• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Populus endobetamannanase PtrMAN6 plays a role in coordinating
Populus endobetamannanase PtrMAN6 plays a role in coordinating

... compared with the untreated controls (Figure 4d). These results suggest that N-glycosylation of PtrMAN6 is required for its enzymatic activities in Populus. Furthermore, when analyzed by SDS-PAGE and immunoblot under reducing conditions, PtrMAN6 proteins migrated as monomeric proteins (Figure S2a). ...
rumex l. species induce apoptosis in 1301, eol-1 and h
rumex l. species induce apoptosis in 1301, eol-1 and h

... MAGDALENA WEGIERA, HELENA D. SMOLARZ* and ANNA BOGUCKA-KOCKA Chair and Department of Pharmaceutical Botany, Medical University, Chodüki 1, 20-093 Lublin, Poland ...
The D-Type Alfalfa Cyclin Gene cycMs4 Complements
The D-Type Alfalfa Cyclin Gene cycMs4 Complements

The nucleolar structure and nucleolar proteins as indicators of cell
The nucleolar structure and nucleolar proteins as indicators of cell

... mammals and yeast (Guiltinan et al. 1988, Cerdido and Medina 1995). Studies on the fibrillarin gene after its molecular cloning in Arabidopsis, have demonstrated that its expression is regulated by hormones, such as abscisic acid, and it is also modulated by aging (Pih et al. 2000). The levels of fi ...
Mechanistic investigation into the actions of taurine on beta cells
Mechanistic investigation into the actions of taurine on beta cells

Gene transcription is coordinated with, but not dependent on, cell
Gene transcription is coordinated with, but not dependent on, cell

... slowing, but maintaining, their relative timings, suggesting that cell division may directly control transcription. However, using mutants with specific defects in cell cycle pathways that lead to abnormal lineages, we found that the order between cell divisions and expression onset can switch, show ...
Nuclear Localization of the Parafibromin Tumor Suppressor Protein
Nuclear Localization of the Parafibromin Tumor Suppressor Protein

... FIGURE 2. Mapping of the functional NLS on human parafibromin by deletion mutational analysis. A. Schematic diagrams of the wild-type GFP-tagged HRPT2 and 10 deletion constructs assessed for NLS function. NH2 or COOH terminus of each fragment, with numbers referring to the positions in wild-type un- ...
Project Details - School of Biomedical Sciences
Project Details - School of Biomedical Sciences

... amount of taurine has long been known to be localized in the pancreas and has recently been shown to influence the secretion of insulin [3-5]. Several reports also postulate that taurine may exhibit antidiabetic activity perhaps through promoting beta cell defense and enhanced islet function [6-8]. ...
Cell division in the green microalga Marvania
Cell division in the green microalga Marvania

... On the basis of the present observations bined with information obtained the division cycle of this ...
Apyrase Suppression Raises Extracellular ATP
Apyrase Suppression Raises Extracellular ATP

... Plant cells release ATP into their extracellular matrix as they grow, and extracellular ATP (eATP) can modulate the rate of cell growth in diverse tissues. Two closely related apyrases (APYs) in Arabidopsis (Arabidopsis thaliana), APY1 and APY2, function, in part, to control the concentration of eAT ...
Science and Nature Series Cells
Science and Nature Series Cells

... members functioning within the community as that of the cellular community. 2. You must first create a draft that details the layout of both your plant and animal cell. You can use any of the materials specified by your teacher. Please include a list of materials and procedures that you will undergo ...
final-hGH
final-hGH

... called Insulin-like Growth Factors – IGFs.  The actions of hGH are mediated mainly through IGF-1, the effects of which are to stimulate growth in bone, protein synthesis in muscle and lipolysis of fat. ...
Activation of Src Kinases p53/56@ and p59hckby @ in Myeloid Cells`
Activation of Src Kinases p53/56@ and p59hckby @ in Myeloid Cells`

... protein of Mr 210,000, p2lØbcr/abt, which, in contrast to its normal counterpart p145c@abt is located in the cytoplasm and has a high, constitutive tyrosine kinase activity (3). It is thought that the p2l0bcr/abl @naseacts, at least in part, through the (constitutive) phosphorylation and stimulatio ...
Phosphotyrosine dependent proteinprotein interaction network
Phosphotyrosine dependent proteinprotein interaction network

... central role in tyrosine kinase signaling pathways critical for cellular growth (Schlessinger & Lemmon, 2003; Liu et al, 2006). SH2 domains canonically recognize protein tyrosine phosphorylation. There are several subgroups of PTB domains, some of which function in phospho-tyrosine recognition, whil ...
Developmental control of a G1-S transcriptional program in Drosophila
Developmental control of a G1-S transcriptional program in Drosophila

... (5′) and 5′CGTCTAGATTATGTCTCGTTGTCCTCGATCTT3′ (3′). DNA POLα probe sequences encompassing 900 bp of exon 2 (Hirose et al., 1991) were obtained using the primers 5′CGTCTAGAGGTTATGCAGAAGATCTTCGG3′ (5′) and 5′GCGAATTCTACTGGATCCTCATAGGCCTC3′ (3′). EcoRI + XbaI-digested PCNA and POLα PCR products were cl ...
ID helix-loop-helix proteins - Journal of Cell Science
ID helix-loop-helix proteins - Journal of Cell Science

... in the cell-mediated immune response. Id3−/− mice exhibit defective positive selection of both MHC-class-I- and MHC-class-II-restricted thymocytes (Rivera et al., 2000). Furthermore, enforced expression of Id3 in committed thymocyte progenitors inhibits commitment to and production of the αβ subset ...
- Wiley Online Library
- Wiley Online Library

... Cultivation in the BioLector The BioLector Basic Microcultivation system (m2p labs) enables a direct comparison of optical cell density (OD) and green fluorescence (GFP) in up to 48 different cultures. Hence, the BioLector allows a direct assessment of the GFP signal of reassembled splGFP for the dif ...
Pancreatic Beta Cell Lines and their Applications in Diabetes
Pancreatic Beta Cell Lines and their Applications in Diabetes

Coordination between Cell Growth and Cell Cycle Transit in Animal
Coordination between Cell Growth and Cell Cycle Transit in Animal

... cells, which make the "yes or no" decision in G~-pm about whether to continue through the cell cycle or not, have the capacity to decide, in Gl-ps, "when" they will enter the S phase. The differences in the kinetics between these two transitions (Gl-pm/Gl-ps vs. Gl-ps/ S) suggest the involvement of ...
SPIRAL1 Encodes a Plant-Specific Microtubule
SPIRAL1 Encodes a Plant-Specific Microtubule

... SPR1 Protein Is Colocalized with Cortical MTs Because SPR1 protein sequence analysis did not provide information on likely functions, we sought to determine where the SPR1 protein is localized in Arabidopsis cells. To this end, we created transgenic plants that expressed a SPR1:GFP fusion protein un ...
Redox Homeostasis and Antioxidant Signaling: A
Redox Homeostasis and Antioxidant Signaling: A

... yeast yAP-1 transcription factors are activated through protein thiol oxidation by peroxides (Bauer et al., 1999; Delauney et al., 2002). Similarly, mammalian heat shock factor 1, which is a key player in the response to H2O2 and other stresses, is activated by oligomerization driven by oxidant-indu ...
ERVK Polyprotein Processing and Reverse Transcriptase
ERVK Polyprotein Processing and Reverse Transcriptase

... versus Figure 1, respectively), and may represent cell-type specific post-translational modification of RT [40]. For example, HIV RT is phosphorylated at several sites [51], suggesting that our data also may depict several phosphorylated forms of ERVK RT. The cell-type specific differences in RT iso ...
Inside the Crawling T Cell - The Journal of Immunology
Inside the Crawling T Cell - The Journal of Immunology

... to the reporter system based on the induction of cell locomotion, as potentially more closely related to physiological phenomena taking place, for instance, at the stage of cell extravasation. In the present study, we used the model described earlier (5) in which cells of the human T lymphoma line H ...
Preface The plant cell cycle in context
Preface The plant cell cycle in context

... The first few years of molecular cloning studies of the plant cell cycle thus identified many of the plant cell cycle regulators through DNA homology or conserved function, a process completed when the Arabidopsis genome sequence became available. The use of these approaches tended to emphasize cons ...
Bacterial Cell Morphogenesis Does Not Require a Preexisting
Bacterial Cell Morphogenesis Does Not Require a Preexisting

... In our previous work, we identified an 18 kbp deletion that enables stable proliferation of L-forms [8]. This deletion removed the murC gene, which encodes an essential enzyme in the PG precursor pathway, together with 17 other coding regions of mainly unknown function. (We assume that one or more o ...
< 1 ... 71 72 73 74 75 76 77 78 79 ... 206 >

SULF1

Sulfatase 1, also known as SULF1, is an enzyme which in humans is encoded by the SULF1 gene.Heparan sulfate proteoglycans (HSPGs) act as co-receptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endo-sulfatases, such as SULF1, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report