• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
DNA metabolism
DNA metabolism

... Recombination - linear sequence of DNA altered by cleavage and rejoining of chromosome (involves RecA protein) Repair of this type sometimes needed to reconstruct replication fork Human breast cancer genes (BRCA1 and BRCA2) produce proteins that interact with the human homolog of RecA, therefore the ...
PCR-technique Applications
PCR-technique Applications

... Use of: -ISRT (in situ reverse transcriptase + FISH - Probe 1 against a specific mRNA molecule - Binding + reverse transcription  complementary DNA-strand produced - DNA synthesis with PCR - a fluorescent dye is added to get probe 2 ...
What is trans-acting factor?
What is trans-acting factor?

... a) A promoter activated by activators bound to an enhancer. b) An insulator is placed between the enhancer and the promoter. When bound by appropriate insulator- binding proteins, activation of the promoter by the enhancer is blocked, ...
Introduction to gel electrophoresis
Introduction to gel electrophoresis

... • The DNA samples are loaded into an agarose gel mold. • The agarose mold is placed into a tank which contains a buffer ...
The Human Genome: Structure and Function of Genes
The Human Genome: Structure and Function of Genes

BOLIVARIAN REPUBLIC OF VENEZUELA
BOLIVARIAN REPUBLIC OF VENEZUELA

... translation machinery for a function that not only does not contribute to the cell but wastes energy as well. Explain in terms of selection and drift why, in spite of the above consideration, the element can rise to fixation in the population. By definition, a selfish gene works only for itself, usi ...
No Slide Title
No Slide Title

... •If the primers sequences only occur once in the genome, these mark single loci. •Because of their frequent size polymorphism, and multiple alleles, these are very useful markers. Can be used in forensic science. ...
More on Genetics
More on Genetics

... Mutations are a source of genetic variation DNA extraction-add chemicals that cause DNA to uncoil from histones and burst out of nucleus ________________________________making changes in the DNA code of an organism _________________________________are used to cut DNA into fragments and gel electroph ...
548480Review_guide_ch_5_answers
548480Review_guide_ch_5_answers

... 1. What are two types of selective breeding, and how do they compare? Inbreeding involves crossing two individuals with identical or similar sets of alleles, and offspring have alleles that are very similar to those of their parents. Hybridization is crossing two genetically different individuals so ...
1 - contentextra
1 - contentextra

... 11 Proteins are synthesized using a two-step process: First, a strand of DNA is used as a template to create an mRNA molecule in a process called transcription. Second, this mRNA molecule with the help of a ribosome, tRNA and amino acids synthesizes the actual protein in a process called translatio ...
1 - contentextra
1 - contentextra

Summary Gene regulatory factors in the evolutionary history of
Summary Gene regulatory factors in the evolutionary history of

... Han Chinese in Beijing (CHB), and Yoruba in Ibadan (YRI). We think this set gathers genes that may have contributed in shaping the phenotypical diversity currently observed in these three human populations, for example by introducing regulatory diversity at population-specific level ...
Development of personalized medicine in Japan
Development of personalized medicine in Japan

... The Japan Public Health Center-based prospective study started in 1990 and collected information from 140,000 people. Blood samples from 60,000 people were also stored. The aim of this study is to develop a policy and strategies against lifestyle related diseases. The National Cancer Research Instit ...
Slide 1
Slide 1

... However, some will be beneficial, and the cell with the new genetic information resulting from the mutation will be able to outperform other cells. This enhanced fitness at the cellular level may increase the survival and reproductive performance of the organism, and in that case the mutation will b ...
Exploring Comprehensive Gene Expression Analysis of
Exploring Comprehensive Gene Expression Analysis of

... La Tullippe et at. used high-throughput gene expression analysis to study prostate cancer metastasis Differentially expressed genes between metastatic and primary tumors were found in: I. Cell Cycle Regulation II. Mitosis III. Signaling IV. DNA Replication Metastatic tumors had higher proliferation ...
SMCarr passport for UPS
SMCarr passport for UPS

DNA Biology
DNA Biology

... where protein synthesis occurs Has sites to bind both mRNA and tRNA ...
Proximal promoter
Proximal promoter

... (Kim, T. K. et al. Widespread transcription at neuronal activityregulated enhancers. Nature 465, 182–187 (2010).) ...
AIM: How do comparative studies help trace evolution?
AIM: How do comparative studies help trace evolution?

... • What do you think comparative anatomy studies? • Study of structural similarities and differences in living things ...
tacaatccgttat g c cactcatgattagagtcgcgg gatt
tacaatccgttat g c cactcatgattagagtcgcgg gatt

... DNA is the molecule of life. It contains genes that provide the code to make proteins that control an organism’s functions. It is shaped like a double helix which allows it to replicate itself. Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a ...
12.3 notes
12.3 notes

week 13_genetic information
week 13_genetic information

... of A site amino acid attacks the carbonyl group of P site a.a. both a.a are attached to the A site tRNA. The uncharged tRNA at P site moves to E site. Next step- translocation- the ribosome moved along mRNA. As the mRNA moves, the next codon enters A site, and the tRNA bearing the ...
dna and its structure
dna and its structure

WS 8 – 3: Translation and Protein Synthesis Name
WS 8 – 3: Translation and Protein Synthesis Name

... DNA is the molecule of life. It contains genes that provide the code to make proteins that control an organism’s functions. It is shaped like a double helix which allows it to replicate itself. Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a ...
Chromosomes, DNA, and Genes
Chromosomes, DNA, and Genes

... Disease-Associated Mutations Alter Protein Function ...
< 1 ... 537 538 539 540 541 542 543 544 545 ... 983 >

Non-coding DNA

  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report