Download Laboratory Exam I - HCC Learning Web

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Mutation wikipedia , lookup

Replisome wikipedia , lookup

Genomics wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Non-coding DNA wikipedia , lookup

Epigenomics wikipedia , lookup

Molecular cloning wikipedia , lookup

Genomic library wikipedia , lookup

Mutagen wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Y chromosome wikipedia , lookup

Microevolution wikipedia , lookup

DNA vaccination wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

History of genetic engineering wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

DNA supercoil wikipedia , lookup

Primary transcript wikipedia , lookup

Meiosis wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

X-inactivation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Deoxyribozyme wikipedia , lookup

NEDD9 wikipedia , lookup

Ploidy wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Point mutation wikipedia , lookup

Neocentromere wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Karyotype wikipedia , lookup

Polyploid wikipedia , lookup

Chromosome wikipedia , lookup

Transcript
Laboratory Exam II Review
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
What is the difference between xylem and phloem?
What color of the visible light spectrum is the least effective in
photosynthesis (it is not absorbed)?
What is paper chromatography? What is the basis of fractionation
(there are 3 possible answer choices)?
Which pigment acts as the reaction center molecule in photosynthesis?
What is the difference between somatic and gametic cells? What do
mitosis and mitosis have to do with these types of cells?
What are the different phases of the cell cycle? What happens at each
phase?
Understand what an intermediate filament, microtubule and
microfilament are.
What is Recombination (crossing-over) of chromosomes? When does
it take place in the cell cycle?
What is tetraploid, diploid, haploid? What does this have to do with
the cell cycle?
A fruit fly somatic cell has 4 pairs of homologous chromosomes
(chromosome 1, 2, 3 and 4). If there is no recombination, how many
different gametes are possible after meiosis?
Which organelle in the eukaryotic cell contains chromosomal DNA?
What type of bond holds 2 polynucleotide (DNA) strands together?
What are alternate forms of a gene called?
Know how to apply Chargaff’s rules in calculating the percent ratios of
aromatic bases in the DNA of a species.
Understand dependent and independent assortment. What is linkage?
What is the name of the protein responsible for untwisting and
separating the two strands the DNA helix?
What is the X chromosome? The Y chromosome?
What is sex linkage?
In eukaryotes, the process of transcription takes place in what
organelle? Where does translation occur?
If the mRNA sequence is 5’ AUGAAGGCAGGCCUGUUAUGA 3’,
what is the anti-codon sequence of the tRNA encoding amino acid #4?
What is a frame-shift mutation? A substitution mutation?
Know the difference between complete or incomplete dominance.
What is pleiotropy, epistasis, polygenics?
What is the difference between autosomal or sex chromosomes? What
is the sex chromosome in humans?
24. What is euploidy? What is aneupoloidy?
25. Know what Down Syndrome, Kleinfelters Syndrome and Turners
Syndrome are.
26. What are Barr bodies? When are they present in the cell cycle.
27. What is a restriction enzyme? What do they do?
28. What is the charge of DNA when immersed in a basic medium? Why
is the pH so important when performing gel electrophoresis?
29. A tube contains a mixture of DNA fragments of the following sizes:
4500bp, 2100bp, 800bp, 200bp. Which fragment would separate
fastest in an agarose gel subjected to electroporesis?
30. What is the difference between genotype and phenotype?
31. Perform a mono-hybrid and di-hybrid cross (Punnet square). Predict
the outcomes of the progeny (what do they look like)?
32. Be able to complete a human pedigree for sex-linked trait
colorblindness.