Download qPCR performed on all samples - York College of Pennsylvania

Expression of THRA Over the Course of Retinal Development in Chicken (Gallus gallus) Embryos and
the Impacts of Thyroid Hormone on THRA Expression
Hailey Long and Sean Georgi, Ph.D., Department of Biology, York College of Pennsylvania
Results:
-All stages across the timespan mean ΔCT values were
statistically the same following an
ANOVA((F1.071)=0.8959, P=0.4234)
-Removal from thyroid hormone did not have a
significant difference at stage 35 (P=0.5377, df=2)
following a paired t-test
Introduction:
Retinas are an important part of the eye, as they take
light and transduce it as neural signals to be interpreted
by the brain. The retina is made up of seven different
types of cells. These cells consistently develop in the
same order, beginning with Ganglion cells and ending
with Muller Glia (Wallace, 2011). While the function and
timing of retinal development is well-known, the
underlying molecular mechanisms are still being
discovered and researched.
Li
THRA codes for thyroid hormone receptor A. Thyroid
hormone is created in the thyroid and aids in the control
of metabolism, heart rate and many other necessary
bodily functions. In previous research done by Mader
and Cameron (2006), it was found that THRA in flounder
retinas was thyroid hormone dependent.
Methods:
Across Timespan:
-Designed primers using NCBI and UCSC databases
-Forward-5’ AGCCACTGGAAGCAGAAGAG 3’
-Reverse-5’ CGGCGTGATGATTTTTGTAA 3’
-Dissected retinas from chicken embryos at stages 23/25,
27,29, 31, 33, and 35 (n=3 per stage)
0
M ean  C T
In previous research, performed by La Torre et al (2013),
a Dicer knockout was performed, and suggest that THRA
is involved in late stages of chicken retinal development.
However, exact timing and role was not yet investigated.
Table 1. Means of cycle thresholds and calculated ΔCT
-5
-1 0
-1 5
2 3 /2 5
27
29
31
33
35
S t a g e s /C o n t r o l T y p e
-Investigate if expression levels of THRA in chicken
embryos are altered when retinas are removed from the
presence of thyroid hormone
F ig u r e 1 . E x p r e s s io n o f T H R A a c r o s s t im e o f r e t in a l d e v e lo p m e n t . M e a n
o f s ta g e s 2 3 /2 5 , 2 7 , 2 9 , 3 1 , 3 3 , a n d 3 5 ( n = 3 ) c o m p a r e d to  C T ( c y c le
t h r e s h o ld ) .  C T w a s c a lc u la t e d b y s u b t r a c t in g T H R A v a lu e f r o m G A P D H
v a lu e , a s d e t e r m in e d b y q P C R m a c h in e . M e a n s w e r e c o m p a r e d u s in g
-RNA isolated with Trizol and used as template to make
cDNA
-PCR/gel electrophoresis ran to determine optimal
annealing temperature
-PCR/gel electrophoresis ran to ensure proper function of
primers (all stages)
-qPCR performed on all stages for GAPDH and THRA
-ΔCT calculated from data of qPCR to compare stages
Acknowledgements
I want to thank Dr. Sean Georgi for his time, patience,
knowledge, and dedication in seeing this project through
completion.
( ( F 1 . 0 7 1 ) = 0 . 8 9 5 9 , P = 0 . 4 2 3 4 ) . E r r o r b a r s r e p r e s e n t s t a n d a r d d e v ia t io n .
0
-5
-1 0
-1 5
-2 0
TH+
TH-
P r e s e n c e o f T h y r o id H o r m o n e
F ig u r e 2 . E x p r e s s io n o f T H R A a t s t a g e 3 5 , a f t e r p e r f o r m in g c e ll c u lt u r e
Literature Cited:
Hamburger, V. Hamilton, H. 1951. A series of normal development in the
development of the chick embryo. Developmental Dynamics. 195:231-272.
La Torre, A. Georgi, S. Reh, T.A. 2013. Conserved microRNA pathway regulates
developmental timing of retinal neurogenesis. Proc Natl Acad Sci U S A. . 11026:E2362-E2370
Mader, MM. Cameron, DA. 2006. Effects of induced systemic hypothyroidism upon
the retina: regulation of thyroid hormone receptor alpha and photoreceptor
production. Molecular Vision. 12:915-30.
Wallace, V.A. 2011. Concise Review: Making a retina-From the building blocks to
clinical applications. Stem Cells 29:412-417.
o n e - w a y A N O V A , w it h n o s t a g e b e in g s ig n if ic a n t ly d if f e r e n t
M ean  C T
Goals:
-Determine if there is any differences of expression
levels of THRA across the timespan of retinal
development in chicken embryos
f o r 4 8 h o u r s w it h ( T H + ) a n d w it h o u t ( T H - ) t h y r o id h o r m o n e ( n = 3 p e r
g r o u p ) , c o m p a r e d b y  C T v a lu e .  C T w a s c a lc u la t e d b y s u b t r a c t in g
T H R A v a lu e f r o m G A P D H v a lu e , a s d e t e r m in e d b y q P C R m a c h in e . A
t - t e s t w a s p e r f o r m e d , a n d d e t e r m in e d t h e r e w a s n o s ig n if ic a n t
d if f e r e n c e b e t w e e n t h e t w o g r o u p s ( P = 0 . 5 3 7 7 ) . E r r o r b a r s r e p r e s e n t
s t a n d a r d d e v ia t io n .
Amplification Plot of qPCR including (from left to right) GAPDH, THRA, and RT-
Retinal Explants Treated with Thyroid Hormone:
-Used previously determined primers
-Dissected retinas from embryos at stages 35 (n=6)
-Cultured retinas, 3 with thyroid hormone (50 ng/mL) and
3 without for 48 hours in DMEM-F12 cell culture media
-Processed into cDNA, as done with other samples
-qPCR performed on all samples
-ΔCT calculated
Conclusions:
-THRA is equally expressed across the timespan of
development in chicken embryos
-The presence/lack of thyroid hormone has no effect on
expression of THRA in chicken embryos