HiPer® Protein Estimation Teaching Kit (Qualitative)
... To 1 ml of each standard and protein sample, add 1 ml of concentrated Nitric acid and boil for1 minute and allow it to cool to room temperature. To the above solution add few drops (0.2 ml) of 1 M NaOH. ...
... To 1 ml of each standard and protein sample, add 1 ml of concentrated Nitric acid and boil for1 minute and allow it to cool to room temperature. To the above solution add few drops (0.2 ml) of 1 M NaOH. ...
Case Study #1 Use of bioinformatics in drug development
... – Ehrlichia chaffeensis,Human monocytic ahrlichiosis(HME)-United States – Ehrlichia phagocytophilia,Human Granulocytic ehrlichis(HGE)-United States ...
... – Ehrlichia chaffeensis,Human monocytic ahrlichiosis(HME)-United States – Ehrlichia phagocytophilia,Human Granulocytic ehrlichis(HGE)-United States ...
protein
... ULs apply to chronic daily use. For some nutrients, there may be insufficient data on which to develop a UL. ...
... ULs apply to chronic daily use. For some nutrients, there may be insufficient data on which to develop a UL. ...
Chapter 14: Carbohydrates
... A single protein molecule contains hundreds or even thousands of amino acid units. An animal body has tens thousands of different proteins ...
... A single protein molecule contains hundreds or even thousands of amino acid units. An animal body has tens thousands of different proteins ...
The 14-3-3 proteins in regulation of cellular metabolism - BORA
... binding partners (possibly >500) associated with most cellular processes [1–8]. Although the associations with many of these binding partners have not been completely verified yet, these proteomic and interactomic studies clearly illustrate the diverse biological functions associated with this protei ...
... binding partners (possibly >500) associated with most cellular processes [1–8]. Although the associations with many of these binding partners have not been completely verified yet, these proteomic and interactomic studies clearly illustrate the diverse biological functions associated with this protei ...
(GRP78) gene in silkworm Bombyx mori
... and Homo sapiens (80.27%). RT-PCR analysis shows that Bmgrp78 is ubiquitously expressed in tissues of silkworm. Heat shock over 35 ◦C notably enhanced the expression of Bmgrp78 in head tissues. In response to starvation, the transcript level of Bmgrp78 in head tissues was 2.8-fold (at WS stage) and ...
... and Homo sapiens (80.27%). RT-PCR analysis shows that Bmgrp78 is ubiquitously expressed in tissues of silkworm. Heat shock over 35 ◦C notably enhanced the expression of Bmgrp78 in head tissues. In response to starvation, the transcript level of Bmgrp78 in head tissues was 2.8-fold (at WS stage) and ...
Bioinorganic Chemistry of Metal
... Hemeproteins are a typical metalloprotein, which show a variety of functions including oxygen storage/transport, elec tron transfer, redox catalysis with various substrates. Besides these traditional functions of hemeproteins, a new function of hemeprotein has been found recently, which is a sensor ...
... Hemeproteins are a typical metalloprotein, which show a variety of functions including oxygen storage/transport, elec tron transfer, redox catalysis with various substrates. Besides these traditional functions of hemeproteins, a new function of hemeprotein has been found recently, which is a sensor ...
High-School Football Athletes: A Proper Nutrition Guide
... muscle. Therefore, the regulation of intramuscular glutamine has significant effects on skeletal muscle metabolism. The loss of muscle glutamine may be a signal for muscle degradation, so it is essential that intra-muscular glutamine stores are maintained. Prolonged, exhaustive exercise can decrease ...
... muscle. Therefore, the regulation of intramuscular glutamine has significant effects on skeletal muscle metabolism. The loss of muscle glutamine may be a signal for muscle degradation, so it is essential that intra-muscular glutamine stores are maintained. Prolonged, exhaustive exercise can decrease ...
Noncovalently Associated Complexes: Apomyoglobin and
... In general, picomoles or less of a protein complex are required for analysis by ESI/MS and analysis times using infusion for sample introduction are only a few minutes. The low-energy ESI process is well suited to study protein complexes because in many cases the energy associated with the ionic int ...
... In general, picomoles or less of a protein complex are required for analysis by ESI/MS and analysis times using infusion for sample introduction are only a few minutes. The low-energy ESI process is well suited to study protein complexes because in many cases the energy associated with the ionic int ...
Machine Learning Designs for Artificial Histone Acetyltransferases
... different concentrations of H3p19 (1.2 mM, 0.6 mM, 0.3 mM. 0.15 mM, and 0.075 mM). The Line-Weaver Burke equation generated from the fluorescent assay was used to calculate Vmax, Kcat, and Km. Based on the data (Figure 8 A, B, C and Table 3), A121T appeared to have the highest turnover and specific ...
... different concentrations of H3p19 (1.2 mM, 0.6 mM, 0.3 mM. 0.15 mM, and 0.075 mM). The Line-Weaver Burke equation generated from the fluorescent assay was used to calculate Vmax, Kcat, and Km. Based on the data (Figure 8 A, B, C and Table 3), A121T appeared to have the highest turnover and specific ...
Chemistry-Biology Interface Symposium Frontiers at the
... have developed and introduced novel methodologies for MFA based on tandem MS and stable-isotope labeling experiments. We demonstrate that tandem MS provides more labeling information than can be obtained from traditional full scan MS analysis and allows estimation of fluxes with much higher precisio ...
... have developed and introduced novel methodologies for MFA based on tandem MS and stable-isotope labeling experiments. We demonstrate that tandem MS provides more labeling information than can be obtained from traditional full scan MS analysis and allows estimation of fluxes with much higher precisio ...
Awan, Ali: In Silico Transfer of Ligand Binding Function between Structurally Analogous Proteins
... To ascertain the stability of a hybrid protein, the amino acid sequence is entered into an energy minimisation and protein folding program for engineered sequences, such as genome@home. This scores the stability of the protein, allowing the ranking of different hybrids in terms of stability. To eval ...
... To ascertain the stability of a hybrid protein, the amino acid sequence is entered into an energy minimisation and protein folding program for engineered sequences, such as genome@home. This scores the stability of the protein, allowing the ranking of different hybrids in terms of stability. To eval ...
Protein - UML Computer Science
... families are grouped by 3D structure or function (as in Pfam) Start with sequences matched by an initial search, iteratively pull in more remote homologues More sensitivity than simple sequence comparison because profiles implicitly contain information on which residues within the family are wel ...
... families are grouped by 3D structure or function (as in Pfam) Start with sequences matched by an initial search, iteratively pull in more remote homologues More sensitivity than simple sequence comparison because profiles implicitly contain information on which residues within the family are wel ...
Overview: The Molecules of Life
... Note that all amino acids have carboxyl and amino groups. The terms acidic and basic in this context refer only to these groups in the R groups. Amino acids are joined together when a dehydration reaction removes a hydroxyl group from the carboxyl end of one amino acid and a hydrogen from the amino ...
... Note that all amino acids have carboxyl and amino groups. The terms acidic and basic in this context refer only to these groups in the R groups. Amino acids are joined together when a dehydration reaction removes a hydroxyl group from the carboxyl end of one amino acid and a hydrogen from the amino ...
Slide 1
... The dataset for the algorithm for binding site prediction and extraction : 90 HIV protease protein (21 wild type, and 69 mutated) PDBs The descriptors such as volume, dipole moment, moment of inertia, quadruple moment, hydrophobicity, residue interface propensity, integral of properties, and, Betti ...
... The dataset for the algorithm for binding site prediction and extraction : 90 HIV protease protein (21 wild type, and 69 mutated) PDBs The descriptors such as volume, dipole moment, moment of inertia, quadruple moment, hydrophobicity, residue interface propensity, integral of properties, and, Betti ...
Protein structure prediction
... • User provides a query sequence with unknown structure • Search the PDB for proteins with similar sequence and known structure. Pick the best match (the template). • Build a model based on that template – One can also build a model based on multiple templates, where different templates are used for ...
... • User provides a query sequence with unknown structure • Search the PDB for proteins with similar sequence and known structure. Pick the best match (the template). • Build a model based on that template – One can also build a model based on multiple templates, where different templates are used for ...
Proteins
... Amino acids There are 20 different types of Amino Acids. What makes them different? ...
... Amino acids There are 20 different types of Amino Acids. What makes them different? ...
Metabolic Adaptation and Protein Complexes in Prokaryotes
... known and profiting from its compact genome, Kühner et al. [4] used tandem affinity purification-mass spectrometry (TAP-MS) on the small Gram-positive bacterium M. pneumoniae. This revealed 62 homomultimeric and 116 heteromultimeric soluble protein complexes which are partly conserved across bacteri ...
... known and profiting from its compact genome, Kühner et al. [4] used tandem affinity purification-mass spectrometry (TAP-MS) on the small Gram-positive bacterium M. pneumoniae. This revealed 62 homomultimeric and 116 heteromultimeric soluble protein complexes which are partly conserved across bacteri ...
Subunit Isoform of X,K-ATPase in Human Skeletal Muscle
... lacking exon 3 (hereafter called C), respectively (Fig. 1). To restore the complete reading frame, product of primers VEKO1 (cttkgcccactgaacagccatgag) and BS1 (ggcgaagggtctgatcataac) (corresponding to Met1- Ala160) was cloned as above and the PstI-BamHI cassette from this construct was introduced in ...
... lacking exon 3 (hereafter called C), respectively (Fig. 1). To restore the complete reading frame, product of primers VEKO1 (cttkgcccactgaacagccatgag) and BS1 (ggcgaagggtctgatcataac) (corresponding to Met1- Ala160) was cloned as above and the PstI-BamHI cassette from this construct was introduced in ...
Interactome
In molecular biology, an interactome is the whole set of molecular interactions in a particular cell. The term specifically refers to physical interactions among molecules (such as those among proteins, also known as protein-protein interactions) but can also describe sets of indirect interactions among genes (genetic interactions). Mathematically, interactomes are generally displayed as graphs.The word ""interactome"" was originally coined in 1999 by a group of French scientists headed by Bernard Jacq. Though interactomes may be described as biological networks, they should not be confused with other networks such as neural networks or food webs.