progeny of the crosses indicated
529
Fig. 6 Spatial expression of pPl1 and H19 in Peromyscus placentae. Paraffin embedded sections of placentae from PO (P. polionotus) and reciprocal F1 hybrids between PO and BW (Peromyscus
maniculatus) were hybridized to digoxygenin-labelled anti-sense
H19 probe(left) and a pan-pPl1 probe (right). S Spongiotrophoblast layer, L labyrinthine layer. All sections were photographed at
×2 magnification
expression of pPl1 late in gestation. On the other hand,
the mis-regulation of pPl1 was confined to animals generated in crosses in which imprinting disruptions were
also seen (G3×BW and G4; Fig. 5b), and not in crosses
in which imprinting disruptions have not been observed
(F2 and (BW×PO)F1×BW; Fig. 5b). Thus although pPl1
is not imprinted itself, its expression may be regulated in
part by the same epigenetic mechanisms that regulate
imprinted genes. Whether this reflects some aspect of the
tight linkage between the biallelic pPl1 and the imprinted pPl1-v genes is not clear.
Alterations in the structure of the placenta
in Peromyscus hybrids
The decreased expression of the pPl1 transcripts in the
under-sized (BW×PO)F1 offspring could not be attributed to temporal misregulation of either gene during gestation (data not shown). To further explore the explanation
530
for the decrease, we used RNA in situ hybridization to
investigate the spatial expression of these genes within
the placenta. pPl1-v staining revealed that the gene is expressed in the spongiotrophoblast layer in both PO and
BW placentae (Fig. 6 and data not shown). However in
(BW×PO)F1 placentae the spongiotrophoblast layer is reduced, possibly explaining the reduced relative expression of the pPl1 transcripts (Fig. 6). Conversely the
spongiotrophoblast layer is expanded in (PO×BW)F1
placentae, and the architecture was generally disorganized. pPl1-v staining appeared only slightly proportionately expanded.
H19 is a gene that is maternally expressed primarily
in the labyrinthine layer and a subset of glycogen cells.
Its expression was expanded in (PO×BW)F1 placentae,
suggesting an overabundance of glycogen cells and invasion of labyrinthine cells into the spongiotrophoblast
layer (Fig. 6). In contrast, H19 expression in the undersized (BW×PO)F1 placenta was similar to that seen in
the parental strains. These studies reveal that the changes
in placental growth in the reciprocal hybrids affect different cell layers.
Discussion
In this study we demonstrate that the expression of one
of the PL genes in Peromyscus, pPl1-v, is imprinted in
the placenta. The PLs are placental-specific hormones
involved in regulating the availability of nutrients to the
fetus, possibly by directly stimulating the release of
the growth factors insulin-like growth factor-I (IGF-I),
IGF-II and insulin (Hill and Hogg 1989; Anthony et al.
1995). There is also evidence that PLs can signal through
the prolactin receptor, thereby affecting endometrial
epithelial remodeling and differentiation during pregnancy in support of conceptus growth and development
(Cohick et al. 1996; Sakal et al. 1996). Thus pPl1-v joins
a growing list of imprinted genes that are involved in the
regulation of fetal growth through the IGF/insulin pathways. The list includes the paternally expressed growthpromoting genes Igf2, Insulin-2 and Dlk1 as well as maternally expressed genes that repress growth, such as
Igf2r and Grb10 (Barlow et al. 1991; DeChiara et al.
1991; Giddings et al. 1994; Miyoshi et al. 1998; Schmidt
et al. 2000). Igf2r encodes the IGF-II /mannose-6-phosphate receptor that targets IGF-II for degradation and
Grb10 encodes an adaptor protein that inhibits signaling
through the insulin and/or IGF-1 receptors (Morrione
et al. 1997; Morrione 2000). This complex network of
imprinted genes provides strong support for imprinting
as a growth regulatory mechanism.
The notion that imprinting evolved to regulate fetal
growth can be explained as a form of kinship theory
known as parent offspring conflict, first proposed by
Haig and colleagues (Moore and Haig 1991; Haig 1992,
1997). They argued that competing interests between
parents will be played out between maternally and paternally derived genes within the embryos of polyandrous
species. The mother will attempt to optimize the survival
of her offspring by distributing maternal resources equally among all current and future offspring, while the father will try to garner as many maternal resources as
possible, even at the expense of the mother and her future offspring. This selection pressure will be heightened
by a greater likelihood that future offspring will not be
sired by the current male. Our demonstration that pPl1-v
is paternally expressed is consistent with this model.
The dramatic parent-of-origin-specific somatic overgrowth and placental dysplasia that occur in Peromyscus
hybrids have been shown to have both genetic and epigenetic causes (Vrana et al. 2000). The genetic component
has been mapped to two regions of the mouse genome
that interact with one another genetically: a maternally
expressed region on the X chromosome and a paternally
expressed region that corresponds to proximal mouse
chromosome 7. The epigenetic effect is a loss-of-silencing of a substantial number of genes that are normally silenced upon maternal inheritance. Given the role of PLs
in regulating fetal growth, it was conceivable that the
overgrowth could have been due in part to the persistent
expression of pPl1 in late gestation. Our genetic analysis, however, rules out a major role for pPl1 expression
in the hybrid phenotype.
In addition to their well-established roles in growth,
PLs are also expressed within the maternal hypothalamus and the choroid plexus (Bridges et al. 1985; Bridges
1994). Infusion of either purified prolactin or PL-I into
non-pregnant female mice results in the induction of a
number of maternal-specific behaviors (Bridges and
Freemark 1995). Thus PLs expressed from the paternal
genome in the embryo may also influence postnatal maternal care. A role for genomic imprinting in maternal
behavior was first suggested from the outcome of lossof-function mutations in two paternally expressed genes,
Mest and Pw1/Peg3. Both mutations reduced the rate of
fetal growth in offspring, but in addition, the maternal
behavior of daughters was compromised (Lefebvre et al.
1998; Li et al. 1999). In both instances, the behavioral
defect was correlated with a reduction in the number of
oxytocin-producing neurons in the hypothalamus. However neither mutation affected the behavior of wild-type
mothers of mutant embryos, which parental competition
should favor more strongly. In contrast, circulating PLs
could well perform such a function.
Of the imprinted genes that have been examined in
multiple species, the majority show conservation of imprinting (Morison and Reeve 1998). There are several
exceptions such as Mash2, a gene that encodes a transcription factor required for the development of spongiotrophoblasts in the placenta (Guillemot et al. 1994). This
gene is maternally expressed in mice but it is biallelic in
Peromyscus (Guillemot et al. 1995; Vrana et al. 1998).
The IGF2R gene, whose imprinting in humans is a polymorphic trait, is consistently imprinted in mouse, Peromyscus and didelphid marsupials (Barlow et al. 1991; Xu
et al. 1993; Smrzka et al. 1995; Vrana et al. 1998; Killian
et al. 2000). Thus different species have either evolved
531
different sets of imprinted genes following speciation, or
have differentially lost imprinting. Based on the sequence comparisons in Fig. 2, which argue that the duplication of the Pl1 genes occurred after the radiation of
rodents, pPl1-v represents a clear case where imprinting
of a gene appears to have been gained. Given the large
and diverse number of prolactin-related genes in different mammalian species, including Peromyscus (Lin et
al. 2000 and data not shown), it is worth considering
whether different family members might be imprinted in
different groups.
The fact that the linked pPl1 gene in Peromyscus is
not imprinted raises the interesting mechanistic question
of how the local control of pPl1-v imprinting is
achieved, given that many well-studied imprinted genes
exist in large multi-gene clusters that are regulated by
single imprinting control regions (Reik and Maher 1997;
Tilghman 1999). However, even within these clusters are
imprinted genes that are flanked by biallelic genes, such
as the imprinted Mash2 gene in mouse whose immediate
neighbors are not imprinted (Caspary et al. 1998;
Paulsen et al. 1998). A simple model that could account
for local silencing of a single gene in an otherwise biallelic cluster posits that the promoter of the silenced gene
has evolved to be more heavily methylated and therefore
transcriptionally silent upon inheritance through one
germline versus the other. This is thought to be the basis
for the imprinting of genes such as the RNA-coding H19
gene and the Igf2r-linked anti-sense Air transcript (Li et
al. 1993; Wutz et al. 1997). Interestingly, however, the
methylation status of the sequences surrounding these
genes also affects other genes at a distance, Igf2 and
Igf2r, respectively (Wutz et al. 1997; Thorvaldson et al.
1998). Although pPl1 is not imprinted itself, it becomes
inappropriately expressed in the same Peromyscus
crosses that show imprinting disruptions. This suggests
that the imprinting of the neighboring pPl1-v gene may
have some influence over the expression of pPl1 without
leading to its imprinting. Given its recent acquisition in
evolution, the examination of the imprinting mechanism
at pPl1-v may lead to key insights into the genesis of the
process.
Acknowledgements This work was supported by a grant from the
National Institute of General Medical Sciences (GM51460) to
S.M.T. and grants from the NIH (RR14279) and NSF (DBI
9816613) to M.J.D. S.M.T. is an Investigator of the Howard
Hughes Medical Institute and J.V.S. was supported by a Jane
Coffin Childs Postdoctoral Fellowship.
References
Anthony RV, Pratt SL, Liang R, Holland MD (1995) Placentalfetal hormonal interactions: impact on fetal growth. J Anim
Sci 73:1861–1871
Auffray C, Rougeon F (1980) Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor
RNA. Eur J Biochem 107:303–314
Barlow DP, Stoger R, Herrmann BG, Saito K, Schweifer N (1991)
The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus. Nature 349:84–87
Bartolomei MS, Tilghman SM (1997) Genomic imprinting in
mammals. Annu Rev Genet 31:493–525
Bremer K (1994) Branch support and tree stability. Cladistics
10:295–304
Bridges RS (1994) The role of lactogenic hormones in maternal
behavior in female rats. Acta Paediatr Suppl 397:33–39
Bridges RS, Freemark MS (1995) Human placental lactogen infusions into the medial preoptic area stimulate maternal behavior
in steroid-primed, nulliparous female rats. Horm Behav 29:
216–226
Bridges RS, DiBiase R, Loundes DD, Doherty PC (1985) Prolactin stimulation of maternal behavior in female rats. Science
227:782–784
Caspary T, Cleary MA, Baker CC, Guan X-J, Tilghman SM
(1998) Multiple mechanisms regulate imprinting of the mouse
distal chromosome 7 gene cluster. Mol Cell Biol 18:3466–
3474
Chen EY, Liao YC, Smith DH, Barrera-Saldana HA, Gelinas RE,
Seeburg PH (1989) The human growth hormone locus: nucleotide sequence, biology, and evolution. Genomics 4:479–
497
Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl
Acad Sci USA 81:1991–1995
Cohick CB, Dai G, Xu L, Deb S, Kamei T, Levan G, Szpirer C,
Szpirer J, Kwok SC, Soares MJ (1996) Placental lactogen-I
variant utilizes the prolactin receptor signaling pathway. Mol
Cell Endocrinol 116:49–58
Deb S, Faria TN, Roby KF, Larsen D, Kwok SC, Talamantes F,
Soares MJ (1991) Identification and characterization of a new
member of the prolactin family, placental lactogen-I variant.
J Biol Chem 266:1605–1610
DeChiara TM, Robertson EJ, Efstratiadis A (1991) Parental imprinting of the mouse insulin-like growth factor II gene. Cell
64:849–859
Dietz AB, Georges M, Threadgill DW, Womack JE, Schuler LA
(1992) Somatic cell mapping, polymorphism, and linkage
analysis of bovine prolactin-related proteins and placental lactogen. Genomics 14:137–143
Giddings SJ, King CD, Harman KW, Flood JF, Carnaghi LR
(1994) Allele specific inactivation of insulin 1 and 2, in the
mouse yolk sac, indicates imprinting. Nat Genet 6:310–313
Goffin V, Shiverick KT, Kelly PA, Martial JA (1996) Sequencefunction relationships within the expanding family of prolactin, growth hormone, placental lactogen, and related proteins
in mammals. Endocr Rev 17:385–410
Guillemot F, Nagy A, Auerbach A, Rossant J, Joyner AL (1994)
Essential role of Mash-2 in extraembryonic development.
Nature 371:333–336
Guillemot F, Caspary T, Tilghman SM, Copeland NG, Gilbert DJ,
Jenkins NA, Anderson DJ, Joyner AL, Rossant J, Nagy A
(1995) Genomic imprinting of Mash-2, a mouse gene required
for trophoblast development. Nat Genet 9:235–241
Hagiwara Y, Hirai M, NIshiyama K, Kanazawa I, Ueda T, Sakaki
Y, Ito T (1997) Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18. Proc Natl Acad Sci USA
94:9249–9254
Haig D (1992) Genomic imprinting and the theory of parent-offspring conflict. Semin Dev Biol 3:153–160
Haig D (1993) Genetic conflicts in human pregnancy. Q Rev Biol
68:495–532
Haig D (1997) Parental antagonism, relatedness asymmetries, and
genomic imprinting. Proc R Soc Lond Ser B 264:1657–1662
Hill DJ, Hogg J (1989) Growth factors and the regulation of preand postnatal growth. Baillieres Clin Endocrinol Metab 3:
579–625
Hurst LD (1997) Evolutionary theories of genomic imprinting. In:
Reik W, Surani A (eds) Genomic imprinting. IRL Press,
Oxford, pp 211–237
Jackson-Grusby LL, Pravtcheva D, Ruddle FH, Linzer DI (1988)
Chromosomal mapping of the prolactin/growth hormone gene
family in the mouse. Endocrinology 122:2462–2466
532
Killian JK, Byrd JC, Jirtle JV, Munday BL, Stoskopf MK,
MacDonald RG, Jirtle RL (2000) M6P/IGF2R imprinting evolution in mammals. Mol Cell 5:707–716
Lefebvre L, Viville S, Barton SC, Ishino F, Keverne EB, Surani
MA (1998) Abnormal maternal behaviour and growth retardation associated with loss of the imprinted gene Mest. Nat
Genet 20:163–169
Li E, Beard C, Jaenisch R (1993) The role of DNA methylation in
genomic imprinting. Nature 366:362–365
Li L, Keverne EB, Aparicio SA, Ishino F, Barton SC, Surani MA
(1999) Regulation of maternal behavior and offspring growth
by paternally expressed Peg3. Science 284:330–333
Lin J, Toft DJ, Bengtson NW, Linzer DI (2000) Placental prolactins and the physiology of pregnancy. Recent Prog Horm Res
55:37–51
Linzer DI, Nathans D (1985) A new member of the prolactingrowth hormone gene family expressed in mouse placenta.
EMBO J 4:1419–1423
Miyoshi N, Kuroiwa Y, Kohda T, Shitara H, Yonekawa H,
Kawabe T, Hasegawa H, Barton SC, Surani MA, KanekoIshino T, Ishino F (1998) Identification of the Meg1/Grb10
imprinted gene on mouse proximal chromosome 11, a candidate for the Silver-Russell syndrome gene. Proc Natl Acad Sci
USA 95:1102–1007
Moore T, Haig D (1991) Genomic imprinting in mammalian development: a parental tug-of-war. Trends Genet 7:45–89
Morison IM, Reeve AE (1998) A catalogue of imprinted genes
and parent-of-origin effects in humans and animals. Hum Mol
Genet 7:1599–1609
Morrione A (2000) Grb10 proteins in insulin-like growth factor
and insulin receptor signaling. Int J Mol Med 5:151–154
Morrione A, Valentinis B, Resnicoff M, Xu S, Baserga R (1997)
The role of mGrb10alpha in insulin-like growth factor I-mediated growth. J Biol Chem 272:26382–26387
Morrison DA, Ellis JT (1997) Effects of nucleotide sequence
alignment on phylogeny estimation: a case study of 18S
rDNAs of apicomplexa. Mol Biol Evol 14:428–441
Owerbach D, Rutter WJ, Martial JA, Baxter JD, Shows TB (1980)
Genes for growth hormone, chorionic somatommammotropin,
and growth hormones-like gene on chromosome 17 in humans. Science 209:289–292
Paulsen M, Davies KR, Bowden LM, Villar AJ, Franck O,
Fuermann M, Dean WL, Moore TF, Rodrigues N, Davies KE,
Hu RJ, Feinberg AP, Maher ER, Reik W, Walter J (1998) Syntenic organization of the mouse distal chromosome 7 imprinting cluster and the Beckwith-Wiedemann syndrome region in
chromosome 11p15.5. Hum Mol Genet 7:1149–1159
Phillips A, Janies D, Wheeler W (2000) Multiple sequence alignment in phylogenetic analysis. Mol Phylogenet Evol 16:317–
330
Prince K (2001) Development of molecular markers for the Peromyscus genome project. M.Sc. thesis, University of South
Carolina, Columbia
Reik W, Maher ER (1997) Imprinting in clusters: lessons from
Beckwith-Wiedemann syndrome. Trends Genet 13:330–334
Sakal E, Robertson MC, Chapnik-Cohen N, Tchelet A, Gertler A
(1996) Interaction of recombinant rat placental lactogen-I with
extracellular domains of prolactin receptors from three species. Recept Signal Transduct 6:35–42
Schmidt JV, Matteson PG, Jones BK, Guan XJ, Tilghman SM
(2000) The Dlk1 and Gtl2 genes are linked and reciprocally
imprinted. Genes Dev 14:1997–2002
Shah P, Sun Y, Szpirer C, Duckworth ML (1998) Rat placental
lactogen II gene: characterization of gene structure and placental-specific expression. Endocrinology 139:967–973
Smrzka OW, Fae I, Stoger R, Kurzbauer R, Fischer GF, Henn T,
Weith A, Barlow DP (1995) Conservation of a maternal-specific methylation signal at the human IGF2R locus. Hum Mol
Genet 4:1945–1952
Soares MJ, Farria TN, Roby KF, Deb S (1991) Pregnancy and the
prolactin family of hormones: coordination of anterior pituitary, uterine and placental expression. Endocr Rev 12:402–
423
Thorvaldson JL, Duran KL, Bartolomei MS (1998) Deletion of
the H19 differentially methylated domain results in loss of
imprinted expression of H19 and Igf2. Genes Dev 12:3693–
3702
Tilghman SM (1999) The sins of the fathers and mothers: genomic
imprinting in mammalian development. Cell 96:185–193
Vrana PB, Guan X-J, Ingram RS, Tilghman SM (1998) Genomic
imprinting is disrupted in interspecific Peromuscus hybrids.
Nat Genet 20:362–365
Vrana PB, Fossella JA, Matteson P, Rio T del, O’Neill MJ,
Tilghman SM (2000) Genetic and epigenetic incompatibilties
underlie hybrid dysgenesis in Peromyscus. Nat Genet 25:120–
124
Wilkinson DG, Nieto MA (1993) Detection of messenger RNA by
in situ hybridization to tissue sections and whole mounts.
Methods Enzymol 225:361–373
Womack J, Johnson J, Owens E, Rexroad C, Schlapfer J, Yang Y
(1997) A whole-genome radiation hybrid panel for bovine
gene mapping. Mamm Genome 8:854–856
Wutz A, Smrzka OW, Schweifer N, Schellander K, Wagner EF,
Barlow DP (1997) Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature 389:745–749
Xu Y, Goodyer CG, Deal C, Polychronakos C (1993) Functional
polymorphism in the parental imprinting of the human IGF2R
gene. Biochem Biophys Res Commun 197:747–754