Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
1 1 Ammonia oxidation and ammonia-oxidizing Bacteria and 2 Archaea from estuaries with differing histories of hypoxia 3 Jane M. Caffrey1, Nasreen Bano2, Karen Kalanetra2, †, James T. Hollibaugh2 4 1 5 11000 University Parkway, Pensacola, FL 32514, USA 2Department of Marine Science, 6 University of Georgia, Athens, GA 30602,USA 7 † 8 95616, USA 9 Supplemental Information Center for Environmental Diagnostics and Bioremediation, University of West Florida, current address: Department of Public Health Sciences, University of California, Davis, CA 10 Methods 11 Sampling design. Nine small sediment cores (4.6 cm ID) were collected at each site. Three 12 cores were sectioned and the surficial 0-0.5 cm layer was used for potential nitrification rate 13 measurements, community composition analysis, and determining porosity. Three cores 14 were used for analysis of extractable NH4+ and were cut into 0-0.5, 0.5-1, 1-2 and 2-4 cm 15 sections. Sediment chlorophyll a concentrations in the 0-0.5 cm layer were measured in 16 separate samples collected at the same time using a cut-off 10 mL syringe. Three cores were 17 sectioned under an N2 atmosphere into 0-1, 1-2 and 2-4 cm layers for porewater sulfide and 18 reactive iron analysis. Values from the top layer are reported in Table 1. 19 20 Potential Nitrification. Six replicates per site were incubated aerobically at room 21 temperature on a shaker table. Approximately 0.5 g wet weight of sediment was added to 22 filtered water from sites amended to a final concentration of 0.5 mM NH4Cl in a total volume 23 of 50 ml (1). After 0.5 and 24 h, 15 mL aliquots were filtered through a GF/F filter and 24 frozen for later NO2- and NO3- + NO2- analysis. Room temperature during individual 2 25 incubations ranged from 20-26 °C, so rates were normalized to 21°C using the Arrhenius 26 equation and assuming Q10=2.0. 27 Sediment characteristics. Extractable NH4+ concentrations were determined by adding 1 M 28 NaCl (10 mL/10 g wet sediment). Porewater sulfide was analyzed using an Ag/AgCl 29 electrode. Sediment chlorophyll samples were extracted in 10 mL of 90% acetone, sonicated 30 and read after 24 h on a Turner Designs™ fluorometer (2). Reactive Fe was measured in 31 sediments following removal of pore waters using a 0.5 N HCl extraction. Ferrozine was used 32 to measure Fe2+, hydroxylamine was used to reduce total iron to Fe2+. Fe3+ was calculated by 33 difference. 34 Nutrient analysis. NO3-, NH4+, and NO2- were analyzed on either a Bran and Lubbe AA3 35 autoanalyzer or a Lachet FIA autoanalyzer (3,4). Sediment extracts from Pensacola Bay 36 Shoal and from Apalachicola Bay Cat Point and Dry Bar sites were analyzed manually for 37 NH4+ (5). 38 Water quality data. Temperature, salinity, DO, pH, turbidity and depth were measured 39 using YSI datasondes at all sites except Pensacola Bay channel. Instrument calibration and 40 data post processing followed National Estuarine Research Reserve System Wide Monitoring 41 Program protocols (6,7) for Apalachicola Bay, Elkhorn Slough, Rookery Bay, Sapelo Island, 42 and Weeks Bay. 43 Real-time quantitative PCR was used to estimate the relative abundance of Bacteria and 44 Archaea amoA and 16S rRNA genes. Immediately following the collection of the samples, 45 DNA was extracted from the top 0.5 cm layer of sediment and used as template for PCR 46 amplifications. All samples were measured in triplicate using an iCycler real-time PCR 47 system (Bio-Rad, Hercules, CA) as described previously (see references, Table 4) and an 48 average value was calculated. Each sample was run for a total of 40 cycles and reactions were 49 performed in a 25 µl volume with 1 µL of DNA template. Bacteria and Archaea 16S rRNA 50 gene abundance was determined using TaqMan primers and probes. AOB and AOA amoA 3 51 gene abundance was quantified using SYBRgreen to measure amplicon production. The 52 primers and probes used in this study are listed in Table 4. TaqMan probes were 5' labeled 53 with FAM as the reporter dye and 3' labeled with TAMRA as the quencher dye. TaqMan 54 reaction mixtures contained 1.25 U Platinum Taq (Invitrogen), 0.25 U Amperase Uracil N- 55 glycosylase (Applied Biosystems, Foster City, CA), 3 mM MgCl, and 200 µM dNTPs with 56 400µM dUTP (Applied Biosystems) with primer and probe concentrations and PCR 57 conditions as described previously (see references, Table 4). SYBRgreen reaction mixtures 58 contained 12.5 µl iQ SYBR®Green Supermix (Bio-Rad) with 500 nM primer concentration 59 and cycling conditions as described by Wuchter et al.(8). The plate read for AOB amoA 60 quantification was carried out at 80ºC to avoid detection of nonspecific products. Product 61 specificity was verified by melt curve analysis and by visualization in agarose gels of bands 62 of the expected size; ca. 500 bp for AOB and 260 bp for AOA. Analysis of the sequences of 63 DNA amplicons from randomly chosen samples further verified the specificity of the Q-PCR 64 quantification. 65 66 Standard curves were generated for each probe and/or primer set with serial dilutions of a 67 standard containing a known number of the target sequences. Bacterial 16S rRNA gene 68 standards used cloned 16S rRNA genes amplified from Escherichia coli K-12 ATCC 25196 69 DNA. Standards for Archaea 16S rRNA and AOB and AOA amoA genes were generated 70 from PCR amplicons cloned from environmental samples as follows. Target sequences were 71 amplified with the same primer sets used for quantification, then purified by agarose gel 72 electrophoresis. The PCR products were extracted with a QIAquick gel extraction kit 73 (Qiagen, Valencia, CA), cloned using a TOPO TA cloning kit with TOP10 chemically 74 competent cells (Invitrogen, Carlsbad, CA), then sequenced to verify specificity. A QIAprep 75 Spin Miniprep kit (Qiagen) was used to extract the plasmids. Linearized plasmids were 4 76 produced from cloned amplicons by digestion with NotI restriction enzyme (Promega, 77 Madison, WI), then run on an agarose gel and extracted with a QIAquick gel extraction kit 78 (Qiagen). DNA concentrations in the extracts were measured fluorometrically by PicoGreen 79 (Molecular Probes, Eugene, OR) staining on a Shimadzu RF5000U spectrofluorophotometer. 80 Gene abundance was calculated based on DNA concentration and plasmid plus insert 81 sequence size. Dilution series ranging from 101 to 107 or 108 copies µl-1 were used for the 82 standard curves. To eliminate any differences in extraction efficiency between environmental 83 samples, we normalized by the 16S rRNA genes for the prokaryotic community in each 84 sample. Relative abundance of amoA genes is expressed by normalizing amoA gene 85 abundance to the number of copies of prokaryotic (Bacteria + Archaea) 16S rRNA genes in 86 each sample. 87 88 Statistics – Data were examined for normality. Potential nitrification, the relative abundance 89 of AOB amoA and AOA amoA were log transformed. A paired t-test was done to compare 90 AOB amoA and AOA amoA abundance. We performed a Pearson correlation analysis using 91 environmental variables (temperature, salinity, bottom water DO, sediment chlorophyll a, 92 extractable NH4+, reactive iron and pore water sulfide), potential nitrification rates, 93 abundances of AOB amoA and AOA amoA. In addition, a multiple regression analysis was 94 conducted examining the effect of salinity, bottom water DO, sediment chlorophyll a and 95 AOA amoA abundance on potential nitrification rates. SYSTAT version 9 was used for 96 statistical analysis. 97 98 References 5 99 1 Henriksen, K., Hansen, J.I., & Blackburn, T.H. Rates of nitrification, distribution of 100 nitrifying bacteria, and nitrate fluxes in different types of sediment from Danish 101 waters. Mar. Biol. 61,299-304 (1981). 102 103 104 2 Welschmeyer, N.A.. Fluorometric analysis of chlorophyll a in the presence of chlorophyll b and pheopigments. Limnol. and Oceanogr. 39, 1985-1992 (1994) 3 Diamond, D.H. Determination of ammonia in brackish or seawater by flow injection 105 analysis colorimetry. QuikChem Method 31-107-06-1-C for Lachat Instruments. 106 Milwaukee, WI. (1997a) 107 4 Diamond, D.H. Determination of nitrate in brackish or seawater by flow injection analysis. 108 QuikChem Method 31-107-04-1-A for Lachat Instruments. Milwaukee, WI. (1997b) 109 5 Holmes, R.M., Aminot, A., Kerouel, R., Hooker, B.A., & Peterson, B.J. A simple and 110 precise method for measuring ammonium in marine and freshwater ecosystems. Can. 111 J. Fish. Aquat Sci. 56,1801–1808 (1999). 112 6 Wenner, E.L., Holland, A.F., Arendt, M.D., Edwards, D., & Caffrey, J.M. A Synthesis of 113 Water Quality Data from the National Estuarine Research Reserve System-Wide 114 Monitoring Program. NOAA Grant NA97OR0209, MRD Contribution No. 459. 115 NOAA. (2001). 116 7 National Oceanic and Atmospheric Administration, Office of Ocean and Coastal Resource 117 Management, National Estuarine Research Reserve System-wide Monitoring 118 Program. Centralized Data Management Office, Baruch Marine Field Lab, University 119 of South Carolina http://cdmo.baruch.sc.edu. (2004). 120 121 8 Wuchter, C., Abbas, B., Coolen, M. J. L., Herfort, L., van Bleijswijk, J. et al. Archaeal nitrification in the ocean. Proc. Natl. Acad. Sci. USA. 103,12317-12322 (2006). 6 122 9 Suzuki, M. T., Taylor, L. T. & DeLong, E. F. Quantitative analysis of small-subunit rRNA 123 genes in mixed microbial populations via 5'-nuclease assays. Appl. Environ. 124 Microbiol. 66, 4605-4614 (2000). 125 10 Rotthauwe, J.-H., Witzel, K.-P. & Liesack, W. The ammonia monooxygenase structural 126 gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia- 127 oxidizing populations. Appl. Environ. Microbiol. 63, 4704-4712 (1997). 128 11 Hornek, R., A. Pommerening-Röser, H.-P. Koops, A. H. Farnleitner, N. Kreuzinger, A. 129 Kirschner, and R. L. Mach. Primers containing universal bases reduce multiple amoA 130 gene specific DGGE band patterns when analyzing the diversity of beta-ammonia 131 oxidizers in the environment. J. Microbiol. Methods. 66:147-155. (2006). 132 7 Table 1 – Location of sampling sites, number of times they were sampled, bottom water salinity, bottom water dissolved oxygen (DO) concentration (mg L-1), sediment chlorophyll a (µg cm-2), extractable NH4+ concentration (nmol cm-3), and porewater sulfide (mM). Mean values and ranges for salinity and DO include data from the week preceding sampling date. Estuary/site Latitude Longitude Number Salinity DO Sediment Extractable Porewater Chlorophyll a NH4+ Sulfide mg L-1 µg cm-2 nmol cm-3 mM 26 2.1 1.9 148 0.1 22-28 0.4-4.1 18 7.6 4.0 1.7 0.2 5.4-24 0.4-9.4 10 5.5 1.1 218 1.6 0-19 0.2-10.9 8 3.6 1.9 158 1.4 of times sampled PB Pensacola Bay, FL Channel 30° 27.40’N 3 87° 7.94’W Shoal 30° 27.53’N 4 87° 06.12’W WKB Weeks Bay, AL Mid Bay 30° 23.90’N 4 87° 49.65’ W Fish River 30° 24.97'N 4 8 87° 49.37'W 0-17 0.0-9.0 26 4.1 9.4-33 1.5-8.6 26 5.3 10.5-29 0.3-9.8 22 4.6 9.4-33 2.5-8.6 9 6.3 3.6-24 1.7-8.9 29 5.5 12.1-28 0.4-6.8 11 4.8 0.3-16 1.5-8.7 SAP Sapelo Island, GA Dean Creek 31° 23.38N 2 81° 16.74W Hunt Camp 31° 28.72'N, 2 81° 16.38'W Marsh Landing 31° 25.07' N, 2 81° 17.77'W 3.5 70.9 0.2 0.6 51.2 0.5 0.9 49.2 0.5 3.4 66.8 0 16.2 12.5 0 1.7 329 0.1 APA Apalachicola Bay, FL Dry Bar 29º 40.48' N, 1 85º 3.50' W Cat Point 2942.12N, 1 8452.81' W East Bay 29º 47.15' N, 84º 52.52' W 1 9 RKB Rookery Bay, FL Fakahatchee Bay 25° 53.53’N 1 81° 28.62’W Blackwater River 25° 56.06’N 1 81° 35.68’W Henderson Creek 26° 1.54’N 1 81° 43.99’W 31 5.2 19-32 3.2-9.9 34 5.5 32-35 3.0-7.6 31 6.1 31-35 4.9-9.9 38 4.6 33-39 0.8-11.4 34 3.4 32-34 1.2-5.3 36 4.7 6.6 43.6 0.1 7.5 66.7 0.1 7.8 114 0.1 28.7 78.7 0 11.3 98.3 0 28.1 104 0.2 ELK Elkhorn Slough, CA Azevedo Pond 36° 50.83'N 1 121° 45.27’W South Marsh 36° 49.08’N 1 121° 44.30’W North Marsh 3650.08’N, 12144.30’W 1 27-38 10 Table 2- Correlation coefficients for AOB and AOA amoA gene abundances normalized to total prokaryote rRNA gene abundance and environmental variables. Pearson correlation coefficients, p values and n are listed. AOB amoA AOA amoA Temperature Salinity Porewater sulfide AOB amoA -0.55 -0.40 0.003 0.04 28 28 0.16 0.51 0.39 0.004 30 30 -0.21 -0.46 0.32 0.02 25 25 1 0.56 0.01 30 AOA amoA 0.56 0.001 30 1 11 Table 3 – Multiple regression coefficients for the relationship between potential nitrification and environmental variables (salinity, DO, sediment chlorophyll a,) and abundance of AOA amoA genes. Standardized coefficients and levels of significance (p values) are listed. Variable Beta Standard significance Coefficient Sediment chlorophyll a 0.89 0.001 Salinity -0.56 0.008 DO -0.48 0.004 AOA amoA abundance 0.32 0.05 12 Table 4 – Primers and probes used for QPCR analysis Target Gene Primer or Name Sequence (5' to 3') Reference Probe Bacteria Archaea Ammonia oxidizing bacteria Ammonia oxidizing archaea 16S rRNA primer BACT1369F CGGTGAATACGTTCYCGG 9 16S rRNA primer PROK1492R CGWTACCTTGTTACGACTT 9 16S rRNA probe Tm1389F CTTGTACACACCGCCCGTC 9 16S rRNA primer ARCH1-1369F CGGTGAATACGTCCCTGC 9 16S rRNA primer ARCH2-1369F CGGTGAATATGCCCCTGC 9 16S rRNA primer PROK1541R AAGGAGGTGATCCRGCCGCA 9 16S rRNA probe Tm1389F CTTGTACACACCGCCCGTC 9 amoA primer amoA-1F GGGGTTTCTACTGGTGGT 10 amoA primer amoAr NEW CCCCTCBGSAAAVCCTTCTTC 11 amoA primer Arch-amoA-for CTGAYTGGGCYTGGACATC 8 amoA primer Arch-amoA-rev TTCTTCTTTGTTGCCCAGTA 8