Download Breaking the code

Breaking the DNA code
Replication
Define replication (Ch 12 pg 299)______________________________________________________________
__________________________________________________________________________________________
Write out steps of replication (pg 299)
_____________________
__________________________
Step 2 _____________________
__________________________
Step 3 _____________________
__________________________
Step 1
Practice replication! For each of the three DNA sequences below, write the sequence of the
complementary strand of DNA that results after replication.
ACGTAG
Complementary DNA: TGCATC
Ex. DNA strand:
DNA strand #1:
TACCGGATGCCAGATCAAATC
Complementary DNA #1: ____________________________________________________________________
DNA strand #2:
TACGGGGGCGTAACCACAACT
Complementary DNA #2: ____________________________________________________________________
Protein Synthesis
Part A - Transcription
Define transcription (pg. 301)________________________________________________________________
__________________________________________________________________________________________
Write out the steps in Transcription (the first part of protein synthesis). (pg 301, Figure 12-14)
Step 1 ____________________________________________________________________________________
Step 2 ____________________________________________________________________________________
Practice transcription! For each of the DNA sequences below, write the sequence of the mRNA
(messenger RNA) codons that are made during transcription. Look at your notes.
Separate the codons (3 bases). Remember this is where thymine is replaced with uracil.
ACG TAG
mRNA strand (codon): UGC/AUC
ex. DNA strand:
DNA strand #1:
TACCGGATGCCAGATCAAATC
mRNA strand (codons) #1: __________________________________________________________________
DNA strand #2:
TACGGGGGCGTAACCACAACT
mRNA strand (codons) #2: __________________________________________________________________
Part B - Translation
Define translation (pg. 304)__________________________________________________________________
__________________________________________________________________________________________
Write out the steps in translation (second part of protein synthesis). (pg 303-305 Figure 12-18)
Step 1 ____________________________________________________________________________________
Step 2 ____________________________________________________________________________________
Step 3 ____________________________________________________________________________________
Practice translation! For each of the mRNA strand (codon) sequences you have written in Part Atranscription, copy them below and write the sequence of tRNA strand (anticodons) that match it.
Ex. mRNA strand codon (from Part A- transcription):
tRNA strand anticodon:
UGC-AUC
ACG-UAG
mRNA strand (codons) #1: __________________________________________________________________
tRNA strand (anticodons) #1: ________________________________________________________________
mRNA strand (codons) #2: _________________________________________________________________
tRNA strand (anticodons) #2: _______________________________________________________________
Amino acids
tRNA
mRNA
What are the building blocks of proteins? _______________________________________________
Copy the mRNA strand (codons) again that you made in Part A- transcription. Using the chart below, write the
amino acid coded for each mRNA codon. This will form a protein chain.
Ex. mRNA strand (codon) (from Part A- transcription):
UGC-AUC
Chain of amino acids (look on chart below):
Cysteine-Isoleucine
mRNA strand (codons) #1: __________________________________________________________________
Chain of amino acids #1: ____________________________________________________________________
mRNA strand (codons) #2: __________________________________________________________________
Chain of amino acids #2: __________________________________________________________________
mRNA and Amino Acid Chart