Download 4- Dora JM, Machado WE, Rheinheimer J, Crispim D, Maia AL. 2010

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Hypothyroidism wikipedia, lookup

Hyperthyroidism wikipedia, lookup

Graves' disease wikipedia, lookup

Sexually dimorphic nucleus wikipedia, lookup

Epigenetics of diabetes Type 2 wikipedia, lookup

Diabetic neuropathy wikipedia, lookup

Diabetic retinopathy wikipedia, lookup

Diabetic foot ulcer wikipedia, lookup

Complications of diabetes mellitus wikipedia, lookup

Transcript
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
Alrefaie
Effect of vitamin D3 Supplementation on Thyroid
Hormones and Deiodinase 2 Expression in
Streptozotocin-induced Diabetic Rats
Zienab Alrefaie
Physiology Department, Faculty of Medicine, Cairo University
ABSTRACT
Aim: Effect of vitamin D supplementation on peripheral conversion of T4 into T3 in
diabetic rats has not been previously investigated. The present study aimed to assess
the effect of vitamin D3 administration on deiodinase 2 (D2) expression in diabetic
rats. Methods: Thirty male Wistar rats (200-250 g) were included into; control,
diabetic and diabetic supplemented with vitamin D3 groups. Diabetes was induced by
single intraperitoneal injection of streptozotocin 45 mg/kg in citrate buffer. Vitamin
D3 was administered orally in a dose of 500 IU/kg/day in corn oil for 10 weeks.
Serum levels of free T4, free T3 and TSH were measured. Tissue homogenates from
liver, kidney, muscle, femur bone, heart and brain were obtained and assessed for
expression of D2 mRNA. Results: Diabetic rats demonstrated significant increase in
free T4 and significant decrease in free T3 together with non significant increase in
TSH level compared to control rats. However the changes in thyroid profile were
ameliorated by vitamin D3 administration to diabetic rats. D2 mRNA expression was
significantly reduced in all tissue homogenates obtained from diabetic rats compared
to control rats. Vitamin D3 treated diabetic rats showed significantly enhanced D2
mRNA expression in liver and brain homogenates, while in remaining tissues; the
increase in D2 mRNA did not reach significance. Conclusion: Diabetes mellitus
inhibited peripheral conversion of T4 into T3 secondary to reduction in the
expression of D2 in almost all body tissues. Vitamin D3 administration to diabetic
rats greatly corrected the alterations in thyroid profile and D2 expression. The
present results point to the possible beneficial role of vitamin D3 against the
subclinical hypothyroid state that could associate diabetes mellitus.
Key words: diabetes mellitus, vitamin D3, thyroid hormones, deiodinase 2
INTRODUCTION
Uncontrolled diabetes mellitus
was found to be associated with
altered function of thyroid gland, this
condition has been characterized as
"euthyroid sick syndrome"[1].
Abnormalities
in
thyroid
hormone levels seen in rats rendered
diabetic included; decreased thyroxin
(T4), triiodothyronin (T3) and
increased reverse T3 while thyroid
stimulating hormone (TSH) was
found to be low or normal[2]. However
little is known about the effects of
diabetes mellitus on peripheral
conversion of T4 into active T3.
80-90% of the circulating T3 is
derived from the T4 intracellularly.
The conversion of T4 to T3 is
13
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
catalyzed by type 1 (D1) and type 2
(D2) deiodinases via outer-ring
deiodination.[3]
D2 is considered the main T4activating enzyme and the key
enzyme for T3 generation as stated by
Dora et al.[4]
Significant controversy has been
raised recently regarding the effects of
vitamin D on nonskeletal tissues.
Vitamin D receptors were found to be
expressed in almost all cells of the
body, in addition many observations
supported the relationship of serum
25-hydroxyvitamin D to many
diseases and disorders. Interest in
vitamin D as a therapeutic modality
for the prevention of nonskeletal
diseases has much increased[5,6].
In fact, the effect of vitamin D
supplementation on thyroid status and
peripheral deiodination of T4 into T3
in diabetic rats was not worked out
previously.
Aim
The present study was designed
to assess the effect of vitamin D3
supplementation on diabetes-induced
changes in free T4, free T3 and TSH
levels and D 2 mRNA expression of
streptozotocin-induced diabetic rats
METHODS
Animals
Thirty adult male Wistar rats
weighing (200-250 g) were included
in the present study. They were
obtained and maintained at the animal
house, Kasr Alini Faculty of
Medicine, Cairo University. Animals
were kept at room temperature under
12 h light/ dark cycle. They were
allowed free access to rat chaw and
water.
Alrefaie
Chemicals
Streptozotocin was obtained from
MB Biomedicals LLA, California,
USA. While vitamin D3 was obtained
from Sigma–Aldrich Co., St. Louis,
USA.
Experimental design
Twenty rats were made diabetic
by single intraperitoneal injection of
streptozotocin (stz) (45 mg/kg body
weight) in citrate buffer (pH 4.5)[7].
Diabetes was confirmed by blood
glucose levels above 250 mg/dl 72
hours following injection. The
remaining
10
rats
received
intraperitoneal equivalent volume of
citrate buffer and accounted for the
control group.
Diabetic animals were classified
into; diabetic group, and diabetic
group supplemented with vitamin D3;
rats were administered orally vitamin
D3 in a dose of 500 IU/kg/day in corn
oil for 10 weeks[8].
At the end of the experiment after
an overnight fast, blood samples were
collected through retro orbital rout
and sera were separated and used for
measurement of freeT4, free T3 and
TSH levels.
Then animals were sacrificed
under diethyl ether anesthesia, tissue
samples from liver, kidney, muscle,
femur bone, heart and brain were
dissected and kept at -80 until
measurement
of
D2
mRNA
expression.
Biochemical measurements
Free T4 and T3 were measured
using electrochemiluminescence assay
technique (Immuno Diagnostics Inc.
USA) while TSH was measured using
Cusabio rat ultrasensitive TSH ELIZA
kit (U-TSH) (Wuhan Huamei Biotech,
Inc. China).
14
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
Detection of D2 gene by Real-time
RT-PCR
1-Ribonucleic acid (RNA) extraction
and complementary deoxyribonucleic
acid (cDNA) synthesis.
Total RNA was isolated from
different tissue homogenates using
trizol reagent TM (Invitrogen,
Carlsbad, CA) according to the
manufacturer’s protocol
The RNA sample was dissolved
in RNase-free water and quantified
spectrophotometrically. The integrity
of the RNA was studied by gel
electrophoresis on a 1% agarose gel,
containing ethidium bromide. Firststrand cDNA synthesis was performed
with the Superscript Choice System
(Life Technologies, Breda, the
Netherlands) by mixing 2 μg total
RNA with 0.5 μg of oligo (dT)12-18
primer in a total volume of 12 μL.
After the mixture was heated at 70°C
for 10 min, a solution containing 50
mmol/L Tris・HCl (pH 8.3), 75
mmol/L KCl, 3 mmol/L MgCl2, 10
mmol/L DTT, 0.5 mmol/L dNTPs, 0.5
μL RNase inhibitor, and 200 U
Superscript Reverse Transcriptase was
added, resulting in a total volume of
20.5 μL. This mixture was incubated
at 42°C for 1 h and then stored at –
80°C until further use.
2- Real time quantitative PCR
For real time quantitative PCR, 1
μL of first-strand cDNA diluted 1:10
in RNase-free water was used in a
total volume of 25 μL, containing 12.5
μL 2x SYBR Green PCR Master Mix
(Applied Biosystems, Foster City,
CA, USA) and 200 ng of each primer.
Primers, designed with the Primer
Express software package (Applied
Biosystems),
for
Type
2
iodothyronine
deiodinase
gene
Alrefaie
(forward
5′5'
GGCTGACTTCCTGTTG3′(Reverse
5′CACATCGGTCCTCTTGGTTCC 3′) β-actin primers (forward 5′TGTTGTCCCTGTATGCCTCT-3′,
reverse
5′TAATGTCACGCACGATTTCC-3′).
PCR reactions, consisting of 95°C for
10 min (1 cycle), 94°C for 15 s, and
60°Cfor 1 min (40 cycles), were
performed on an ABI Prism 7900 HT
Fast Real Time PCR system (Applied
Biosystems). Data were analyzed with
the
ABI
Prism 7900sequence
detection system software (version
2.2) and quantified with the
comparative threshold cycle method
with beta actin as a housekeeping
gene reference[9].
Statistical Analysis
Data were statistically evaluated
with SPSS for windows package
version 20 (SPSS Inc., Chicago, IL,
USA). Results are expressed as the
Mean ± SD. One way analysis of
variance (ANOVA) test was used to
compare
between
groups.
Significance level at P < 0.05 was
considered to indicate statistical
significance.
RESULTS
Results obtained in the present
study revealed significant changes in
the thyroid profile 10 weeks after
induction of diabetes mellitus.
Diabetic
rats
demonstrated
significant increase in free T4 and
significant decrease in free T3
together with non significant increase
in TSH level compared to control rats.
Vitamin D3 supplementation to
diabetic rats significantly ameliorated
15
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
the alterations in the levels of free T4,
T3 and TSH which were returned
towards normal (Table 1 and Figure
1).
Deiodinase 2 mRNA expression
revealed highly significant reduction
in homogenates of liver, kidney,
muscle, heart and brain tissues
obtained from diabetic rats compared
to control rats (P < 0.001). Femur
bone homogenates demonstrated the
least significant reduction in D2
mRNA expression in diabetic rats
compared to control non diabetic rats
(P < 0.01).
Alrefaie
Diabetic rats treated with vitamin
D3
demonstrated
significant
enhancement
of
D2
mRNA
expression in liver and brain
homogenates when compared to the
untreated diabetic rats. It is observed
that although D2 expression was also
increased in kidney, muscle, bone and
heart homogenates of diabetic rats in
response
to
vitamin
D3
administration, but this increase did
not reach statistical significance
(Table 2 and Figures 2-3).
Table 1: Serum levels of free T4 (ng/dl), T3 (pg/ml), TSH (nIU/ml) and glucose
(mg/dl) in control group, diabetic group and diabetic group treated with vitamin
D3.
Parameter
Control group
Diabetic group
Diabetic + vit D3 group
1.27 ± 0.43
0.83 ± 0.17
0.84 ± 0.19
P1 < 0.05
P1 : NS
Free T4
P2 < 0.01
2.05 ± 0.5
2.87 ± 0.55
3.83 ± 0.25
P1 < 0.001
P1 < 0.01
Free T3
P2 < 0.01
70.15 ± 19.2
56.91± 18.63
53.55 ± 12.67
P1 : NS
P1 : NS
TSH
P2 : NS
271.87 ± 52.1
193 ± 16.71
86.88 ± 10.96
P1 < 0.001
P1 < 0.001
Glucose
P2 < 0.001
P1: Significant when compared to control group
P2: Significant when compared to diabetic group
NS: Non significant
16
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
Alrefaie
Table 2: Deiodinase 2 (D2) mRNA expression in tissue homogenates from liver,
kidney, muscle, femur, heart and brain of control group, diabetic group and
diabetic group treated with vitamin D3.
Parameter
Control group
Diabetic group
Diabetic + vit D3 group
0.2 ± 0.12
0.6 ± 0.24
D2 Liver
1.77 ± 0.33
P1 < 0.001
P1 < 0.001
P2 < 0.01
0.32 ± 0.22
0.58 ± 0.26
D2 Kidney
1.51 ± 0.42
P1 < 0.001
P1 < 0.001
P2: NS
0.46 ± 0.12
0.52 ± 0.21
D2 Muscle
0.98 ± 0.04
P1 < 0.001
P1 < 0.01
P2 : NS
0.44 ± 0.23
0.6 ± 0.42
D2 Bone
1.28 ± 0.54
P1 < 0.01
P1 < 0.05
P2 : NS
0.61 ± 0.23
0.79 ± 0.2
D2 Heart
1.47 ± 0.25
P1 < 0.001
P1 < 0.01
P2 : NS
0.52 ± 0.26
1.05 ± 0.22
D2 Brain
1.94 ± 0.21
P1 < 0.001
P1 < 0.001
P2 < 0.01
P1: Significant when compared to control group
P2: Significant when compared to diabetic group
NS: Non significant
Figure 1: Serum levels of free T4 (ng/dl), T3 (pg/ml), TSH (nIU/ml) and glucose
(mg/dl) in control group, diabetic group and diabetic group treated with vitamin D3.
P1: Significant when compared to control group
P2: Significant when compared to diabetic group
NS: Non Significant
17
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
Alrefaie
Figure 2: Deiodinase 2 (D2) mRNA expression in tissue homogenates from liver,
kidney, muscle, and femur bone of control group, diabetic group and diabetic group
treated with vitamin D3.
P1: Significant when compared to control group
P2: Significant when compared to diabetic group
NS: Non Significant
Figure 3: Deiodinase 2 (D2) mRNA expression in tissue homogenates from heart and
brain of control group, diabetic group and diabetic group treated with vitamin D3.
P1: Significant when compared to control group
P2: Significant when compared to diabetic group
NS: Non Significant
18
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
DISCUSSION
Findings of the present work
demonstrated
that
stz-induced
diabetes mellitus for 10 weeks
significantly elevated free T4 and
significantly reduced free T3 with
significant reduction in D2 mRNA in
almost
all
body
tissues.
Supplementation of diabetic rats with
the active form of vitamin D,
produced beneficial effects as it
returned the levels of thyroid
hormones towards normal and
enhanced the expression of D2 in all
tissues assessed specially the liver and
brain.
According to most updated
works, the present study is the first to
investigate the effect of vitamin D3
administration
on
peripheral
conversion of T4 into active T3 in
many body tissues in diabetic rats.
Diabetes mellitus is one of the
most common clinical problems. It
could result in many complications
including thyroid gland dysfunction.
Saravanan
and
Ponnurugan[10]
observed significant decrease in T3,
T4 and TSH levels in stz-induced
diabetic rats 45 days after induction of
diabetes. The authors explained their
observation that stz-induced liver
damage resulted into two problems;
first decreased T3 production in the
liver, second decreased production of
thyroid binding proteins leading to
decrease in T3 and T4 levels.
The present results apparently
invalidate
the
explanation
of
Saravanan and Ponnurugan, as D2
was decreased in many body tissues
other than the liver indicating
decreased T3 production all over the
body and not only in the liver. In
Alrefaie
addition, the present work assessed
the free levels of T4 and T3 which is
more accurate than measurement of
total levels that could be affected by
thyroid binding proteins.
Previously, Parmar and Kar[11],
induced diabetes by feeding rats
atherogenic diet for 14 days. The
authors demonstrated reduction in
total T3, T4 and hepatic D1 in
atherogenic diet-induced diabetic
animals.
Although the great difference in
the experimental design between
present work and work of Parmar and
Kar, but their findings point to
decreased thyroid function in diabetic
models.
Similarly, Santos et al.[12] pointed
to the prevalence of thyroid disorders
especially subclinical hypothyroidism
in diabetic rats agreeing with the
present findings.
In accord with the present results
and in human patients, Chubb et al.[13]
stated that subclinical hypothyroidism
is common among type 2 diabetic
patients. Also high prevalence of
thyroid dysfunction in thyroid ultra
sound scanning was found in young
patients with type 1 diabetes
mellitus[14].
Results of diabetic rats in the
present work showed non significant
elevation of TSH, this further supports
the possibility of development of
subclinical
hypothyroid
state
especially with decreased deiodination
of T4 into T3 in many tissues. This
finding also suggests that the pituitary
feed-back might greatly depend on the
T3 formed through action of D2 in the
brain.
In support to this hypothesis, it
was stated earlier that in the brain
19
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
80% of T3 is formed locally from T4
through activity of D2[15].
Supplementation of vitamin D3
has been assessed for possible
beneficial effects in many clinical
entities.
The present work could be the
first to assess effect of vitamin D3
supplementation on D2 expression in
diabetic rats in almost all body tissues.
Relation of vitamin D to
Hashimoto's thyroiditis has been
much investigated. Very little work in
the literature investigated the relation
of vitamin D to other thyroid
dysfunction or illnesses.
Recently, Chailurkit et al.[16], in
their
population-based
study
demonstrated that high vitamin D
status was associated with low
circulating TSH. This was exactly
observed in the present study in the
diabetic group treated with vitamin
D3 in which TSH levels were
decreased
towards
normal
in
comparison with the untreated
diabetic group.
Previously Gouveia et al.[17],
revealed that treatment of bone
extracts from mice skeleton with
vitamin D3 increased D2 activity by
2-3 fold as early as 24 hours. Their
observation highlights the beneficial
effect of vitamin D3 on bone tissue
D2 and supports the present findings.
In conclusion, the present data
revealed that diabetes mellitus
impaired thyroid hormone status and
compromised peripheral conversion of
T4 into T3 due to inhibition of D2
mRNA expression. For the first time,
the present work provides evidence
that vitamin D3 supplementation
ameliorated the decline in peripheral
production of T3 in diabetic rats and
Alrefaie
corrected the alterations in the level of
thyroid hormones.
REFERENCES
1- Tabata S, Toyoda N, Nishkawa
M, Yonemoto T, Gondou A,
Ogawa Y et al. 1999. Effect of
streptozotocin-induced diabetes
mellitus on type 1 deiodinase in
inherited D1 deficient mice.
Endocrine J 46(4): 497-504.
2- Tabata S, Nishkawa M, Toyoda
N, Yonemoto T, Ogawa Y, Inada
M.
1999.
Effect
of
triiodothyronin administration on
reduced expression of type 1
iodothronin
mRNA
in
streptozotocin-induced diabetic
rats. Endocrine J 46(3): 367-374.
3- St Germain DL, Galton VA,
Hernandez A. 2009 Minireview:
Defining the roles of the
iodothyronine
deiodinases:
current concepts and challenges.
Endocrinology 150(3):1097-107.
4- Dora
JM,
Machado
WE,
Rheinheimer J, Crispim D, Maia
AL. 2010 Association of the type
2
deiodinase
Thr92Ala
polymorphism with type 2
diabetes: case-control study and
meta-analysis. Eur J Endocrinol.
163(3):427-34
5- Christakos S, DeLuca HF 2011
Minireview: vitamin D, is there a
role in extraskeletal health?
Endocrinology 152: 2930–2936
6- Rosen CJ, Adams JS, Bikle DD,
Black DM, Demay MB, Manson
JE, Murad MH, Kovacs CS. 2012
The nonskeletal effects of vitamin
D:
an
Endocrine
Society
scientific statement. Endocr Rev.
33(3): 456-92.
20
Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013
7- Pari L, Sankaranarayanan C.
2009 Beneficial effects of
thymoquinone on hepatic key
enzymes
in streptozotocininduced diabetic rats. Life Sci
85(26):830-4.
8- Salum E, Kampus P, Zilmer
M, Eha
J, Butlin
M, Avolio
AP, Põdramägi
T, Arend
A, Aunapuu M, Kals J. 2012
Effect of vitamin D on aortic
remodeling in streptozotocininduced diabetes. Cardiovasc
Diabetol. 11:58-62.
9- Pfaffl MW. 2001 A new
mathematical model for relative
quantification in real-time RTPCR. Nucleic Acids Res 29:e45.
10- Saravanan G, Ponmurugan P.
2012 Antidiabetic effect of Sallylcysteine: effect on thyroid
hormone
and
circulatory
antioxidant
system
in
experimental diabetic rats. J
Diabetes Complications 26:280 285.
11- Parmar HS, Kar A. 2007
Atherogenic diet induced diabetes
mellitus: involvement of thyroid
hormones. Eur J Pharmacol 570:
244-248.
12- Santos MC, Louzada RA, Souza
EC, Fortunato RS, Vasconcelos
AL, Souza KL, Castro JP,
Carvalho DP, Ferreira AC. 2013
Diabetes
mellitus
increases
reactive
oxygen
species
production in the thyroid of male
rats. Endocrinology 154(3):136172.
Alrefaie
13- Chubb SA, Davis WA, Inman Z,
Davis TM. 2005 Prevalence and
progression
of
subclinical
hypothyroidism in women with
type 2 diabetes: the Fremantle
Diabetes Study. Clin Endocrinol
62(4):480-6.
14- Hansen D, Bennedbaek FN,
Høier-Madsen M, Hegedüs L,
Jacobsen BB. 2003 A prospective
study of thyroid function,
morphology and autoimmunity in
young patients with type 1
diabetes. Eur J Endocrinol.
148(2):245-51.
15- Guadano-Ferraz A, Escamez MJ,
Rausell E, Bernal J. 1999
Expression of type 2 iodothyronin
deiodinase in hypothyroid rat
brain indicates an important role
of thyroid hormone in the
development of specific primary
sensory systems. J Neurosci
19(9):3430-9
16- Chailurkit LO, Aekplakorn W,
Ongphiphadhanakul B. 2013
High vitamin D status in younger
individuals is associated with low
circulating thyrotrophin. Thyroid
23(1):25-30.
17- Gouveia CH, Christoffolete MA,
Zaitune CR, Dora JM, Harney
JW, Maia AL, Bianco AC. 2005
Type
2
iodothyronine
selenodeiodinase is expressed
throughout the mouse skeleton
and in the MC3T3-E1 mouse
osteoplastic cell line during
differentiation.
Endocrinology
146(1):195-200.
21
‫‪Alrefaie‬‬
‫‪Bull. Egypt. Soc. Physiol. Sci. 33 (2) 2013‬‬
‫المستخلص العربى‬
‫الهدف ‪:‬لم يتم التحقق من أثر فيتامين د على تحويل هرمون ‪ T4‬إلى ‪ T3‬فى أنسجة الجسم المختلفة في الفئران‬
‫المصابة بداء السكري سابقا‪ .‬هذه الدراسة تهدف الى تقييم تأثير فيتامين د‪ 3‬على انزيم ديايودينز ‪ )D2( 2‬في‬
‫الجرذان المصابة بداء السكري‪.‬‬
‫الطرق المستخدمة‪ :‬أدرج ثالثون فأرا نوعية ويستار من الذكور (‪ 250-200‬ج) في ‪ 3‬مجموعات‪ ,‬الضابطة‪,‬‬
‫والسكري‪ ,‬والسكري مع فيتامين د‪ . 3‬استحدث مرض السكري عن طريق الحقن داخل الصفاق مرة واحدة من‬
‫الستربتوزوتوسين ‪ 45‬مغ ‪ /‬كغ ‪ .‬أعطى فيتامين د‪ 3‬عن طريق الفم في جرعة من ‪ 500‬وحدة دولية ‪ /‬كجم ‪ /‬يوم‬
‫في زيت الذرة لمدة ‪ 10‬أسابيع‪ .‬تم قياس مستويات المصل لهرمونات ‪ T4‬الحرة‪ T3 ،‬الحرة و‪ TSH‬وكذلك‬
‫مستوى السكر‪ .‬تم الحصول على أنسجة من الكبد والكلى والعضالت والعظام (عظم الفخذ) والقلب والمخ و تم‬
‫تقييمها النزيم ‪. D2‬‬
‫النتائج‪ :‬أظهرت الفئران المصابة بالسكري زيادة ذات داللة احصائية في ‪ T4‬وانخفاض ذو داللة احصائية في‬
‫‪ T3‬جنبا إلى جنب مع زيادة ليست ذات داللة احصائية في مستوى ‪ TSH‬بالمقارنة مع الفئران الضابطة‪ .‬ولكن‬
‫تم تحسن هذه التغييرات في الفئران المصابة بداء السكري و اللتى تناولت فيتامين د‪ .3‬لوحظ انخفاض ‪D2‬‬
‫بشكل كبير ذو داللة احصائية في جميع األنسجة التي تم الحصول عليها من الجرذان المصابة بداء السكري‬
‫مقارنة بالفئران الضابطة‪ .‬أدى اعطاء فيتامين د‪ 3‬للفئران المصابة بداء السكري إلى ارتفاع ذو داللة احصائية فى‬
‫‪ D2‬في الكبد والمخ‪ ،‬بينما في األنسجة المتبقية‪ ,‬الزيادة في ‪ D2‬لم تصل للداللة االحصائية‪.‬‬
‫االستنتاج‪ :‬داء السكري يقلل من تحويل ‪ T4‬الى ‪ T3‬و يؤدى إلى انخفاض في ‪ D2‬في جميع أنسجة الجسم تقريبا‪.‬‬
‫إعطاء فيتامين د‪ 3‬للجرذان المصابة بداء السكري صحح من التغيرات في وظائف الغدة الدرقية و انزيم ‪.D2‬‬
‫تشير النتائج الحالية إلى احتمال وجود دور مفيد لفيتامين د‪ 3‬لهرمونات الغدة الدرقية فى المرضى المصابين بداء‬
‫السكري‪.‬‬
‫‪22‬‬