Download Shark Fin Forensics

Name ___________________________________ Class _______ Date ______________
Shark Fin Forensics
Use modern molecular biology lab techniques
to determine if great white sharks are being
fished illegally in nearby waters.
Lab Benches Used
Molecular biology techniques such as DNA sequencing are important tools for
enforcing laws that protect threatened or endangered species. Just as human tissue
collected at a crime scene can yield DNA profiles that can be used to identify victims
and suspects, unidentifiable animal tissues such as dried shark fins, powdered bone
and teeth of mammals, and dried internal organs can be analyzed to determine if they
were taken from protected species or even a certain population of a species.
In this virtual lab activity you will act as a wildlife forensic specialist. You will
use DNA sequencing to determine if the great white shark is being illegally hunted
and traded.
Enter the Virtual Bio Lab and select the title of this lab activity from the “DNA”
menu on the whiteboard. You will be taken to the virtual Molecular lab bench.
The Case
Inspectors have notified you that some large unidentified shark fins have been seized
from a local fishing boat. Some of the larger fins may be from great white sharks,
which are protected by federal and state laws in the region. However, the dried fins
are too discolored and misshapen for the fisheries inspectors to positively identify as
great white shark fins. So, they have sent you tissue samples from the five dorsal fins
that are large enough to be from great whites.
Part A: DNA Preparation and PCR
Do any of the samples match the great white DNA that you have in your lab? Use the
following procedure to find out.
 Assemble samples of DNA from unidentified fins. Go to the clipboard on the
right side of the lab bench and click on it to open the list of presets. Select the
preset called “Unknown Shark Fin Samples." In the tube rack you will now see
five unidentified shark fin DNA samples that are loaded into microcentrifuge
tubes. Roll over the tubes to read their labels.
 Prepare standard sample of great white shark DNA. Drag an empty tube from
the tube jar to the rack and label it "Great White Shark DNA." (Mouse over the
tube and then click on the blank space in the tube rack. Type in the label name
and hit “enter.”) With the great white shark selected in the Species Selector, click
on the pipette icon that’s below the species list. The “DNA Samples” door will
open. You now have a pipette loaded with great white DNA. Next, load this
sample into the microcentrifuge tube you just labeled. To do this, drag the pipette
over the tube until it straightens up. Click on the pipette and it will lean to the
right, indicating that the sample has been inserted into the tube. On the next page
is an image showing the three positions of the pipette and what they indicate:
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
1
DNA: Shark Fin Forensics
Name ___________________________________ Class _______ Date ______________
You can also lift the tube to see that it now contains a translucent blue fluid.
 Add PCR reagents. Target the 12S gene as a sequence to compare between your
standard great white sample and the unidentified samples. (The 12S gene codes
for mitochondrial rRNA and is commonly used as a point of comparison between
different species' DNA.) To do this, you must add primers and reagents to the
unknown shark fin DNA samples as well as your great white DNA sample. First,
use the pipette to load “Taq” and insert it into each tube. (You can pick up the
pipette from the bench and then click on the Taq jar to generate a pipette loaded
with enough Taq for one tube, or you can just click on the jar with the cursor and
you'll get a loaded pipette). Be sure to load Taq into each of your six tubes. Next,
do the same with “dNTPs tag.” Make sure you reload the pipette before adding a
given reagent to the next tube.
 Add primers. Open the primer selector by clicking on the projector that's just
behind the tube rack. You will need to select two specific primers—one right and
one left—to snip the 12S gene from each shark DNA sample.
Left primer
ttaaggtttggtcctggc
Right primer
attccaagtgcactttccagtac
Select a primer and then click on the pipette icon. (Note: If a primer doesn't appear
in the virtual primer list, you can type or paste it in manually. Once entered, click
"Add" to put it at the top of the list where it can then be selected.) You'll now
have a pipette loaded with that specific primer. Insert the primer into the first
tube. Reload your pipette with the same primer by clicking the tip of the pipette
onto the pipette icon below the primer list. Add it to the next tube. Repeat this
process until each tube has received both primers. If you fail to add both the left
anr right primer to each sample, you will not be able to isolate or amplify the gene
you will be comparing across these species.
 Run PCR. Your primed DNA samples are now ready for the PCR machine. Drag
the tubes to the empty slots in the machine. Close the lid and click the green
arrow to start the polymerase chain reaction (PCR), which will amplify the 12S
gene so that you have lots of copies to work with. Because PCR takes over three
hours, use the arrows on the main clock to advance time by just over three hours
until the machine’s display reads "complete." Open the PCR machine lid and drag
each tube back to the main tube rack.
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
2
DNA: Shark Fin Forensics
Name ___________________________________ Class _______ Date ______________
Part B: Sequencing
Now that you have isolated the 12S genes and amplified them, you can use the
sequencer to spell out the nucleotide sequence of those genes.
 Sequence each sample. Start with the great white shark DNA standard and then
sequence the unidentified shark fin DNA samples. To sequence a sample, move
the tube to the sequencer and close the drawer. The sequencer controls will be
projected once a tube is loaded. Click "Start" to begin sequencing that sample's
12S gene. Again, this process takes a while, so use the clock to advance time until
sequencing is complete. You can label each sequence as it is being produced. Do
this by clicking on the sequence to highlight it and then clicking in the field
reading “Enter sequence name here…” Type in the name of the sequence, such as
“Fin #1 12S Sequence.”
 Save each sequence. Click on a sequence in the sequencer display to highlight it.
Click on the "Save" button. The titled sequence will now be saved to your virtual
lab book. Be sure to do this for each sample.
Part C: Analysis
Now you can turn to the virtual lab book and compare the 12S sequences of the five
unidentified shark fin DNA samples with the 12S sequence of your great white shark
DNA sample. Use the following steps to organize and compare the sequences.
 Organize the sequences in one place. In the lab book you can compare your
standard great white 12S sequence with the 12S sequences from the five shark
fins. To do this, open the first unknown sequence (click on the ATCG icon), click
on the sequence to highlight it, then right-click and select "copy data." Now, open
the great white sequence, click in the empty white space below the sequence, and
then right-click (or ctrl-click) "paste" to paste the other sequence below the great
white's sequence. Repeat this process with the other four unknown fins’ 12S
sequences until all five unknown sequences are pasted into the same page as the
great white 12S sequence.
 Compare sequences. Compare each of the five unidentified sequences with the
great white standard. To do this, click on the great white sequence until it is
highlighted in yellow, hold down the control (or command) button, and select
another sequence. Then click on the "Differences" button. Nucleotides that don’t
match between them will be highlighted in gray on one of them. If there are any
differences, this suggests that the great white’s DNA is not a match with that
given unknown fin’s DNA, and that the fin the DNA sample came from did not
belong to a great white. Such a non-matching fin might have belonged to a closely
related shark such as a mako or porbeagle, or it might have belonged to another
large shark that’s more distantly related.
1. Do any of the five unidentified shark fin samples appear to have come from a great
white shark? Explain your answer.
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
3
DNA: Shark Fin Forensics
Name ___________________________________ Class _______ Date ______________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
Part D: Conclusions
Suppose the fishermen who were in possession of the shark fins claim that they
didn’t realize that some of the sharks they had caught and killed were great whites, a
protected species. Exit the Molecular lab bench and head to the Systematics lab
bench on the left side of the lab room. Once inside, select the "Great White Shark
Lineage" preset from the clipboard. Roll over the lower taxa in the great white’s
lineage and read the description in the Species Selector to learn about this shark’s
characteristics.
2. How likely is it that the great white is difficult for fishermen to identify? Explain.
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
3. Summarize the case against the fishermen as though you were preparing to testify in their trial.
Be sure to cite the DNA analysis that you performed.
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
Copyright © Pearson Education, Inc., or its affiliates. All Rights Reserved.
Virtual Bio Lab
4
DNA: Shark Fin Forensics