Download Document

Ch. 11 Protein Synthesis Practice Review
RNA polymerase
5’ end
TGGCATGCATACGGCGTGCAAGTCTGGTCATTAA
ACCGTACGTATGCCGCACGTTCAGACCAGTAATT
mRNA strand:
________________________________________________________________________
Polypeptide chain:
_______________________________________________________________________
Mutation #1—Silent
Silent mutations are DNA point mutations that do not result in a change to the amino
acid sequence of a protein.
RNA polymerase
5’ end
TGGCATGCATACGGCGTGCAAGTCTGGCCATTAA
ACCGTACGTATGCCGCACGTTCAGACCGGTAATT
mRNA strand:
________________________________________________________________________
Polypeptide chain:
________________________________________________________________________
1
Mutation #2—Missense:
A missense mutation is a point mutation in which a single nucleotide is changed,
resulting in a codon that codes for a different amino acid. This can render the resulting
protein nonfunctional.
RNA polymerase
5’ end
TGGCATGCATTCGGCGTGCAAGTCTGGTCATTAA
ACCGTACGTAAGCCGCACGTTCAGACCAGTAATT
mRNA strand:
________________________________________________________________________
Polypeptide chain:
________________________________________________________________________
Mutation #3—Nonsense:
A nonsense mutation is a point mutation in a sequence of DNA that results in a
premature stop codon, or a nonsense codon in the transcribed mRNA, and in a truncated,
incomplete, and usually nonfunctional protein product.
RNA polymerase
5’ end
TGGCATGCATACGGCGTGAAAGTCTGGTCATTAA
ACCGTACGTATGCCGCACTTTCAGACCAGTAATT
mRNA strand:
________________________________________________________________________
Polypeptide chain:
________________________________________________________________________
2
REVIEW
1. A point mutation, or single base substitution, is a type of mutation that causes the
replacement of a single base nucleotide with another nucleotide of the genetic material,
DNA or RNA. One can categorize point mutations as follows:
Point mutations can also be categorized functionally:



nonsense mutations: code for a stop, which can truncate the protein
missense mutations: code for a different amino acid
silent mutations: code for the same or a different amino acid but without any
functional change in the protein
2. A frameshift mutation is caused by insertion or deletion of a number of nucleotides
that is not evenly divisible by three from a DNA sequence. Due to the triplet nature of
gene expression by codons, the insertion or deletion can disrupt the reading frame, or the
grouping of the codons, resulting in a completely different translation from the original.
The earlier in the sequence the deletion or insertion occurs, the more altered the protein
produced is.
A frameshift mutation causes the reading of codons to be different, so all codons after the
mutation will code for different amino acids. Furthermore, the stop codon ("UAA",
"UGA" or "UAG") will not be read, or a stop codon could be created at an earlier or later
site. The protein being created could be abnormally short, abnormally long, and/or
contain the wrong amino acids. It will most likely not be functional.
3