Download genetics i - Indian School Al Wadi Al Kabir

INDIAN SCHOOL AL WADI AL KABIR
DEPARTMENT OF SCIENCE
WS: 5
Date: 21/05/16
BIOLOGY
GENETICS-2
1. List the salient features of double helix structure of DNA.
2. (a) In the eukaryotes the DNA molecules are organized within the nucleus. How is the
DNA molecule organized in a bacterial cell in absence of a nucleus?
(b) Explain the packaging of DNA in eukaryotes.
3. Why is DNA considered a better hereditary material than RNA?
4. Answer the following based on Messelson and Stahl’s experiment
a) Write the name of the chemical substance used as a source of nitrogen in this
experiment
b) Why did they synthesize the light heavy DNA molecules in their experiment?
c) How did the scientists make it possible to distinguish the heavy from light? Explain
d) Write the conclusion the scientists arrived after completing the experiment
5. In a series of experiments with Streptococcus and mice, F. Griffith concluded that R- strain
bacteria had been transformed. Explain.
6. Draw a schematic representation of a dinucleotide. Label the following:
i) The components of a nucleotide
ii) 5’ end
iii) N- glycosidic linkage
iv) Phosphodiester linkage
Page 1/2
7.
(a) How many codons code for amino acids and how many do not?
(b) Explain the following with example
Unambiguous and specific codon
Degenerate codon
Universal
Initiator codon
8. Describe the structure of a RNA polynucleotide chain having four different types of
nucleotides.
9. How is hnRNA processed to form mRNA?
10. Explain the process of transcription in a bacterium.
11. (a) Name the enzyme that catalyzes the transcription of hnRNA.
(b) Why does the hnRNA need to undergo changes? List the changes hnRNA undergoes and
where in the cell such changes take place?
12. Name the different components present in deoxy-ribose nucleoside triphosphates. Give its
two roles.
13.Correlate the codons of mRNA with amino acids of polypeptide translated.
5'AUGACCUUUCACUUCGUGUAA 3’------m RNA
MET-THR-PHE-HIS-PHE-VAL------- polypeptide
Infer any 3 properties of genetic code with examples from the above information
14. i) Why does DNA replication occur in small replication occur in small replication forks and
not in its entire length?
ii) Why is DNA replication continuous and discontinuous in a replication fork?
iii) Explain the importance of ‘origin of replication’ in a fork?
15. (a) Draw a schematic representation of transcription unit showing the polarity of both the
strands. Label the promoter gene and the template strand
(b) Mention the condition when template strand becomes coding strand.
(c) Give the function of the promoter gene
Page 2/2
Prepared by,
Rejitha Sajith