Supporting Data Download

Transcript
Supporting references
1.
Singh A, Misra V, Thimmulappa RK, Lee H, Ames S, Hoque MO, et al.
Dysfunctional KEAP1-NRF2 interaction in non-small-cell lung cancer. PLoS Med.
2006;3:e420.
2.
Hussain SP, Amstad P, Raja K, Sawyer M, Hofseth L, Shields PG, et al.
Mutability of p53 hotspot codons to benzo(a)pyrene diol epoxide (BPDE) and the
frequency of p53 mutations in nontumorous human lung. Cancer Res. 2001;61:6350-5.
3.
Dai B, Yoo SY, Bartholomeusz G, Graham RA, Majidi M, Yan S, et al. KEAP1dependent synthetic lethality induced by AKT and TXNRD1 inhibitors in lung cancer.
Cancer Res. 2013;73:5532-43.
4.
Takahashi T, Carbone D, Takahashi T, Nau MM, Hida T, Linnoila I, et al. Wildtype but not mutant p53 suppresses the growth of human lung cancer cells bearing
multiple genetic lesions. Cancer Res. 1992;52:2340-3.
5.
Pauwels B, Korst AE, Pattyn GG, Lambrechts HA, Van Bockstaele DR,
Vermeulen K, et al. Cell cycle effect of gemcitabine and its role in the radiosensitizing
mechanism in vitro. Int J Radiat Oncol Biol Phys. 2003;57:1075-83.
6.
You L, Yang CT, Jablons DM. ONYX-015 works synergistically with
chemotherapy in lung cancer cell lines and primary cultures freshly made from lung
cancer patients. Cancer Res. 2000;60:1009-13.
7.
Das GC, Holiday D, Gallardo R, Haas C. Taxol-induced cell cycle arrest and
apoptosis: dose-response relationship in lung cancer cells of different wild-type p53
status and under isogenic condition. Cancer Lett. 2001;165:147-53.
8.
Uematsu K, He B, You L, Xu Z, McCormick F, Jablons DM. Activation of the Wnt
pathway in non small cell lung cancer: evidence of dishevelled overexpression.
Oncogene. 2003;22:7218-21.
9.
Abazeed ME, Adams DJ, Hurov KE, Tamayo P, Creighton CJ, Sonkin D, et al.
Integrative radiogenomic profiling of squamous cell lung cancer. Cancer Res.
2013;73:6289-98.
10.
Cavazzoni A, Petronini PG, Galetti M, Roz L, Andriani F, Carbognani P, et al.
Dose-dependent effect of FHIT-inducible expression in Calu-1 lung cancer cell line.
Oncogene. 2004;23:8439-46.
Supporting figure legends
Figure S1. siRNA#3 and siRNA#5 specifically reduce the protein levels of Nrf2 and
HMOX1 without affecting ERK and p53.
Figure S2. The protein levels of NRF2 and the phosphorylated form of the extracellular
signal-regulated kinase (p-ERK; a readout of KRAS activation) in several lung cell lines.
Cell lysates were subjected to immunoblot analysis with anti-Nrf2, anti-ERK and an
antibody specific for phosphorylated ERK.
Table S1. Cisplatin toxicity as a function of KRAS, NRF2, KEAP1, and P53. The
response to cisplatin-mediated toxicity of the listed NSCLC was measured by functional
impairment of mitochondria using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) method. LD50s are listed. The coding regions of NRF2 and KRAS were
sequenced and the status of each gene is listed. The mutation information for KEAP1
and TP53 was obtained from the literature. The references can be found in the
supporting references according to the numbers in the table.
Figure S3. Identification of a TRE (TGCGTCA) in the promoter of NRF2. The different
human NRF2 promoter constructs were cloned upstream of a luciferase reporter gene
(the sites where primer pairs bind are illustrated). These constructs were co-transfected
into HEK293 cells alone with an empty vector, KRASDN, KRASG12D or KRASWT
expression vector for 48h. Dual luciferase activities were measured. The experiment
was repeated three times, each with triplicate samples. Data are expressed as mean ±
SEM (*p  0.05 Ctrl group vs. KRAS) (left panel).
Figure S4. Larger images of the IHC analyses shown in Figure 2B.
Figure S5. Larger images of the IHC analysis shown in Figure 5D, left panel.
Figure S6. Larger images of the IHC analysis shown in Figure 5D, right panel.
Table S2. The percentage of mice with adenocarcinomas from each group.
Figure S7. The average number of lesions (AHH+adenomas vs. adenocarcinomas).
Supporting Materials and Methods
Construction of recombinant DNA molecules
The KRASG12D expression vector was constructed by cloning a PCR-generated
fragment containing the entire open reading frame of KRASG12D from the original
template RCAS-KRASG12D purchased from Addgene (# 11549) and inserting into the
EcoR I/Xho I sites of pcDNA 3.1 (Invitrogen), using the following primers: sense,
AAGAATTCAGATCGATATGACTGAG;
antisense,
AACTCGAGAACTAGTGGATCCCCCG. The wildtype form of KRAS (KRASWT) without
the mutation from G to A at the 12th amino acid position and dominant negative form
(KRASDN) with the mutation from S to N at the 17th amino acid position in pcDNA 3.1
were constructed by PCR and standard recombinant DNA techniques. The sequences
were confirmed by direct nucleotide sequencing. Deletion fragments of the NRF2
promoter sequence were amplified by PCR using a human genomic DNA extracted
from human bronchial epithelium cells and then cloned into the Kpn I/Xho I sites of
pGL4.22 (Promega). The positions of PCR primers are shown in Figure 3A. The primer
sequences are as follows:
F0, ACGTGGTACCGAAATTTGTAAAGAGTAAAC;
F1, GAAGGGTACCATCTGTGGCGTGGTGGCTGC;
F2, TCAGGGTACCTGCGAACACGAGCTGCCGGA;
F3, TCAGGGTACCGCAGCTCCTACACCAACGCC;
F4, TGGCGGTACCTTCCCGCCCCCGGACCGCGA;
F5, CCGGGGTACCCGGAGGAGCCGCCGACGCAG;
R1, GGACCTCGAGTTGGGGCTCCCCGACGGCGG;
R2, CCAGCTCGAGTCCCAGCAGGCGGGGGACCT;
R3, CTGTCTCGAGTGTGTTGGGGCTCCCCGACG;
R4, GGTGCTCGAGGCGTCGGCGGCTCCTCCGGG;
R5, GGCACTCGAGCGGGCCCTTCCTTCCCCCGC.
The fragment named “TRE”, which is located from 267 to 273 nt in NRF2’s promoter
sequence including a sequence similar to AP-1 recognition site (“TGCGTCA”), was
purchased (Sigma), and inserted into the Kpn I/ Xho I sites of pGL4.22 after endrepairing and annealing the two oligos together.
mRNA extraction and real-time quantitative reverse transcription-PCR (qRT-PCR)
Total mRNA was extracted using TRIzol (Invitrogen) according to the manufacturer’s
instructions. Using equal amounts of mRNA and the Transcriptor first-strand cDNA
synthesis kit (Promega), cDNA was generated and used for real-time qRT-PCR. The
following TaqMan probes were obtained from the universal probe library (Roche):
human NRF2, #70; HMOX1, #25; GCLM, #18; and GAPDH, #25. Both the forward and
the reverse primers for human NRF2, HMOX1, GCLM, AND GAPDH were synthesized
by Sigma and the sequences were as follows: NRF2, ACACGGTCCACAGCTCATC
(Forward)
and
TGTCAATCAAATCCATGTCCTG
(Reverse);
HMOX1,
AACTTTCAGAAGGGCCAGGT (Forward) and CTGGGCTCTCCTTGTTGC (Reverse);
GCLM,
GACAAAACACAGTTGGAACAGC
(Forward)
and
CAGTCAAATCTGGTGGCATC (Reverse) and GAPDH, CTGACTTCAACAGCGACACC
(Forward) and TGCTGTAGCCAAATTCGTTGT (Reverse). The real-time PCR was
performed as follows: 1 cycle of predenaturation (94°C for 5 min), 40 cycles of
amplification (94°C for 10 s and 60°C for 20 s), and a cooling program of 50°C for 30 s.
Reactions for each sample were done in duplicate, and the experiment was repeated
three times. The data are expressed as relative mRNA levels and were normalized to
GAPDH.
Quantification of cDNA amount for Nrf2, Keap1, Nqo1, Akr1b10, Akr1c1, Gclm, Hmox1
and β-actin in each tissue sample was performed with KAPA SYBR FASR qPCR Kit
(Kapa Biosystems). All primer sets were designed with Primer 3 free online software.
The primers were synthesized by Sigma and the sequences were as follows: Nrf2,
CTCAGCATGATGGACTTGGA
(Reverse);
Keap1,
and
Akr1c1,
TCTTGCCTCCAAAGGATGTC
(Reverse);
Nqo1,
(Forward)
and
(Reverse);
(Reverse);
Gclm,
and
Akr1b10,
GGCCATGTCCTCCTCACTTA
GGAGGCCATGGAGAAGTGTA
GCACACAGGCTTGTACCTGA
(Forward)
GGTAGCGGCTCCATGTACTC
AGACCTGGAAGCCACAGAAA
AGAGGACTGCAGCACAGGTT
(Reverse);
and
GATCGGCTGCACTGAACTG
GGCAGTGTGACAGGTTGAAG
(Forward)
(Forward)
(Forward)
and
TCCCATGCAGTGGAGAAGAT
(Forward)
and
AGCTGTGCAACTCCAAGGAC
GAGCCTGAATCGAGCAGAAC
(Reverse);
and
β-actin,
(Forward)
and
(Reverse);
Hmox1,
CTCGGCTTGGATGTGTACCT
AAGGCCAACCGTGAAAAGAT
(Forward)
and
GTGGTACGACCAGAGGCATAC (Reverse). The real-time PCR was performed as
follows: 1 cycle of predenaturation (95°C for 3 min), 40 cycles of amplification (95°C for
5 s and 60°C for 20 s and 72°C for 5 s), melting curve (95°C for 5 s, 65°C for 1 min and
97°C continuous), and a cooling program of 40°C for 30 s. Mean crossing point (Cp)
values and SEM were determined. Cp values were normalized to the respective
crossing point values of mβ-actin reference gene. Data are presented as the fold
change in gene expression compared to the control group. All reporter gene and RTPCR analyses were repeated in three independent experiments and in duplicates. Data
are all shown as mean ± SEM.
Immunoblot analysis
For detection of protein expression in total cell lysates, cells were washed with
phosphate-buffered salt (PBS) buffer and lysed with sample buffer (50 mM Tris-HCl (pH
6.8), 2% sodium dodecyl sulfate (SDS), 10% glycerol, 100 mM dithiothreitol (DTT),
0.1% bromophenol blue) after indicated treatment. For detection of protein expression in
the lung tissue samples, tissues were homogenized in 1 x sample buffer (50 mM TrisHCl (pH 6.8), 2% sodium dodecyl sulfate (SDS), 10% glycerol, 100 mM dithiothreitol
(DTT), and centrifuged at 12,000 g at 4°C for 15 min to move debris. Then lysates were
boiled, sonicated, and used for electrophoresis and immunoblot.