glycan associated protein of Legionella (PpiA)
... chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and 5'CTTGTTGCCTCATAAATAAACTCTC 3' (reverse position 639-615). Oligonucleotide synthesis was ...
... chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and 5'CTTGTTGCCTCATAAATAAACTCTC 3' (reverse position 639-615). Oligonucleotide synthesis was ...
predominant expression of at cell receptor v,6 gene subfamily
... Immunization with the autoantigen myelin basic protein (MBP)' causes experimental allergic encephalomyelitis (EAE) (1), an autoimmune disease mediated by antigen-specific class II-restricted T lymphocytes (1, 2). Recent studies have shown that MBP-specific T cell clones mediate EAE, causing relapsin ...
... Immunization with the autoantigen myelin basic protein (MBP)' causes experimental allergic encephalomyelitis (EAE) (1), an autoimmune disease mediated by antigen-specific class II-restricted T lymphocytes (1, 2). Recent studies have shown that MBP-specific T cell clones mediate EAE, causing relapsin ...
The molecular biology of sex determination and sexual development
... numbers. The blood samples were sexed by Invader assay and a sex assigned to each coded sample. The Invader designation corresponded to the coded samples in 990 cases out of 1000. In the ten remaining cases the original records of morphological sexing were found to be indeterminate. It is concluded ...
... numbers. The blood samples were sexed by Invader assay and a sex assigned to each coded sample. The Invader designation corresponded to the coded samples in 990 cases out of 1000. In the ten remaining cases the original records of morphological sexing were found to be indeterminate. It is concluded ...
An Approximate Approach to DNA Denaturation
... results. As already mentioned the DNA double helix undergoes strand separation melting in which the interbase H-bonds have to be broken. T h e motion of the helix involved in this bond disruption are low frequency collective motion of the entire macromolecule. A detailed theory or description of mel ...
... results. As already mentioned the DNA double helix undergoes strand separation melting in which the interbase H-bonds have to be broken. T h e motion of the helix involved in this bond disruption are low frequency collective motion of the entire macromolecule. A detailed theory or description of mel ...
Gene Duplication, Gene Conversion and the Evolution of
... the duplicates potentially maintains gene function by counteracting stochastic forces of Y chromosome degeneration (Rozen et al. 2003; Charlesworth 2003; Noordam and Repping 2006). The rationale behind this hypothesis is subtle. As with other clonally inherited chromosomes, each evolutionary lineage ...
... the duplicates potentially maintains gene function by counteracting stochastic forces of Y chromosome degeneration (Rozen et al. 2003; Charlesworth 2003; Noordam and Repping 2006). The rationale behind this hypothesis is subtle. As with other clonally inherited chromosomes, each evolutionary lineage ...
Homozygous NOTCH3 null mutation and impaired NOTCH3
... which has abolished Notch3 expression. This is a very interesting and valuable case as majority of CADASIL mutations reported so far have been neomorphic heterozygous mutations and Notch3-/mice have no CADASIL phenotype. The author then went on to determine the expression of an array of so called No ...
... which has abolished Notch3 expression. This is a very interesting and valuable case as majority of CADASIL mutations reported so far have been neomorphic heterozygous mutations and Notch3-/mice have no CADASIL phenotype. The author then went on to determine the expression of an array of so called No ...
Candidate Genetic Risk Factors of Stroke: Results of a Multilocus
... calculation all results obtained in the study. The observed effect sizes were close to 1.0 for all tested SNPs, a result indicating that there were no systematic differences between patients and controls in the genetic background, i.e., through selection bias. Our study was not powered to reach stat ...
... calculation all results obtained in the study. The observed effect sizes were close to 1.0 for all tested SNPs, a result indicating that there were no systematic differences between patients and controls in the genetic background, i.e., through selection bias. Our study was not powered to reach stat ...
Induced point mutations in the phytoene synthase 1 gene cause
... vitamin C, vitamin E and carotenoids. (Friishansen and Mccullough 1962; Fraser et al. 2005; Rao and Rao 2007; Ried and Fakler 2010). Carotenoids are part of the isoprenoid family and the carotenoid pathway starts from the transformation of GGDP to phytoene through the action of the enzyme phytoene s ...
... vitamin C, vitamin E and carotenoids. (Friishansen and Mccullough 1962; Fraser et al. 2005; Rao and Rao 2007; Ried and Fakler 2010). Carotenoids are part of the isoprenoid family and the carotenoid pathway starts from the transformation of GGDP to phytoene through the action of the enzyme phytoene s ...
The landscape of microbial phenotypic traits and associated genes
... occurring gene families are involved in genetic interactions conditional on at least one phenotype, suggesting that epistasis has a major role in shaping microbial gene content. ...
... occurring gene families are involved in genetic interactions conditional on at least one phenotype, suggesting that epistasis has a major role in shaping microbial gene content. ...
Mechanisms of Notch Signaling Potentiating Survival During
... Activation of Canonical Target Genes ...
... Activation of Canonical Target Genes ...
Study of TAS2R38 Genes for Bitter Taste Depending on Heredity of
... The present study was done in humans, based on responses to some bitter compounds.Some show a bimodal distribution that distinguishes two phenotypes, tasters and non-tasters. Phenylthiourea (PTU), is an organosulfur thiourea containing a phenyl ring. The main objective of this study was to determine ...
... The present study was done in humans, based on responses to some bitter compounds.Some show a bimodal distribution that distinguishes two phenotypes, tasters and non-tasters. Phenylthiourea (PTU), is an organosulfur thiourea containing a phenyl ring. The main objective of this study was to determine ...
Lecture 14
... • Advantages of pea plants for genetic study – There are many varieties with distinct heritable features, or characters (such as flower color); character variants (such as purple or white flowers) are called traits – Mating can be controlled – Each flower has sperm-producing organs (stamens) and an ...
... • Advantages of pea plants for genetic study – There are many varieties with distinct heritable features, or characters (such as flower color); character variants (such as purple or white flowers) are called traits – Mating can be controlled – Each flower has sperm-producing organs (stamens) and an ...
Simplified Insertion of Transgenes Onto Balancer Chromosomes via
... ABSTRACT Balancer chromosomes are critical tools for Drosophila genetics. Many useful transgenes are inserted onto balancers using a random and inefficient process. Here we describe balancer chromosomes that can be directly targeted with transgenes of interest via recombinase-mediated cassette exchan ...
... ABSTRACT Balancer chromosomes are critical tools for Drosophila genetics. Many useful transgenes are inserted onto balancers using a random and inefficient process. Here we describe balancer chromosomes that can be directly targeted with transgenes of interest via recombinase-mediated cassette exchan ...
FOXP2: the language gene
... • The chimpanzee and mouse structures were essentially identical and the orangutan showed only a minor change in secondary structure • The human-specific change at position 325 creates a potential target site for phosphorylation by protein kinase C together with a minor change in predicted secondar ...
... • The chimpanzee and mouse structures were essentially identical and the orangutan showed only a minor change in secondary structure • The human-specific change at position 325 creates a potential target site for phosphorylation by protein kinase C together with a minor change in predicted secondar ...
Hereditary non polyposis colorectal cancer in a random sample of
... 1996 and revised in 2000, in which criteria for the identification of colorectal tumors that should be tested for MSI were present (6): those who meet the Amsterdam criteria should be tested for MSI. Cancers which are MSI should be tested by sequencing on germ line mutations. Genetic testing using g ...
... 1996 and revised in 2000, in which criteria for the identification of colorectal tumors that should be tested for MSI were present (6): those who meet the Amsterdam criteria should be tested for MSI. Cancers which are MSI should be tested by sequencing on germ line mutations. Genetic testing using g ...
Molecular regulators of phosphate homeostasis in plants
... overexpression of OsPHR2 results in increased shoot Pi accumulation in transgenic rice (Zhou et al., 2008). Overexpression of OsPHR2 also enhances root elongation and root hair proliferation, which was not observed in Arabidopsis with altered expression of PHR1 (Rubio et al., 2001; Nilsson et al., 2 ...
... overexpression of OsPHR2 results in increased shoot Pi accumulation in transgenic rice (Zhou et al., 2008). Overexpression of OsPHR2 also enhances root elongation and root hair proliferation, which was not observed in Arabidopsis with altered expression of PHR1 (Rubio et al., 2001; Nilsson et al., 2 ...
Transcriptional analysis of the gene for glutamine synthetase II and
... the S. coelicolor Genome Sequencing Project at the Sanger Centre, Hinxton, UK) provides further evidence that S. coelicolor GSI is post-translationally modi®ed by Ntr-like proteins. Fisher and Wray (1989) have shown that glnA is monocistronically transcribed from the same promoter during all phases ...
... the S. coelicolor Genome Sequencing Project at the Sanger Centre, Hinxton, UK) provides further evidence that S. coelicolor GSI is post-translationally modi®ed by Ntr-like proteins. Fisher and Wray (1989) have shown that glnA is monocistronically transcribed from the same promoter during all phases ...
Genetic Diseases - Noadswood Science
... treatment and understanding of this inherited disease. Children born with cystic fibrosis do not have a normal life expectancy, although this is improving all the time. ...
... treatment and understanding of this inherited disease. Children born with cystic fibrosis do not have a normal life expectancy, although this is improving all the time. ...
Somatic MEN1 gene mutation does not contribute
... To determine if MEN1 gene inactivation is also involved in the development of sporadic pituitary adenomas, allelic deletions of chromosome 11q13 and MEN1 gene mutations and polymorphisms were assessed in 35 sporadic tumours of the anterior pituitary (9 prolactin-secreting, 8 GH-secreting, 3 TSH-secr ...
... To determine if MEN1 gene inactivation is also involved in the development of sporadic pituitary adenomas, allelic deletions of chromosome 11q13 and MEN1 gene mutations and polymorphisms were assessed in 35 sporadic tumours of the anterior pituitary (9 prolactin-secreting, 8 GH-secreting, 3 TSH-secr ...
S4 Text.
... imaging for the characterization of GAL4 expression patterns - can be performed singly or in either order. Specific GAL4 enhancer trap strains could be selected for study on the basis of reported expression patterns or mutant phenotypes, as was done here; alternatively, a random collection of such s ...
... imaging for the characterization of GAL4 expression patterns - can be performed singly or in either order. Specific GAL4 enhancer trap strains could be selected for study on the basis of reported expression patterns or mutant phenotypes, as was done here; alternatively, a random collection of such s ...
NIOSH 2013 Pesticide Handler Personal Protective Technology Stakeholders Meeting
... populations distinct from other populations for cancer, respiratory disease, neurological symptoms and injury patterns and others conditions. ...
... populations distinct from other populations for cancer, respiratory disease, neurological symptoms and injury patterns and others conditions. ...
Microbiology
... prepared from strain NM522, due to restriction of the unmodified DNA prepared from strain NM522. By contrast, equal transformation efficiencies of both modified and unmodified DNA were obtained in the isolates derived from the two successive P1 transductions, indicating co-transduction of the hsdR m ...
... prepared from strain NM522, due to restriction of the unmodified DNA prepared from strain NM522. By contrast, equal transformation efficiencies of both modified and unmodified DNA were obtained in the isolates derived from the two successive P1 transductions, indicating co-transduction of the hsdR m ...
Plxdc2 Is a Mitogen for Neural Progenitors Suzanne F. C. Miller-Delaney
... been identified, including members of the bone morphogenetic protein (BMP), fibroblast growth factor (Fgf), insulin-like growth factor (Igf) and Wnt families as well as Sonic Hedgehog (Shh). The midbrain-hindbrain boundary (MHB), which expresses Wnt1 and Fgf8, is one of several local signalling cent ...
... been identified, including members of the bone morphogenetic protein (BMP), fibroblast growth factor (Fgf), insulin-like growth factor (Igf) and Wnt families as well as Sonic Hedgehog (Shh). The midbrain-hindbrain boundary (MHB), which expresses Wnt1 and Fgf8, is one of several local signalling cent ...